Team:Heidelberg/Templates/DelH overview16

From 2013.igem.org

Vector Maps and Primers

1st Strategy: DelH & pSB6A1 without mRFP

Identifier Order date Note Sequence
HM17:DelH_Terminator_BB_fw 16-08-2013 Amplification of Backbone pSb6A1-lacI-mRFP ATTGGCGCTGGAGTACGCGCTGGACTGA
aggcatcaaataaaacgaaaggctcag


2nd Strategy: DelH & Tetracycline Resistance & pSB6A1 without mRFP

Identifier Order date Note Sequence
HM14:DelH_tetR_fw2013-08-16 Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag
HM15:tetR_stop_BB_rev2013-08-16 Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg
HM16:tetR_pSB6A1_fw2013-08-16Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag


Additional Screening Primer

Identifier Order date Note Sequence
HM13:Screen_DelH_end_fw2013-08-16 New screening primer for the end of DelH together with the VR2 primer from the registry TTTCTGACGACCCTGCACCTGAAG