From 2013.igem.org
29-04 - 05-05-13
Generation of Plasmid Backbones
Transformation of Biobricks
Part of the registry | Plate of 2012 | Well | Resistance
|
pSB4K5 (insert=J04450) | 1 | 5G | Kanamycin
|
pSB6A1 (insert=J04450) | 1 | 1K | Ampicillin
|
lacZ (I732019) in pSB1AK3 | 4 | 12G | Kanamycin, Ampicillin
|
AraC (I0500) in pSB2K3 | 1 | 14N | Kanamycin
|
pSB1C3 (insert=J04450) | 1 | 3A | Chloramphenicol
|
- Added 10 µl H2O to each well
- Incubated for 10 min at RT
- Thawed 5x chemical competent E.coli Top10
- 3 µl of plasmid DNA were added
- Incubated for 10 min on ice
- Heat shock for 40 s at 42.2°C
- Incubated for 10 min on ice
- Added 500 µl LB Medium
- Incubated at 37°C for 40 min
- Centrifuged 120 at 5,000 rpm, supernatant discarded
- Pellet resuspended in remaining medium
- Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
- Incubated for 2 days at RT
- One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above
Result
All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.
Amplification of DelH Fragments
Design of Primers
Identifier | Order date | Note | Sequence
|
DN01:DelH_f1_PacI_fw | 03-05-2013 | Amplification of DelH F1, with RBS and adding PacI restriction site | TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
|
DN02:DelH_f1_SalI_rev | 03-05-2013 | Amplification of DelH F1 until SalI restriction site | TTTT GTCGACCAACACCTGTGCCTGC
|
DN03:DelH_f2_SalI_fw | 03-05-2013 | Amplification of DelH F2 starting at SalI restriction site | TTTT GTCGACTGGATGGAGCCTGGTGAAAG
|
DN04:DelH_f2_KpnI_rev | 03-05-2013 | Amplification of DelH F2, adding KpnII restriction site | TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
|
DN05:AraCbb_KpnI_fw | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site | TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
|
DN08:AraCbb_PacI_rev | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site | TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG
|