Team:ETH Zurich/Experiments

From 2013.igem.org

Header2.png
80px-Eth igem logo.png

Contents

Final Circuit

For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.



Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.


Cloned Constructs

To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.

Fluorescent protein reporter constructs
Description Cloning Maps
1 Receiver cell construct for GFP diffusion experiments Plac-LuxR-pLuxR BBa_J09855 backbone (SpeI, PstI) and BBa_E0840 insert (XbaI, PstI) 300px][File:Pla2.png
2 Library of the Receiver cell constructs Using the Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities
Primers:
5'-tatactagagacnnntaggatcgtacag
5'-gatcgtannngtttacgcaagaaaatg
5'-tagagacnnntaggatcgtannngtttacgcaagaaaatg
5'-tagagaccnntaggatcgtanangtttacgcaagaaaatg
5'-tagagacctntaggatcgtacangtttacgcaagaaaatg
Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.
Pla3.png
3 Receiver cell construct for GFP experiments without the LuxR generating part BBa_R0062 backbone (SpeI, PstI) and BBa_E0840 insert (XbaI, PstI) Pla4.png
Pla5.png
4 Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.
Oligos:
5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct
5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt
Pla6.png
5 Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from BBa_J23118 Pla7.png



LuxI generating constructs
Description Cloning Maps
6 Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments BBa_J23100 backbone (SpeI, PstI) and BBa_K805016 insert (XbaI, PstI) Pla8.png
Pla9.png
7 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments BBa_J23118 backbone (SpeI, PstI) and BBa_K805016 insert (XbaI, PstI) Pla8.png
Pla9.png
8 Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments BBa_J23110 backbone (SpeI, PstI) and BBa_K805016 insert (XbaI, PstI) Pla8.png
Pla9.png
9 Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments BBa_J23114 backbone (SpeI, PstI) and BBa_K805016 insert (XbaI, PstI) Pla8.png
Pla9.png


LuxR generating constructs
Description Cloning Maps
10 constitutive LuxR generating biobrick Plac-LuxR-pLuxR BBa_J09855 Pla10.png
11 constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations BBa_F2621 Pla11.png
12 negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system BBa_R0063 backbone (SpeI, PstI) and BBa_J24679 insert (XbaI, PstI) Pla12.png



pLuxR constructs
Description Cloning Maps
13 Library of pLuxR promoter variants in pSB1C3 backbone for cloning The promoter variants were chosen after characterization and sequencing with the GFP receiver library. The sequences were ordered as custom-made oligos and inserted into pSB1C3 using EcoRI and PstI restriction sites.
Oligos:
5'-accagtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accggtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-acccgtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accagtaggatcgtaaaggtttacgcaagaaaatggtttgttatagtcgaataaa
5'-accagtaggatcgtataggtttacgcaagaaaatggtttgttatagtcgaataaa
Pla13.png


Hydrolase constructs
Description Cloning Maps
14 Aes coding region with RBS in SB1C3 backbone BBa_K1216002 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattaaagctgagcggtaaagaactgag
Pla14.png
15 Aes-His coding region with RBS in SB1C3 backbone BBa_K1216006 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla15.png
16 GusA coding region with RBS in SB1C3 backbone BBa_K1216000 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattattgtttgcctccctgctgcg
Pla16.png
17 GusA-His coding region with RBS in SB1C3 backbone BBa_K1216004 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla17.png
18 PhoA coding region with RBS in SB1C3 backbone BBa_K1216001 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattacttcaggcccagcgccgctttc
Pla18.png
19 PhoA-His coding region with RBS in SB1C3 backbone BBa_K1216005 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat
5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc
Pla19.png
20 NagZ coding region with RBS in SB1C3 backbone BBa_K1216003 was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.
Primers:
5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc
5'-gtttcttcctgcagcggccgctactagtattattactcgtgacctgctttctcttc
Pla20.png
21 constitutive expression of PhoA for non-mine cells constitutive promoter BBa_J23100 (SpeI, PstI) backbone and BBa_K1216001insert (XbaI, PstI) Pla21.png
Pla22.png
22 constitutive expression of NagZ for mine cells constitutive promoter BBa_J23100 (SpeI, PstI) backbone and BBa_K1216003insert (XbaI, PstI) Pla23.png
Pla24.png
23 AHL inducible expression of GusA Plac-LuxR-pLuxR BBa_J09855 (SpeI, PstI) backbone and BBa_K1216000insert (XbaI, PstI) Pla25.png
Pla26.png
24 AHL inducible expression of GusA with positive feedback loop for LuxR expression Plac-LuxR-pLuxR BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.
Oligos:
5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga
5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa
5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct
5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt
Pla27.png
Pla28.png
25 AHL inducible expression of Aes Plac-LuxR-pLuxR BBa_J09855 (SpeI, PstI) backbone and BBa_K1216002insert (XbaI, PstI) Pla29.png
26 AHL inducible expression of Aes with mutant pLux promoter Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and BBa_K1216002 (SpeI,PstI) insert Pla30.png




Groupparts / Biobricks

In the following table you can find all the biobricks that were submitted by our group.


Loading.....