Team:Paris Bettencourt/Notebook

From 2013.igem.org

Please be patient. It may take a few seconds to load

Detect

Saturday 13th July

PCR circular and linear, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert, Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

ReagentVolume
1x
Nuclease-free water37.25 ul
5x Phusion HF Buffer10 ul
10 mM dNTPs1 ul
Forward Primer (10 uM)0.5 ul
Reverse Primer (10 uM)0.5 ul
Template Plasmid0.25 ul
Phusion DNA Polymerase0.5 ul
Total Volume50 ul


Thermocycler Protocol: NEB Phusion
TempTime
Start98°C30 secMelt
Cycle 198°C5 secMelt 35 cycles
Cycle 240.5°C / 60°C 25 secAnneal
Cycle 372°C5 minExtend
Finish72°C5 minExtend
Store10°CForeverStore


Conjugation of XL-10 (with sSP011)
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare tube (in BD tubes) :
- Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)
6) Incubate overnight at 37°C


Patches
check and make new ones


Digestion M13 backbone, RFP insert
for Backbone (M13mp18 plasmid): 3ug
7,58 ul plasmid (c=395ng/ul)
3 ul EcoRI
3 ul PstI
3ul 10x Fast Digest
13,42 ul H20
incubate for 12 min on 37°
heat inactivation: 80° 5 min
for insert (BBa_J04450): 5ug
31,4 ul plasmid
5 ul EcoRi
5 ul PstI
3,6 ul H20
incubate for 20 min at 37°
heat inactivation: 80° 5min

Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)
100V, 20 min 1% gel

Detect

Sunday 14th July

Gel of PCR, Gel Extraction, DpnI digest of PCR products and PCR purification

Gel of PCR (Amp 60° circ, lin, Chl 40.5 circ, lin)
100V, 20 min 1% gel

Gel of Digest
100V, 20 min 1% gel

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.


DpnI digest of PCR products:
SPCR4 (40ul) - add 1 ul DpnI
SPCR 7 (150ul) - add 3 ul of DpnI
SPCR8 (60 ul) - add 3 ul of DpnI
SPCR 9 (150ul) - add 3 ul of DpnI
SPCR10 (110ul) - add 3 ul of DpnI
Incubate for 15 min at 37°C


PCR purification
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

Monday 15th July

Plating and control of antibiotic resistance.

We made a 1:1000 dilution of KAN (stand.c) in an LB solid media.

Pouring the plates. Around 20 mL/plate
1. KEIOΔPYR KANR Growth
2. ME1655 KANR No growth

Conclusion :

The KEIOΔPYRF growed as expected. Negative control did not growth.
Plates have KAN antibiotic
KEIO has KAN R.

Detect

Tuesday 16th July

We prepared a colony PCR to send the KAN for sequencing, to know exactly the sequence of the KAN.

KEIOΔMPYRF has a deletion of PYRF to be replaced by KAN
We pitched 4 singles colonies into 50µL of H2O
Boil 5 minutes at 95°C
1,5 µL of this can be used directly for PCR

PCR reaction
Keep all the regents at 4°C while preparing the mixture

ReagentVolume
JW 182 (10 uM)
JW 183 (10 uM)
Template DNA
Quick-load Tag 2x Master Mix
Nuclease free water
0,5 µL
0,5 µL
1,5 µL
12,5 µL
10 µL
Total volume25 µL


Thermocycler Protocol : NEB Quick-Load

Temperature Time
Start

Cycle1
Cycle 2
Cycle 3

Finish
Store
95°C

95°C
50°C
68°C

68°C
10°C
30 seconds

15 seconds
30 seconds
1 minute/kB

5 minutes
Forever
melt

melt
anneal
extend - 35 cycles

extend
store

Gel electrophoresis

We do it to prove that our colony PCR was successful. We expect a band at about 800 base pairs.
Our gel is 1%, therefore we used 0,5g agarose in 100µL TAE buffer.
As a ladder, we used a 1kB plus gene ruler of fermentor.
We l the gel with 5 µL sample ans we kept the sample at 4°C.

PICTURE

We see that the band are as expected. THis is an indicator that KAN is at the right place. The sequence has then been sent for sequencing

Transformation of PAUC 18 into a NEBΔturbo clearing cells
We are transforming PAUC 18 that consist in a low ORI and ampicillin resistance
We will use commercialized NEB turbo competent cells as well as freshly made chemical competent cells
We did this to check the competency of our fresh competent cells

NOTE : EVERYTHING HAS TO BE KEPT ON ICE AND NO VORTEX

Throw competent cells on ice. Those can be prepared using the CaCl2 protocol
Place 20 µL of cells in a pre-chilled Eppendorf tube
For an intert vector, add 0,5 µL or less to the chilled cells
For a ligation product, add 2-3 µL to the chilled cells
Mix gently by flicking the tube
Chill on ice for 10 minutes - this step is optional but can improve yields when transforming a ligation product
Heat shock at 42°C for 30 seconds
Return on ice for 2 minutes
Add 200µL LB medium and recover the cells by shaking at 37°C
Another rich medium can substitute for the recovery. The recovery time varies with the antibiotic selection
Ampicillin : 15 - 30 minutes

Place out the cells on selective LB
Use glass beads to spread the cells. The volume of cells plated depends on what is being transformed

For an intact vector
High transformation efficiencies are expected. Plating out 10 µL of recovered cells should produce many colonies.

Note : 200 µL is the maximum volume of liquid that an LB plate can absorb
Incubate at 37°C. Transformants should appear within 12 hours

Conclusion
The BL 21 DE3 strain showed IP colonies
For the new NEB turbo cells, we see no colony
The old NEB turbo cells worked fine

Detect

Wednesday 17th of July

PCR purification

We are purifying the colony PCR from yesterday to send it away for sequencing

Procedure
Add 1.1 volume and Binding Buffer
Transfer up to 800 µL. Centrifuge for 30-60 seconds. Descend the flow through
Add 700 µL of washed Buffer. Centrifuge for 30-60 seconds
+ 1 min centrifuge to completely remove any residual wash buffer
Add 50 µL of Elution Buffer to the center of the Gene JT purification column membrane and centrifuge for 1 minute
Discard the Gene JET purification column and store the purified DNA at -20°C.

Detect

Thursday 18th July

Calculating the transformation efficiency for the E.coli NEB and E.coli NNEB strains.

· 20 µL of cell culture was inoculated in 200 µL of LB, where 0.5 µL of DNA sample (?) was added, giving the total volume of 220.5 µL.
· After the heat shock transformation 10 µL of the culture was diluted in 90 µL of LB, giving the 10-1 dilution (d); then 10 µL of this dilution was transferred in 90 µL of LB, giving the 10-2 dilution. 10 µL of each dilution (v) was plated on ampicillin media and left for incubation (24 h, 37 ̊C).


· After incubation, colonies were counted:
NEB NNEB
10 0 433
0 368
Average 0 400.5
10 0 62
0 40
Average 0 51

Obviously, NEB strain was not transformed and only NNEB was included in further calculations.
· The number of the transformed colony forming units per mL of the culture was calculated following the formula: colony number / d*v.

Calculation from the 10-1 dilution: 0.4 * 109 CFU/mL
Calculation from the 10-2 dilution: 0.51 * 109 CFU/mL

· The transformation efficiency was calculated by dividing the number of transformed colony forming units (CFU) by the amount of the DNA used (mDNA).

CFU1 = 0.4 * 109 CFU/mL * 0.22 mL (total V of the transformation culture) = 0.088*109 CFU
CFU2 = 0.51 * 109 CFU/mL * 0.22 mL = 0.1122*109 CFU

The concentration of the DNA solution which was used was 0.323 µg/µL, while the total DNA mass which was added to the transformation culture was: 0.323 µg/µL * 0.5 µL = 0.1615 µg.

So the transformation efficiency, calculated from the 10 times diluted (TE1) and 100 times diluted (TE2) cultures is:

TE1 = CFU1/mDNA = 0.55 * 109 CFU/µg
TE2 = CFU2/mDNA = 0.69 * 109 CFU/µg

TE1 and TE2 are almost the same

Detect

Monday 22nd July

Culture purification by streak plate method and preparing the glycerol stock for the sSP001 (TN 57) and sSP002 (NEC) strains.

Place your note here

Detect

Tuesday 23rd July

Colony PCR

· Strain: Keio ΔpyrF
· Primers: JW182 and JW183
· Amplified region: kanamycine resistance gene




Detect

Monday 29th July


Liquid culture of:
pCOLA DUET (from glycerol stock of Sabotage Group) - 20 ml culture
pSSB1 (from plate) - 5 ml culture
pSSB2 (from plate ) - 5 ml culture

Plating of addgene bacteria containing the plasmids we want:
streak out bacteria from addgene to get single colonies:
pBAC-BA-lacZ
pCRISPR
pCas9
pCRIPSR::rpsL

Detect

Tuesday 30th July

Liquid culture, Miniprep and Glycerol stock

Liquid culture of:
pCOLA DUET (from liquid culture (29.07.13)) - 20 ml culture
pSSB1 (from liquid culture (29.07.13)) - 5ml culture
pSSB2 (from liquid culture (29.07.13)) - 5 ml culture
pBAC-BA-lacZ (from plate ) - 5 ml culture
pCRISPR (from plate ) - 5 ml culture
pCas9 (from plate ) - 5 ml culture
pCRIPSR::rpsL (from plate ) - 5 ml culture
F+ strain - (from glycerol stock Sabotage) - 10 ml culture
Keio Keio delta pyrF (from plate ) - 10 ml culture


Miniprep (pCOLA-DUET = sSP007) using the Thermo Scientific Miniprep Kit

1) Pellet 2x9 ml of liquid culture (4000 rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µL of resuspension solution
4) add 250 µL of lysis solution, mix by inverting 4-6 times
5) add 350 µL of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5 ml tube
11) add 50 µL of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

pSP001= pCOLA-DUET: 65 ng/ul



Glycerol Stock
from overnight culture of MG1655-pCOLA-DUET (sSP007)
Centrifuge 4000 rpm, 10 minutes,
take out liquid
resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB
freeze in -80°C

Detect

Wednesday 31st July

Conjugation, Miniprep addgene plasmids,Glycerol Stock of addgene plasmids



Conjugation

sSP001, SP002, keio Delta PyrF
F+ comes from XL1 Blue (glycerol stock Sabotage) => F+ is tetR

Protocol :
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare 4 tubes (in BD tubes) :
- Tube 1 = 0,5 mL LB with Strain 1 (sSP001) ,5 mL LB = control
- Tube 2 = 0,5 mL LB with Strain 2 (sP001) + 0,5 mL LB = control
- Tube 3 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB = control
- Tube 4 = 0,5 mL LB with Strain 4 (XL1) + 0,5 mL LB = control
- Tube 5 = 0,5 mL LB with Strain 1 (sSP001) + 0,5 mL LB with Strain 4 (XL1)
- Tube 6 = 0,5 mL LB with Strain 2 (sSP002) + 0,5 mL LB with Strain 4 (XL1)
- Tube 7 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB with Strain 4 (XL1)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 10ul for controls, 100uL, 10ul for mixed tubes on LB antibiotics (Tube 5: Chl + Tet, Tube 6: Chl + Tet, Tube 7: Kan + Tet)
6) Incubate overnight at 37°C

Miniprep addgene plasmids
1) Pellet 4 ml of liquid culture (4000 rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µL of resuspension solution
4) add 250 µL of lysis solution, mix by inverting 4-6 times
5) add 350 µL of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove leftover liquid
10) transfer the column on a 1.5 ml tube
11) add 50 µL of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

See Database for plasmid reference
pCas9:
pCRISPR:
pBac-LacZ:
pCRISPR::rpsL:

Glycerol Stock of addgene plasmids
(see Database for strain reference)
from overnight culture
Centrifuge 4000 rpm, 10 minutes,
take out liquid
resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB
freeze in -80°C

Detect

Thursday 1st August

PCR (gradient + usual) of SPCR1, SPCR7, SPCR8, SPCR10, SPCR9, SPCR4

ReagentVolume
1x
Nuclease-free water37.25 µL
5x Phusion HF Buffer10 µL
10 mM dNTPs1 µL
Forward Primer (10 µM)0.5 µL
Reverse Primer (10 µM)0.5 µL
Template Plasmid0.25 µL
Phusion DNA Polymerase0.5 µL
Total Volume50 µL


Gradient:
Pos 1: 40°
Pos 2: 40,2°
Pos 3: 41,3°
Pos 4: 43,1°
Pos 5: 45,4°
Pos 6: 48°
Pos 7: 50,7°
Pos 8: 53,5°
Pos 9: 56,0°
Pos 10: 58,1°
Pos 11: 59,8°C
(Pos 12: 60,6°)

Usual PCR: 52°

Detect

Friday 2nd August

Place your twit here

Gels with PCR products: 1% Agar
100V 20 Min
10 min staining in BET







Detect

Monday 5th August

Place your twit here

5ml liquid culture with proper antibiotics of:
SSp001 + F+
sSP002 + F+
keio delta pyrF + F+

Gelelectrophoresis: 1% Agar, 100 V 20 min

Detect

Tuesday 6th August

Liquid cultures of sSP008-sSP0011

Detect

Wednesday 7th August

Glycerol Stock of sSP008-sSP0011, M13 Test, Single Colonies, Liquid cultures, PCR and Transformation


Glycerol Stock of sSP008-sSP0011
Take 1.5ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

M13 Test
Plate from ON culture:
1) 1:1000 - sSP012: sSP009 (plate 200ul)
2) 200 ul sSP012
3) 200ul sSp009

Single Colonies
streak out ON culture of sSP012 to get single colonies

Liquid cultures of pir+ E.coli and pKD13 from Jake

PCR of SPCR4, SPCR7, SPCR8, SPCR9, SPCR10 from circuar backbone, directly taken from Biobrick plate

Protocol

ReagentVolume
1x
Nuclease-free water37,25µL
5x Phusion HF Buffer10µL
10 mM dNTPs1µL
Forward Primer (10 µM)0.5µL
Reverse Primer (10 µM)0.5µL
Template Plasmid0.25µL
Phusion DNA Polymerase0.5µL
Total Volume50µL


Thermocycler Protocol: NEB Phusion
TempTime
Start98°C30 secMelt
Cycle 198°C5 secMelt35 cycles
Cycle 240.5°C / 60°C25 secAnneal
Cycle 372°C30 sec per kbExtend
Finish72°C5 minExtend
Store10°CForeverStore


Transformation Biobricks BBa_K649304 (with pSB1C3 backbone) and BBa_J04450 (with pSB1A3 backbone) into NEB Turbo (heat shock trafo)

1) Thaw competent cells on ice.
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8) Incubate at 37 °C. Transformants should appear within 12 hrs.


Result: BBa_J04450: many colonies, BBa_K649304 no colonies, plate rest

Detect

Thursday 8th August

Liquid culture of FR-433 (M13)

Gel of PCR products. 100V 20min 1%

4-7-8-9-10 (40.5°C)- 4-7-8-9-10 (60°C)

Detect

Friday 9th August

Liquid culture, Gel, Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo, Glycerol Stock, Making electro competent cells of pir+ E.coli, Transforming pKD13 into pir+ E.coli, Miniprep NEB turbo with BBa-J04450:, Liquid culture and Patch plates.


Liquid culture
1:1000 from liquid: FR-433 (M13), 10 ml
pir+ E.coli: from plate, 25 ml
XL10: from plate 10 ml

Gel: rest of circular backbone PCR product, 1% Agar, 100V, 20 min
SPCR4-7-8-9-10 (40.5) SPCR4-7-8-9-10 (60.5)
Gel picture:
didn’t work

Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo
1) Thaw competent cells on ice.
2) Place 20 µl of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 µl of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 µl LB medium and recover the cells by shaking at 37 °C.
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8) Incubate at 37 °C. Transformants should appear within 12 hrs.


Glycerol Stock FR-433 (M13) -> sSP012
Glycerol Stock pir+ -> sSP013
Glycerol Stock pKD13 -> sSP014
Glycerol Stock NEB turbo with BBa-J04450 -> sSP015
Take 1.5 ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

Making electro competent cells of pir+ E.coli
Preparation of Electrocompetent Cells
Note: Competent cells should never be vortexed, as this will cause them to lyse and release salts into the media. Resuspend cells by pipetting up and down with a large pasteur pipet. Once they are chilled, cells should be continuously cold.

1) The night before the transformation, start an overnight culture of cells.
pir+ E.coli
2) The day of the transformation, dilute the cells 100X.
100 ml LB
Grow at 30°C for about 90 minutes.
3) When the cells reach an OD600 of 0.2.
4) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8.
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 µl of washed cells per transformation.

Transforming pKD13 into pir+ E.coli
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.


Miniprep NEB turbo with BBa-J04450:
1) Pellet 2x 9 ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250 µl of resuspension solution
4) add 250 µl of lysis solution, mix by inverting 4-6 times
5) add 350 µl of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 µl wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5 ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

J04450: 0ng/ul

Liquid culture of: sSP012
sSP008
sSP009
sSP010
sSP011
sSP001
sSP002
XL-10 = sSP016
sSP017= Litmus

Patch plates of:
sSP010
sSP013
sSP009s
sSP014
sSP012

Detect

Saturday 10th August

Test of M13 and Liquid culture

Test of M13

1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.


Liquid culture:
E1010
J04550

Detect

Sunday 11th August

Patches of sSP001-sSP008, sSP015-18 and Stress experiment (Plate reader)

Patches of sSP001-sSP008, sSP015-18

Stress experiment (Plate reader)
sSP001, sSP002, sSP010, sSP011, sSP012 (M13)
1:1000 bacteria in M9 Glucose
Mitomycin C concentrations: 3,3*10^-3, 1,6*10°-3, 6,6*10°-4, 3,3*10°-4
Quadruplets of bacteria (+phage), Triplets of MMC

See also pipetting scheme in folder Experiments on Dropbox

On culture of FR-433, XL-10, delta pyrF
1:1000 culture at 30°

Detect

Monday 12th August

Glycerol Stock, Miniprep, M13 plate test, Patches

Glycerol Stock sSP018 - NEB with E1010
sSP017
sSP016
Take 1.5ml of ON culture + 500ul Glycerol (60%)
Freeze at -80°C

Miniprep
E1010
J04450

1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

J04450: ng/ul
E1010: ng/ul


M13 plate test
1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Patches
check them and prepare new ones of those that haven’t been done yet

Detect

Tuesday 13th August

PCR circular and linear 40.5°C/ 60°C, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert and Gel of PCR

PCR circular and linear, 40.5°C, 60° of pSB1A3, pSB1C3

ReagentVolume
1x
Nuclease-free water37,25µL
5x Phusion HF Buffer10µL
10 mM dNTPs1µL
Forward Primer (10 µM)0.5µL
Reverse Primer (10 µM)0.5µL
Template Plasmid0.25µL
Phusion DNA Polymerase0.5µL
Total Volume50µL


Thermocycler Protocol: NEB Phusion
TempTime
Start98°C30 secMelt
Cycle 198°C5 secMelt35 cycles
Cycle 240.5°C / 60°C25 secAnneal
Cycle 372°C30 sec per kbExtend
Finish72°C5 minExtend
Store10°CForeverStore


Conjugation of XL-10 (with sSP011)
1) From O/N cultures Dilute strains 1/100 in LB
2) Wait for OD to reach O,2
3) Prepare tube (in BD tubes) :
- Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)
4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)
5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)
6) Incubate overnight at 37°C


Patches
check and make new ones


Digestion M13 backbone, RFP insert
for Backbone (M13mp18 plasmid): 3ug
7,58 ul plasmid (c=395ng/ul)
3 ul EcoRI
3 ul PstI
3ul 10x Fast Digest
13,42 ul H20
incubate for 12 min on 37°
heat inactivation: 80° 5 min
for insert (BBa_J04450): 5ug
31,4 ul plasmid
5 ul EcoRi
5 ul PstI
3,6 ul H20
incubate for 20 min at 37°
heat inactivation: 80° 5min

Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)
100V, 20 min 1% gel




Detect

Wednesday 14th August

Gel of PCR, Gel of Digest, Gel Extraction, DpnI digest of PCR products, PCR purification

Gel of PCR (Amp 60° circ, lin, Chl 40.5 circ, lin) 100V, 20 min 1% gel

Gel of Digest
100V, 20 min 1% gel



Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.


DpnI digest of PCR products:
SPCR4 (40ul) - add 1 ul DpnI
SPCR 7 (150ul) - add 3 ul of DpnI
SPCR8 (60 ul) - add 3 ul of DpnI
SPCR 9 (150ul) - add 3 ul of DpnI
SPCR10 (110ul) - add 3 ul of DpnI
Incubate for 15 min at 37°C


PCR purification
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

Thursday 15th August

Liquid cultures

Liquid cultures:
sSp009
sSP012
sSP016
sSp020
Xgal Bacteria from Aude

Detect

Friday 16th August

Liquid M13 Test, Glycerol Stock, Miniprep

Liquid M13 Test

OD (sSP020=XL10 KanR with F+)=0,557
OD (sSP016=XL10 KanR)=0,515
OD (sSP009= delta pyrF with F+)=0,561
OD(sSP012=FR-433=M13)=0,695

Prepare Falcons containing 500ul of each strain, adding 500ul of 10^-6 dilution of FR-433
add 1ul of IPTG and 1ul of Xgal
Incubate at 37° on shaker

Glycerol Stock sSP019 (pir+ E.coli transformed with pKD13)
sSP020 (XL10 KanR with F+)

Miniprep
sSP019
sSP017

1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

pKD13: 311ng/ul
Litmus 28i: 93ng/ul

Detect

Monday 19th August

Restreak XL-1 Blue Litmus28i, PCR, PCR purification Backbone (M13mp18), Ligation (RFP into M13mp18 backbone), Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo and Test Xgal

Restreak XL-1 Blue Litmus28i

PCR

SPCR5, SPCR6, 49,3°C

ReagentVolume
1x
Nuclease-free water37,25µL
5x Phusion HF Buffer10µL
10 mM dNTPs1µL
Forward Primer (10 µM)0.5µL
Reverse Primer (10 µM)0.5µL
Template Plasmid0.25µL
Phusion DNA Polymerase0.5µL
Total Volume50µL


Thermocycler Protocol: NEB Phusion
TempTime
Start98°C30 secMelt
Cycle 198°C5 secMelt35 cycles
Cycle 240.5°C / 60°C25 secAnneal
Cycle 372°C30 sec per kbExtend
Finish72°C5 minExtend
Store10°CForeverStore


PCR purification Backbone (M13mp18)
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Ligation (RFP into M13mp18 backbone)
3ul Backbone
14 ul Insert
2ul 10x T4 DNA Ligase HC Buffer
1 ul T4 DNA Ligase

Incubate for at least 10min at 22°C


Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo
1) Thaw competent cells on ice.
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 3 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
7) Plate out the cells on LB (200ul)
8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Test Xgal
3ml of Liquid culture with
1) Xgal from iGEM 2012 (Jake) (+IPTG)
2) Xgal from last week (in DMF) (+IPTG)

Detect

Tuesday 20th August

Gel of PCR and Xgal Test

Gel of PCR

1%, 100V, 20min



Result: PCR didn’t work


Xgal Test

MG1655 (of Jake) in liquid culture with Xgal of iGEM 2012, Aude and new one (Anne)

Result:
All cultures turn blue (Aude, less blue)

Detect

Wednesday 21st August

Gradient PCR SPCR5, SPCR6, M13 Test, Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i), Transformation

Gradient PCR SPCR5, SPCR6

ReagentVolume
1x
Nuclease-free water37,25µL
5x Phusion HF Buffer10µL
10 mM dNTPs1µL
Forward Primer (10 µM)0.5µL
Reverse Primer (10 µM)0.5µL
Template Plasmid0.25µL
Phusion DNA Polymerase0.5µL
Total Volume50µL


Gradient:
Pos 1: 40.1°
Pos 2: 40,8°
Pos 3: 42.2°
Pos 4: 44.2°
Pos 5: 46.7°
Pos 6: 49.4°
Pos 7: 52.1°
Pos 8: 54.7°
Pos 9: 57.1°
Pos 10: 59.0°
Pos 11: 60.2°C

M13 Test
Liquid cultures of sSP012 and sSP020
1) 100 μ l of plating bacteria per tube
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.


Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i)
1) The night before the transformation, start an overnight culture of cells.
sSP017 (XL1 Blue Litmus 28i)
2) The day of the transformation, dilute the cells 100X.
100 ml LB Amp.
Grow at 30°C for about 90 minutes.
3) When the cells reach an OD600 of 0.2.
4) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transforming pKD13 into pir+ E.coli
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

Thursday 22nd August

Gel of gradient PCR product (Pictures 6,5,5), PCR purification and pooling, Digestion M13 backbone, RFP insert, Test Digestion in Gel, Gel Extraction, Liquid culture, Purification of Backbone Cloning and Miniprep sSP015.


Gel of gradient PCR product
1%, 100V, 20 min







PCR purification and pooling
Pool all samples that worked
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

c(SPCR5)= ng/ul
c(SPCR6)= ng/ul


Digestion M13 backbone, RFP insert

Backbone/Insert (double the amount)

RegentVolume
Purified Plasmid20 ul
H2O65 ul
10x FastDigest Buffer10 ul
FastDigest Enzyme 1 (EcoRI)2,5 ul
FastDigest Enzyme 2 (PstI)2,5 ul
FastAP Phosphatase0 ul
Total Volume100ul

Digest for 2.5 hours at 37 °C with shaking.


Test Digestion in Gel
1%, 100V, 20 min

Gel Extraction
Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
Discard flow-through and place QIAquick column back in the same collection tube.
To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

c=13,6ng/ul

Liquid culture
sSP015

Purification of Backbone Cloning
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Miniprep sSP015
1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

Friday 23rd August

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC), Microscope, Gradient PCR of SPCR2, Digestion of SPCR 5 and SPCR7 and Purification of Digestion.

Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC)
Dilute ON culture 1:100
Centrifuge (1 min, 10rpm)
Wash 1x with 70% of Volume M9 Glucose
Centrifuge again
Take up in 70% of the VOlume M9 Gluo
100ul in each 96 well plate (see pipetting file)
Add MMC 10ug/ml in corresponding wells and incubate in the plate reader
After 90 min add phages into correscponding wells
put back on the plate reader

Microscope
look at the shape and fluorescence at t=0 of sSP001
look at the shape and fluorescence at=90 mi of sSP001 + 10ug/ml MMC
take photos


Gradient PCR of SPCR2
iSP001 (gblock) and iS002

ReagentVolume
1x
Nuclease-free water37,25µL
5x Phusion HF Buffer10µL
10 mM dNTPs1µL
Forward Primer (10 µM)0.5µL
Reverse Primer (10 µM)0.5µL
Template Plasmid0.25µL
Phusion DNA Polymerase0.5µL
Total Volume50µL


Thermocycler Protocol: NEB Phusion
TempTime
Start98°C30 secMelt
Cycle 198°C5 secMelt35 cycles
Cycle 240.5°C / 60°C25 secAnneal
Cycle 372°C30 sec per kbExtend
Finish72°C5 minExtend
Store10°CForeverStore


Digestion of SPCR 5 and SPCR7
ReagentVolume
Purified PCR Product16 ul
H2O0 ul
10x FastDigest Buffer2 ul
FastDigest Enzyme 11 ul
FastDigest Enzyme 21 ul
Total Volume20 ul
Incubate at 37°C for 1h shaking


Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

Sunday 25th August

Gel of Gradient PCR, Liquid Cultures, Ligation M13 + RFP, Ligation SPCR5, SPCR7, Electrocompetent cells, Gibson Assembly, Transformation (Gibson)and Transformation (Gibson, Ligations.

Gel of Gradient PCR
1%, 100V, 20min



Liquid Cultures
NEB Turbo
XL10

Ligation

Ligation M13 + RFP
0.5ul Vector (M13)
2.6ul Insert (RFP)
5.4ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Ligation SPCR5, SPCR7
1.0ul Vector (SPCR5)
1.5ul Insert (SPCR7)
6.0ul H20
1.0ul T4 buffer
0.5ul T4 Ligase

Incubate ~30min at 37 C

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat. 6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Gibson Assembly

Amount per Reaction
Positive Control**

PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*

Gibson
Assembly Master
Mix (2X)
10 μl

Deionized H2O
XX μl

Total Volume
20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes. After incubation, store the samples on ice or at -20°C for subsequent transformation
Note: Extended incubation up to 60 minutes may help to improve assembly efficiency in some cases (for further details see FAQ section).
Transform NEB 5-alpha Competent E. coli cells (provided with the kit) with 2 μl of the assembly reaction, following the transformation protocol.

Transformation (Gibson)
Thaw competent cells on ice.
Add 2 μl of the chilled assembly product to the competent cells. Mix gently by pipetting up and down or by flicking the tube 4–5 times. Do not vortex.
Place the mixture on ice for 30 minutes. Do not mix.
Heat shock at 42°C for 30 seconds. Do not mix.
Transfer tubes to ice for 2 minutes.
Add 950 μl of room-temperature SOC media to the tube.
Incubate the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.
Warm selection plates to 37°C.
Spread 100 μl of the cells onto the selection plates. Use Amp plates for positive control sample.
Incubate overnight at 37°C.

Transformation (Gibson, Ligations)
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 100 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

Monday 26th August


Picking colonies (Trafo Gibson, BBC SPCR5/7)
chosing 5-7 colonies and start liquid cultures

Detect

Tuesday 27th August

Starting liquid cultures and Miniprep of pS.005 and pS.006.

Starting liquid cultures
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Miniprep of pS.005 and pS.006
1) Pellet 2x 9ml of liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension solution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Colony PCR

ReagentVolume
Forward Primer (10 uM)0,5 ul
Reverse Primer (10 uM)0,5 ul
Template DNA (Miniprep)0,5 ul
Quick-Load® Taq 2X Master Mix12,5 ul
Nuclease-free water10,0 ul
Total volume25 ul

Thermocycler Protocol: Dream Taq Green
Temp Time
Start 95°C 30 sec1 Melt
Cycle 1 95°C 15 sec Melt 35 cycles
Cycle 2 46,8°C 30 sec Anneal
Cycle 3 68°C 1 min per kb Extend cellule 2
Finish 68°C 5 min Extend
Store 10°C Forever Store

Detect

Wednesday 28th August

Gel Colony PCR, Liquid Cultures (1:100), Analytical Digest, Gel Ligation/Gibson, Gel Analytical digest, DpnI digest of SPCR5, SPCR6, SPCR7, Gel DpnI digest, PCR purification of DpnI digested SPCR5, SPCR6, SPCR7, Stress test microscope and M13 Test.

Gel Colony PCR
pS005 (C1-C5) - pS006 (C1-C7)
1% 100V 20 min


Liquid Cultures (1:100)
sSP001, sSP002, sSP010, sSP011, sSP012, sSP020

Analytical Digest

ReagentVolume
Plasmid Miniprep 5 ul
H2O12 ul
c10x FastDigest Buffer2ul
FastDigest Enzyme 10,5 ul
FastDigest Enzyme 20,5 ul
Total Volume 20,0 ul
Digest for 15 minutes at 37 °C with shaking


Gel Ligation/Gibson
pS005 - pS006 - M13/RFP
1% 100V 20min



Gel Analytical digest
pS005 (C1-C5)-pS006 (C1-C7)
1% 100V 20min



DpnI digest of SPCR5, SPCR6, SPCR7
add 4ul of DpnI into each tube, mix and incubate for 1h at 37°C

Gel DpnI digest
let each 5ul run on a gel
1%, 100V 20min

PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Stress test microscope
Dilute ON cultures of sSP001, sSP002, sSP010, sSP011, sSP012 1:100 and incubate up to an OD of 0.3
Take out 2ml of sSP001, sSP002, sSP010, sSP011
add:
sSP001: 10ug/ml MMC
sSP002: 10ug/ml MMC
sSP010: 20ul sSP012 supernatant
sSP011: 20ul sSP012 supernatant

incubate for 90 min

take pictures under the microscope (trans and YFP) of (un-)treated samples


M13 Test
Liquid cultures of sSP012 and sSP020
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

Detect

Friday 30th August

M13 test, DpnI digest (SPCR5,6,7), Gel SPCR5,6,7 and PCR purification of DpnI digested SPCR5, SPCR6, SPCR7

M13 test
dilute ON cultures (NEB turbo, FR-433) 1: 100, grow up to an OD of ~0.6
1) 100 μ l of plating bacteria per tube (OD 0.6)
2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB
3) Put 10 μ l/ 100 μ l of each dilution to the bacteria
4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.
5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes
6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds
7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal
8) Swirl the plate gently to ensure an even distribution of bacteria and agar.
9) Incubate them at 37°C.

DpnI digest (SPCR5,6,7)
add 8ul DpnI per tube and digest for 1h at 37°, shaking

Gel SPCR5,6,7
1%, 100V, 20min


PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

Day Numbersuffix Month

Place your twit here

Place your note here

Detect

Wednesday 4th September

Starting Liquid culture, PCRs, Gel, DpnI digest, Digestion of SPCR5,7, Purification of Digestion, Ligation of SPCR5,7, Gibson Assembly, Making Electrocompetent Cells, Transformation, Redo SPCR12/13 ,

Starting Liquid culture
NEB turbo, grow up to an OD of 0.6

PCRs
SPCR1, SPCR2, SPCR4, SPCR12, SPCR13

Reagant Volume
1x (SPCR2) 11x (SPCR12) 11x (SPCR13) 8x (SPCR1) 8x (SPCR4)
Nuclease-free water 37.25 µl 447 µl 447 µl 335,25µl 335,25µl
5x Phusion HF Buffer 10 µl 120 µl 120 µl 90 µl 90 µl
10 mM dNTPs 1 µl 12 µl 12 µl 9 µl 9 µl
Forward Primer (10 uM) 0.5 µl 6 µl 6 µl 4.5 µl 4.5 µl
Reverse Primer (10 uM) 0.5 µl 6 µl 6 µl 4.5 µl 4.5 µl
Template Plasmid 0.25 µl 3 µl 3 µl 2.25 µl 2.25 µl
Phusion DNA Polymerase 0.5 µl 6 µl 6 µl 4,5 µl 4,5 µl
Total Volume 50 µl 600 µl 600 µl 450 µl 450 µl


for SPCR 12/13 gradient, 2,5 min
for SPCR3, SPCR11 51°, 45s
for SPCR 1, SPCR2, 48,8°, 2 min
for SPCR4, 40,8°, 1 min

Gel
1%, 100V, 20 min

1.small gel (SPCR1,2,3,4,11)
2. big gel (SPCR12)
3. big Gel (SPCR13)







DpnI digest
SPCR 1: add 10ul DpnI
SPCR4: add 10ul DpnI
SPCR2,3,11: add 1 ul DpnI

incubate for 1h at 37°

Digestion of SPCR5,7

Reagent Volume
Purified PCR Product 16 µl
H2O 0 µl
10x FastDigest Buffer 2 µl
XbaI 1 µl
SpeI 1 µl
Total Volume 20.0 µl

Incubate for 1h at 37°, shaking

Purification of Digestion
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Ligation of SPCR5,7

Reagent Volume
Vector 1 µl
Insert 3 µl
H2O 4.5 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl

Incubate at room temperature for ~1h

Gibson Assembly

Amount per Reaction : Positive Control**

PCR Fragment(s)+ linearized vector : 2-10 μl (0.02–0.5 pmols)*

Gibson Assembly Master Mix (2X): 10 μl

Deionized H2O : XX μl

Total Volume : 20 μl

Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice
Insert: 2,4 ul
Vector: 0,6 ul

Making Electrocompetent Cells

1) Start a liquid culture of cells. NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS005, pS006, SPCR3 (IDT plasmid) M13mp18
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Redo SPCR12/13
Reagent Volume
11x (SPCR12) 11x (SPCR13)
Nuclease-free water 447 µl 447 µl
5x Phusion HF Buffer 120 µl 120 µl
10 mM dNTPs 12 µl 12 µl
Forward Primer (10 uM) 6 µl 6 µl
Reverse Primer (10 uM) 6 µl 6 µl
Template Plasmid 3 µl 3 µl
Phusion DNA Polymerase 6 µl 6 µl
Total Volume 600 µl 600 µl


Cycling protocol as usual + gradient + topdown

Detect

Thursday 5th September

Gel, Colony PCR, Topdown PCR and gels

Gel
SPCR12, SPCR13
1%, 100V, 20 min

Pictures: 13/09/05_SPCR12_corresponding primers


13/09/05_SPCR13_corresponding primers



Colony PCR

Reagent Volume
Forward Primer (10 uM)/td> 0.5 ul
Reverse Primer (10 uM) 0.5 ul
Template DNA (from above) 1.5 ul
Quick-Load® Taq 2X Master Mix 12.5 ul
Total Volume 25 ul

Thermocycler Protocol: DreamTaq Green PCR MM
Temp Time
Start 95°C 1 min Melt
Cycle 1 95°C 30 sec Melt 35 cycles
Cyle 2 52.6/46.8 °C 30 sec Anneal
Cycle 3 72°C 1 min per kb Extend
Finish 72°C 10 min Extend
Store 10°C Forever Store

Topdown PCR
SPCR 1,4,12,13

Reagent Volume
x1>/b>
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 0.5 µl
Reverse Primer (10 uM) 0.5 µl
Template Plasmid 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl

increases every cycle 1°C, starting from 40°


Gels
1%, 100V, 20+ Min

Pictures:
13/09/05_colony PCR_pS005_C1-C8_BB verification primers


13/09/05_colony PCR_pS005_C9-C16_BB verification primers


13/09/05_colony PCR_pS006_C1-C8_BB verification primers


13/09/05_colony PCR_pS006_C9-C16_BB verification primers


13/09/05_top down PCR_SPCR1,4,12,13


Detect

Friday 6th September

Place your twit here

Digestions: linearized pSB1C3, linearized pSB1A3, SPCR2, SPCR3, SPCR11

Reagent Volume
Purified PCR Product 16 µl
H2OH2O 0 µl
10x FastDigest Buffer 2 µl
FastDigest Enzyme 1 1 µl
cFastDigest Enzyme 2 1 µl
Total Volume 4 µl


SPCR5, pSB1C3: XbaI/SpeI
SPCR11, pSB1A3, pSB1C3: EcoRI/PstI
SPCR13, pSB1A3, pSB1C3: EcoRI/PstI
SPCR2, pSB1A3, pSB1C3: EcoRI/PstI

1h at 37° shaking

Detect

Saturday 7th September

Ligation, Making Electrocompetent Cells, Gibson Assembly, Transformation, Liquid culture of E1010

Ligation

Reagent Volume
Vector 1 µl
Insert 3 µl
H2O 4.5 µl
Fermentas T4 Ligase Buffer 1
Fermentas T4 Ligase Enzyme 0.5
Total Volume 10 µl


SPCR5, pSB1C3
SPCR11, pSB1A3, pSB1C3
SPCR13, pSB1A3, pSB1C3
SPCR2, pSB1A3, pSB1C3

Incubate at room temperature for 10 minutes.


Making Electrocompetent Cells
1) Start a liquid culture of cells.
NEB turbo
2) dilute the cells 100X.
100 ml LB.
Grow at 30°C for about 90 minutes.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8
Split the culture into 2x 50 ml falcon tubes, on ice.
Centrifuge at 4 °C for 10 min at 4000 rpm.
5) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 2x 25 ml of ice cold water.
Combine the volumes in a single 50 ml falcon tube.
6) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
7) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.



Gibson Assembly

Amount per Reaction
Positive Control**


PCR Fragment(s)
+ linearized vector
2-10 μl (0.02–0.5 pmols)*


Gibson
Assembly Master
Mix (2X)
10 μl


Deionized H2O
XX μl

Total Volume
20 μl



Incubate samples in a thermocycler at 50°C for 15 minutes.
Put on Ice


Transformation pS002 (Chl), pS002 (Amp), pS003 (Amp), pS004 (Chl), pS004 (Amp), pS005 (Chl), pS006-7 (Chl), pS007 (Chl), pS008 (Amp), pS009 (Chl), pS012 (Amp), pS013 (Chl), pS013 (Amp)

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Liquid culture of E1010

Detect

Sunday 8th September

Replating of transformation and Miniprep of E1010

Replating of Transformation

Miniprep of E1010
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

Monday 16th September

Result Cloning, Protocol: E. coli Colony PCR, Extraction of DNA, PCR Reaction and Gels

Result Cloning:
Colonies?
pS002 (Chl): no
pS002 (Amp): yes
pS003 (Amp):yes
pS004 (Chl): no
pS004 (Amp): yes
pS005 (Chl): yes
pS006-7 (Chl): yes
pS006 (Chl): no
pS007 (Chl): yes
pS008 (Amp): yes
pS009 (Chl): yes
pS012 (Amp): yes
pS013 (Chl): no
pS013 (Amp): yes

Protocol: E. coli Colony PCR
Using the Dream Taq Master Mix

Extraction of DNA

1) Pick a single colony into 50 ul of H20.

2) Boil for 5 minutes.

PCR Reaction (pS002 (Chl-Lig), pS005 (Chl-G), pS006-7 (Chl-Lig), pS007 (Chl-G), pS008 (Amp-G), pS009 (Chl-G))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.


Reagent Volume
Forward Primer (10 uM) 0.5 ul
Reverse Primer (10 uM) 0.5 ul
Template DNA (from above) 1.5 ul
Quick-Load® Taq 2X Master Mix 12.5 ul
Nuclease-free water 10 ul
Total Volume 25 ul



Thermocycler Protocol: NEB Quick-Load
Temp Time
Start 95°C 30 sec Melt
Cycle 1 95°C 15 sec Melt 35 cycles
Cycle 2 45.8 °C 30 sec Anneal
Cycle 3 72°C 1 min per kb Extend
Finish 72 °C 15 min Extand
Store 10°C Forever Store



Gels
100V, 25-30 min, 1%

Pictures:
13/09/16_colony PCR_ps007.BMP


13/09/16_colony PCR_pS006-7.BMP


13/09/16_colony PCR_ps005.BMP



Result: didn’t work

Detect

Tuesday 17th September

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent Volume
Forward Primer (10 uM) 0.5 ul
Reverse Primer (10 uM) 0.5 ul
Template DNA (from above) 1.5 ul
Quick-Load® Taq 2X Master Mix 12.5 ul
Nuclease-free water 10 ul
Total Volume 25 ul



Thermocycler Protocol: NEB Quick-Load
Temp Time
Start 95°C 30 sec Melt
Cycle 1 95°C 15 sec Melt 35 cycles
Cycle 2 45.8 °C 30 sec Anneal
Cycle 3 72°C 1 min per kb Extend
Finish 72 °C 15 min Extand
Store 10°C Forever Store




Gels
100V, 30 min, 1%

Pictures: 13/09/17_colony PCR_pS009.JPG


13/09/17_colony PCR_pS008_pS002.jpg


13/09/17_colony PCR_pS003.JPG


13/09/17_colony PCR_pS004.JPG


13/09/17_colony PCR_pS012.JPG


13/09/17_colony PCR_pS013.JPG



Result:
pS003: row 3,5 might have worked -> analytical digest
pS004: all might have worked -> analytical digest
pS013: all might have worked -> analytical digest
pS012: row 3,4,5 might have workes -> analytical digest

Sequencing
Bringing primers/plasmids away for sequencin
Bacbbone, SPCR2 with iS002, iS032, iS028, iS029, iS030

Detect

Wednesday 16th September

Ligations

Ligation

SPCR2 - Chl

Reagent Volume
SPCR2 1 µl
Chl 2,95 µl
H2O 4.55 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR2 - Amp

Reagent Volume
SPCR2 1 µl
Amp 3.4 µl
H2O 4.1 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR3 - Chl

Reagent Volume
SPCR3 1 µl
Amp 1.79 µl
H2O 5.71 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR3 - Amp7
Reagent Volume
Amp 1 µl
SPCR 3 1.56 µl
H2O 5.94 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR5 - Chl

Reagent Volume
SPCR 5 0.5 µl
Chl 4.55 µl
H2O 3.45 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR11 - Chl

Reagent Volume
Chl 1 µl
SPCR11 1.3 µl
H2O 6.2 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


SPCR2 - Amp
Reagent Volume
Amp 1 µl
SPCR11 1.13 µl
H2O 6.37 µl
Fermentas T4 Ligase Buffer 1.0 µl
Fermentas T4 Ligase Enzyme 0.5 µl
Total Volume 10 µl


at 16° for 1h

Transformation
1) Thaw competent cells on ice (Gibson Kit competent cells)
2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
3) Add 2.5 ul of plasmid (from Biobrick stock)
4) Mix gently by flicking the tube.
5) Chill on ice for 10 minutes.
4) Heat shock at 42 °C for 30 seconds
5) Return to ice for 2 minutes.
6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.
Ampicillin: 15-30 minutes
Chloramphenicol: 60-120 minutes
7) Plate out the cells on selective LB (10ul)
8. Incubate at 37 °C. Transformants should appear within 12 hrs.

Gel of Ligation products
1%, 100V, 40 min

Detect

Sunday 22nd September

PCR and Gels

PCR
M13 backbone

SPCR16,17

Reagent Volume
x1
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 0.5 µl
Reverse Primer (10 uM) 0.5 µl
Template Plasmid 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl

Protocol see fotos

Gel 100V, 1%, 1,5h

Detect

Monday 23rd September

Gels and PCR

Gel
100V, 1%, 1,5h

Picture: 13/09/23_SPCR16_17_corresponding primers - PCRs didn't worked


PCR
SPCR 16 (normal phusion at 48°C)

Reagent Volume
x1
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 0.5 µl
Reverse Primer (10 uM) 0.5 µl
Template Plasmid 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl



Thermocycler Protocol: NEB Phusion
Temp Time
Start 98°C 30 sec Melt
Cycle 1 98°C 5 sec Melt 35 cycles
Cycle 2 72°C 30 sec Anneal
Cycle 3 72°C 30 sec per kb Extend
Finish 72 °C 5 min Extand
Store 10°C Forever Store



Detect

Tuesday 24th September

Overlap PCR, PCR of Overlap, Digestion, Gel extraction, Gels, PCR Purification, PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3) and liquid culture

Overlap PCR
SPCR5-SPCR2

Reagent Volume
x1
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Template Plasmid(10 uM) 1 µl
Template Plasmid (10 uM) 1 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl






PCR of Overlap

Digestion
M13 (EcoRI, PstI), pSB1C3 (EcoRI, PstI), psB1C3 (XbaI, SpeI)

Reagent Volume
Purified Plasmid 20 µl
H2O 63 µl
10x FastDigest Buffer 10 µl
FastDigest Enzyme 1 2.5 µl
FastDigest Enzyme 2 2.5 µl
FastAP Phosphatase 2 µl
Total Volume 100 µl


SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI)

Reagent Volume
Purified PCR Product 16 µl
H2O 0 µl
10x FastDigest Buffer 2 µl
FastDigest Enzyme 1 1 µl
FastDigest Enzyme 2 1 µl
Total Volume 20 µl


Gel
pSB1C3
1%, 100V, 1h
Picture: 13/09/24_pSB1C3 digest_EcoRI/PstI_XbaI/SpeI - digest worked



Gel extraction
1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
3. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).
4. Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products) 5. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.
6. Discard flow-through and place QIAquick column back in the same collection tube.
7. To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.
8. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
9. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.
10. To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.

Gel
PCR Overlap
1%, 100V, 1h
Picture: 13/09/24_Overlap PCR PCR SCPR5_SPCR2 - PCR didn't work


PCR Purification (M13 (EcoRI, PstI), SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI))
Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3)
each 8x

Reagent Volume
1x
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 0.5 µl
Reverse Primer (10 uM) 0.5 µl
Template Plasmid 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl




Thermocycler Protocol: Fermentas Phusion
Temp Time
Start 98°C 30 sec Melt
Cycle 1 98°C 5 sec Melt 35 cycles
Cycle 2 25 sec Anneal
Cycle 3 72°C 30 sec per kb Extend
Finish 72 °C 5 min Extand
Store 10°C Forever Store


Liquid culture
NEB, sSP004, Fr-433

Detect

Wednesday 25th September

Gel of PCR, PCR (SPCR5,6) and Miniprep Cas9, M13mp18

Gel of PCR
1%, 100V, 1h

Picture: 13/09/25_SPCR2-11 - SPCR2: worked, SPCR3: worked, SPCR5: didn't work, SPCR6: didn't work, SPCR7: didn't work, SPCR8: didn't work, SPCR9: didn't work, SPCR10: didn't work, SCPR11: worked


PCR (SPCR5,6)

Reagent Volume
x1
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 1 µl
Reverse Primer (10 uM) 1 µl
Template Plasmid) 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl


Thermocycler Protocol: Fermentas Phusion
Temp Time
Start 98°C 30 sec Melt
Cycle 1 98°C 5 sec Melt 35 cycles
Cycle 2 25 sec Anneal
Cycle 3 72°C 30 sec per kb Extend
Finish 72 °C 5 min Extand
Store 10°C Forever Store


Miniprep Cas9, M13mp18
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

Thursday 26th September

Gel PCR 5,6, Digestion, PCR (SPCR7-10) and PCR purification

Gel PCR 5,6 1%, 100V, 1h

Picture: 13/09/26_SPCR5_6 - PCR didn't work


Digestions: SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Reagent Volume
Purified PCR Product 16 µl
H2O 0 µl
10x FastDigest Buffer 2 µl
FastDigest Enzyme 1 1 µl
FastDigest Enzyme 2 1 µl
Total Volume 20 µl


PCR (SPCR7-10)

Reagent Volume
x1
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 1 µl
Reverse Primer (10 uM) 1 µl
Template Plasmid) 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl


Thermocycler Protocol: Fermentas Phusion
Temp Time
Start 98°C 30 sec Melt
Cycle 1 98°C 5 sec Melt 35 cycles
Cycle 2 25 sec Anneal
Cycle 3 72°C 30 sec per kb Extend
Finish 72 °C 5 min Extand
Store 10°C Forever Store



PCR Purification: (SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)

Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.
To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through. Place the QIAquick column back into the same tube
To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.
Discard flow-through and place the QIAquick column back in the same tube.
Centrifuge the column for an additional 1 min.
Place QIAquick column in a clean 1.5 ml microcentrifuge tube.
To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.

Detect

Friday 27th September

Gel SPCR7-10, NEB liquid culture, Ligation, Electrocompetent cells and transformation

Gel SPCR7-10
1%, 100V, 1h

Picture: 13/09/27_SPCR7_8_9_10 - PCRs worked


NEB liquid culture
1:1000 of ON culture

Ligation

pS006
Reagent Volume
SPCR5 1 µl
SPCR7 0,28 µl
H2O 7.22 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS006’
Reagent Volume
SPCR5 1 µl
lin pSB1C3 (XbaI/SpeI) 0,47 µl
H2O 7.03 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS006*
Reagent Volume
SPCR5 1 µl
lin pSB1A3 (XbaI/SpeI) 0,67 µl
H2O 6.83 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS013
Reagent Volume
SPCR4 1 µl
SPCR11 0,24 µl
H2O 7.26 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS013'
Reagent Volume
lin pSB1C3 (EcoRI, SpeI) 1 µl
SPCR11 0,28 µl
H2O 7.22 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS013*
Reagent Volume
lin pSB1A3 (EcoRI, PstI)) 1 µl
SPCR11 0,3 µl
H2O 7.2 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS004
Reagent Volume
SPCR4 1 µl
SPCR3 0,2 µl
H2O 7.3 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS004'
Reagent Volume
lin pSB1C3 (EcoRI, PstI) 1 µl
SPCR3 0,3 µl
H2O 7.2 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS004*
Reagent Volume
lin pSB1A3 (EcoRI, PstI) 1 µl
SPCR3 0,27 µl
H2O 7.23 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS002'
Reagent Volume
SPCR2 1 µl
lin pSB1C3 (EcoRI, PstI) 0,8 µl
H2O 6.7 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


pS002*
Reagent Volume
SPCR2 1 µl
lin pSB1A3 (EcoRI, PstI) 0,6 µl
H2O 6.9 µl
Fermentas T4 Ligase Buffer 1 µl
Fermentas T4 Ligase Enzime 0.5 µl
Total Volume 10 µl


45min at 22°, 15 min at 16°

Electrocompetent cells
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
pS006, pS006’, pS006*, pS013, pS013’, pS013*, pS004, pS004’, pS004*, pS002’, pS002*

1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)

2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.

3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.

4) Preload a pipette with 1 ml of LB.

5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.

6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.

7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.

8) Incubate 1/2 h at 37 °C with shaking.

9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.

10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.

Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.

Detect

Saturday 28th September

Extraction of Genomic DNA, PCR Reaction and Restreak plates

Protocol: E. coli Colony PCR (pS006’, pS006*, pS013, pS004, pS004*, pS002*)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8
Pipet 2 ul into 5ml Media with antibiotics to make liquid cultures

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent Volume 9x Volume
Forward Primer (10 uM) 0.5 µl 4.5 µl
Reverse Primer (10 uM) 0.5 µl 4.5 µl
Template DNA (from above) 1.5 µl 13.5 µl
Quick-Load® Taq 2X Master Mix 12.5 µl 112.5 µl9x Volume
Nuclease-free water 10 µl 90 µl
Total Volume 25 µl 125 µl


Thermocycler Protocol: Green Dream Taq
Temp Time
Start 95°C 30 sec Melt
Cycle 1 95°C 15 sec Melt 35 cycles
Cycle 2 46.8°C 30 sec Anneal
Cycle 3 72°C 1 min per kb Extend
Finish 72 °C 10 min Extand
Store 10°C Forever Store


Restreak plates
Some of the plates were too full grown -> Rstreak for single colonies

Detect

Monday 30th September

Extraction of Genomic DNA, PCR reaction, Gels, Miniprep, PCR: SPCR5, SPCR6 and Liquid culture of pS004’ and pS013’

Protocol: E. coli Colony PCR (pS006, pS013’,pS013*, pS004’, pS002’)

Extraction of Genomic DNA

1) Pick a single colony into 50 ul of H20.
Fresh colonies (grown that day) work best, but they can also come from 4 C.
Pipet 2ul onto plates to have C1-C8

2) Boil for 5 minutes.
1.5 ul of this can be used directly for PCR.
Best if used directly, but can also be stored at 4 C for a few days.

PCR Reaction

Keep all the reagents at 4 °C while preparing the mixture.
Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.

Reagent Volume 9x Volume
Forward Primer (10 uM) 0.5 µl 4.5 µl
Reverse Primer (10 uM) 0.5 µl 4.5 µl
Template DNA (from above) 1.5 µl 13.5 µl
Quick-Load® Taq 2X Master Mix 12.5 µl 112.5 µl9x Volume
Nuclease-free water 10 µl 90 µl
Total Volume 25 µl 125 µl


Thermocycler Protocol: Green Dream Taq
Temp Time
Start 95°C 30 sec Melt
Cycle 1 95°C 15 sec Melt 35 cycles
Cycle 2 46.8°C 30 sec Anneal
Cycle 3 72°C 1 min per kb Extend
Finish 72 °C 10 min Extand
Store 10°C Forever Store


Gels
1%, 100V, 45 min

Pictures + Results
13/09/30_colony pcr_pS004_pS013 - 1-8: pS004 (gRNA - Amp), 9-16: pS013 (crRNA - Amp) - seems to have worked beside pS013 C7


13/09/30_colony PCR_pS004*_pS002* - 1-8: pS004* (gRNA - Amp), 9-16: pS002 (reporter - Amp) - pS004* seems to have worked (C1, C2, C3, C6)


13/09/30_colony PCR_pS006'_pS006* - 1-8: pS006' (Cas9 - Chl), 9-16: pS006* (Cas9 - Amp) - didn’t work


13/09/30_Colony PCR_pS013'_pS013* - 1-8: pS013' (crRNA - Chl), 9-16: pS013* (crRNA - Amp) - Seems to have worked beside 13’ C7, C8


13/09/30_colony PCR_pS004' - 1-8: pS004' (gRNA - Chl), 9-16 - pS004' seems to have worked beside C6


13/09/30_digestion of pS006 and pS002 (Cas9, reporter): seem to have worked

other gel images that proof that the reporter as well as the Cas9 construct worked will follow soon!

Miniprep
pS013, pS004
1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

PCR: SPCR5, SPCR6 (gradient + touch down 55-75, -1°/cycle)

Reagent Volume
11x
Nuclease-free water 37.25 µl
5x Phusion HF Buffer 10 µl
10 mM dNTPs 1 µl
Forward Primer (10 uM) 0.5 µl
Reverse Primer (10 uM) 0.5 µl
Template Plasmid) 0.25 µl
Phusion DNA Polymerase 0.5 µl
Total Volume 50 µl


Thermocycler Protocol: Fermentas Phusion
Temp Time
Start 98°C 30 sec Melt
Cycle 1 98°C 5 sec Melt 35 cycles
Cycle 2 25 sec Anneal
Cycle 3 72°C 30 sec per kb Extend
Finish 72 °C 5 min Extand
Store 10°C Forever Store


Liquid culture of pS004’ and pS013’

Detect

Tuesday 1st October

Miniprep pS013’, pS004’

1) Pellet liquid culture (4000rpm, 10 min)
2) Discard supernatant
3) resuspend the cells in 250ul of resuspension olution
4) add 250ul of lysis solution, mix by inverting 4-6 times
5) add 350ul of neutralization solution
4) centrifuge for 5 min
5) transfer supernatant to spin column
6) centrifuge for 1 min
7) discard flow through
8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
9) centrifuge for 1 min to remove left over liquid
10) transfer the column on a 1.5ml tube
11) add 50ul of elution buffer and incubate for 2 min
12) centrifuge for 2 min
13) Nanodrop the concentration and freeze at -20°

Detect

Wednesday 2nd October

Preparation killing assay


Liquid cultures
R16, R26, R26f, delta PyrF, parental delta PyrF, NEB, M13, Litmus + Helper, Litmus GFP + helper

Detect

Wedsnesday 3rd October

Killing assay to test specifity of CRISPR Cas

Electrocompetent cells (delta PyrF, parental, NEB)
1) Start Culture
2) When the cells reach an OD600 of 0.2.
3) Harvest the cells.
When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
Centrifuge at 4 °C for 10 min at 4000 rpm.
4) Wash and combine the cells.
Remove the supernatant.
Resuspend the cells in 25 ml of ice cold water
5) Wash the cells 2 more times.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 50 ml of ice cold water.
Repeat.
6) Wash and concentrate the cells for electroporation.
Centrifuge at 4 °C for 10 min at 4000 rpm.
Resuspend in 1-2 ml of ice cold water.
We will use 200 ul of washed cells per transformation.

Transformation
Cotransform into parental/keio delta pyRF: pS006* (Cas9 in Amp BB) + pS004'(gRNA in Chl BB).
1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)
2) Test the purity of the electrocompetent cells.
Add 200 ul of washed cells to a cuvette.
3) Mix the cells and DNA in a cuvette.
200 ul of washed cells with 200 ng of PCR product.
Keep the cuvette on ice until just before the electroporation.
4) Preload a pipette with 1 ml of LB.
5) Pulse the cuvette with voltage.
Dry the electrodes with a kimwipe prior to loading.
Use the EC2 setting.
6) Listen for arcing.
A cracking sound means all the cells are dead.
Note the time constant: 5 is good, 5.8 is great.
7) Immediately recover the cells.
Add the 1 ml of preloaded LB and pipet up and down to mix.
Collect 1 ml of cells, some volume is lost in the cuvette.
8) Incubate 1/2 h at 37 °C with shaking.
9) Plate 10/200 ul of recovered cells on selective plates.
Use antibiotic appropriate to the part being integrated.
Let the other 900 ul rest overnight at room temperature.
10) Concentrate and plate the remaining cells
Spin down quickly and resuspend in 100 ul LB before plating.
Transformed cells should be incubated at 37 °C.
Colonies should appear 24-48 h after plating.


Plating of 10/100ul on
1. Amp plates -> selection for only Cas9
2. Chl plates -> selection for only gRNA
3. Amp/Chl plates -> selection for theoretically functional system

Detect

Monday 14th October

Liquid cultures sSP008, sSP009, R16, R26, R26f, sT007, sSP021, SCPR2-A3, SPCE2-C3

Detect

Tuesday 15th October

Digestion Reporter and SPCR3

BB: SpeI, PstI
SPCR: XbaI, PstI
2h 37°, heat inactivation

Electrocompetent cells: sSP008, sSP009
Transform SPCR2-A3/C3 both into sSP008/9

Detect

Wednesday 16th October

Miniprep of pS002, pS002’, pS006* Liquid culture sSP017, pS004, pS004’ Glycerols

Detect

Thursday 17th October

Minipreps, Digestions, Ligation and Transformation

Miniprep sSP017, pS004, pS004’

Digest Litmus pS018 EcoRI/PstI, EcoRI/XbaI 2h 37° shaking

PCR purify

Ligation:
1. gRNA+phagmid (10,4+6)
2.phagemid+gRNA+reporter (9,6+1,86+2)
3.phagemid+gRNA+Cas9 (10,2+2,04+3)

1h at 22°

Transform
Heat shock, cells matt
Recover, plate

Detect

Friday 18th October

Miller assay and Liquid phagemid

Miller assay
  • Grow liquid cultures up to an OD 600 of 0.3-0.7
  • Meassure the OD 600
  • Start the specific cultures you want to test under the specific conditions
  • Take each 600 ul of culture and add 400ul of Z buffer (see below)
  • Add 100ul of Chloroform and 50ul of 0.1% SDS and vortex intensively
  • Incubate the tubes for 5min at 28°C
  • Add 200ul of ONPG (see below) and note the time point of adding
  • Incubate for up to 90 min or until a yellow/green color appears
  • To stop the reaction, add 500ul of Na2CO3 and note the time point of stopping
  • Centrifuge for 3 min
  • Measure the OD at 420

  • The expression of beta-galactosidase can now be calculated with the formula: Miller unit= (1000*OD420)/(delta t*V(culture taken)*OD600)

    Z-buffer:
  • Na2HPO4 7H2O 60 mM - 16.1g
  • NaH4PO4 H2O 40 mM - 5.5g
  • KCl 10 mM - 0.75g
  • MgSO4 7H2O 1 mM - 0.246g
  • beta mercaptoethanol 50 mM - 2.7 ml


  • ONPG:
    4mg/ml in Z-buffer

    Na2CO3 1M

    Detect

    Saturday 19th October

    Miller assay, Digestions

    Miller
    Miniprep phagemid
    Digest phagemid E/P, E/X, SPCR3 E,P

    Detect

    Tuesday 22nd October

    Liquid for Miller and Digest&purify SPCR3 E,P

    Detect

    Thursday 24th October

    Digestion, Ligation, Transformation Ligation, Transformation

    Digest phagemid E/P
    Purify it

    Ligation:
    1. SPCR3 E/P + phagemid E/P
    2. SPCR3 E/P + SPCR5 P/X+ phagemid E/X
    2. SPCR3 E/P + SPCR2 P/X+ phagemid E/X

    trafo Ligations

    electrocmpetent cells parental+sSP009+pS002’
    trafo:

    1. parental+pS002
    2. parental+pS002’
    3. parental+pS006*
    4. parental+pS002’+pS006*
    5. sSP009 pS002’ + pS006*

    trafo helper into NEB

    liquid cultures: sSP009, pRECA strains Ariel, sSP008+pS002, sSP008+pS002’

    Detect

    Friday 25th October

    Liquid cultures, Transformation, Conjugation

    Colony PCR
    Liquid Cloning


    Liquid: NEB helper, parental pS002, parental pS006*, sSP008+pS002, sSP008+pS002’


    Miniprep phagemid gRNA

    Trafo: NEB helper+phageid-gRNA, parental ps006*+pS002’, pyrfF F+ pS002’+pS006*

    conjugation of parental pS006* with pS009

    Liquid library

    Restreak for library


    Functionality Test of reporter
    1) sSP008+pS002/pS002’ +Xgal
    2) sSP008+pS002/pS002’ +Xgal + MMC
    3) sSP008+pS002/pS002’ +MMC

    Detect

    Saturday 26th October

    Liquid cultures, Transformation, Conjugation

    Liquid cultures
    sSP008, transformed parental strains, Kan strains, NEB helper-gRNA, sSP009

    Conjugate at OD 0.2 parental + pS002'+pS006* with sSP009 and plate 50ul on Amp/Tet/Chl plates


    Electrocompetent cells+ transformation

    Trafo:sSP008+Cas9 Addgene+ phagemid-gRNA -> killing assay to confirm gRNA on phagemid works , pyrfF F+ pS002’+pS006*

    Detect

    Sunday 27th October

    Miller assay final strain/construct with controls

    Miller assay
  • MG1655 as positive control
  • parental + reporter + Cas9 + F+
  • Keio delta pyrF + reporter + Cas9 + F+
  • parental + reporter + Cas9 + F+ + phagemid with gRNA
  • Keio delta pyrF + reporter + Cas9 + F+ + phagemid with gRNA
  • Keio delta pyrF + reporter + MMC
  • parental + reporter + MMC


  • Liquid culture functionality test
  • parental + reporter + Cas9 + F+ + Xgal
  • parental + reporter + Cas9 + F+ + Xgal + phagemid with gRNA
  • parental + reporter + Cas9 + F+ + phagemid with gRNA
  • Keio delta pyrF + reporter + Cas9 + F+ + Xgal
  • Keio delta pyrF + reporter + Cas9 + F+ + Xgal + phagemid with gRNA
  • Keio delta pyrF + reporter + Cas9 + F+ + phagemid with gRNA


  • Killing assay
    Plate:
  • parental + reporter + Cas9 + F+
  • Keio delta pyrF + reporter + Cas9 + F+
  • parental + reporter + Cas9 + F+ + phagemid with gRNA
  • Keio delta pyrF + reporter + Cas9 + F+ + phagemid with gRNA
  • Target

    Monday 10th June

    Design of SirA genes for synthesis

    SirA

    Mycobacterium tuberculosis
    Reference: Pinto et al. 2007. Sulfite Reduction in Mycobacteria doi: 10.1128/JB.00487-07
    Primers:
    TBsirA F      GGAATTCCATATGTCCGCGAAGGAGAACCCC
    TBsirA R      AAGGAAAAAAGCGGCCGCTCATCGCAGGTCGTCCTCCTCGGCCCGGAT
    We blasted the above primers used to clone sirA from M. tuberculosis into E. coli. We then extracted the sequence from genbank to retrieve the following sequence which includes the restriction sites introduced by Pinto et al.

    ggaattccat atgtccgcga aggagaaccc ccaaatgacc actgcacgtc
    ccgccaaggc tcgaaatgag ggccagtggg cgctgggaca tcgcgagcca
    ctcaacgcca acgaagagct gaagaaggcc ggcaacccgc tcgacgtgcg
    ggagcgcatc gaaaacatct acgccaaaca gggtttcgac agcatcgaca
    agaccgacct gcgagggcgc tttcgctggt ggggcctgta cacccagcgt
    gagcagggct acgacggcac ctggaccggt gacgacaaca tcgacaagct
    cgaggccaaa tacttcatga tgcgggtgcg ttgcgacggc ggcgcgctct
    cggctgccgc gctgcgcacg ctgggccaga tctcgacgga gttcgcgcgc
    gataccgccg atatctccga ccggcagaac gtgcaatacc actggatcga
    agtggaaaac gtccctgaaa tctggcgacg gttagacgat gtcggactgc
    agaccaccga ggcgtgcggt gactgcccgc gggtagtgct gggctcgccg
    ttggccggcg agtcgctcga cgaagtgctc gacccgacct gggcgatcga
    ggagatcgtg cgtcgctaca tcggcaagcc cgacttcgcc gacttgccgc
    gcaagtacaa gaccgccatc tctggcctgc aggacgtcgc gcacgagatc
    aacgacgtcg ccttcatcgg cgtcaaccat cccgagcacg gaccaggcct
    ggatctgtgg gtgggcggtg gactgtcgac caacccgatg ctggcccagc
    gggtcggcgc ctgggttcca ctgggcgaag tgcccgaggt gtgggcggcg
    gtcacctcgg tgtttcgcga ctacggctac cggcgactgc gcgccaaggc
    ccggctgaaa tttctgatca aagactgggg catagcgaag ttccgcgaag
    tgctcgaaac cgagtacctc aagcgtccgc tgatcgacgg tccggccccc
    gaaccggtca agcatccgat cgaccacgtc ggggtgcaac gactcaagaa
    cgggctcaac gccgtcggag tcgcccccat cgccgggcgg gtatcgggca
    ccatcctcac ggcggtcgcc gacctgatgg cgcgggccgg ttccgaccgg
    atccggttca ccccctacca gaagctggtc atcctcgaca ttccggacgc
    cttgctcgac gacttgatcg ccggtctgga cgcgctgggg ctgcagtcgc
    gcccgtcgca ttggcgccgg aacttgatgg cgtgcagcgg gattgagttc
    tgcaagttgt cattcgccga aacccgggtt cgagcacagc atttggtgcc
    cgagctggaa cgccggcttg aggacatcaa ctcgcagctc gacgtaccga
    tcaccgtcaa catcaacggc tgcccgaact catgtgcgcg aattcaaatc
    gccgacatcg gattcaaggg acagatgatc gacgacggac acggcggctc
    cgtcgaaggc ttccaggtgc atctgggcgg acacctcggc ctggatgccg
    gattcggccg caaactgcgc cagcacaagg tcaccagtga cgaactcggc
    gactacatcg accgggtggt gcgcaacttc gtcaaacacc gcagcgaagg
    tgaacgcttc gcgcagtggg tcatccgggc cgaggaggac gacctgcgat
    gagcggccgc ttttttcctt

    This sequence was then inserted into Geneious. The PstI and EcoRI sites were manually removed and replaced with silent mutations. A NcoI site was inserted at the start codon and an extra glycine was added after the start codon for the NcoI site to function properly. We chose glycine as it is small an unlikely to interfere with either polar or non-polar domains within the protein. We used GGC as the codon as it is the highest used glycine codon in e. coli. We also added an AvrII site on the 3’ end of the site. We then added biobrick restriction sites on the ends of the sequence (EcoRI, XbaI, SpeI, PstI). This will allow us to clone into our expression vector pACYCDuet-1 with NcoI and AvrII enzymes and into a biobrick registry with EcoRI and PstI. The insertion into pACYCDuet-1 removes both protein tags and cuts out the second MCS resulting in vector pACYCDuet-TBsirA. The resulting sequence for TB SirA follows:

    catggaattc tagaccatgg gctccgcgaa ggagaacccc caaatgacca
    ctgcacgtcc cgccaaggct cgaaatgagg gccagtgggc gctgggacat
    cgcgagccac tcaacgccaa cgaagagctg aagaaggccg gcaacccgct
    cgacgtgcgg gagcgcatcg aaaacatcta cgccaaacag ggtttcgaca
    gcatcgacaa gaccgacctg cgagggcgct ttcgctggtg gggcctgtac
    acccagcgtg agcagggcta cgacggcacc tggaccggtg acgacaacat
    cgacaagctc gaggccaaat acttcatgat gcgggtgcgt tgcgacggcg
    gcgcgctctc ggctgccgcg ctgcgcacgc tgggccagat ctcgacggag
    ttcgcgcgcg ataccgccga tatctccgac cggcagaacg tgcaatacca
    ctggatcgaa gtggaaaacg tccctgaaat ctggcgacgg ttagacgatg
    tcggacttca gaccaccgag gcgtgcggtg actgcccgcg ggtagtgctg
    ggctcgccgt tggccggcga gtcgctcgac gaagtgctcg acccgacctg
    ggcgatcgag gagatcgtgc gtcgctacat cggcaagccc gacttcgccg
    acttgccgcg caagtacaag accgccatct ctggccttca ggacgtcgcg
    cacgagatca acgacgtcgc cttcatcggc gtcaaccatc ccgagcacgg
    accaggcctg gatctgtggg tgggcggtgg actgtcgacc aacccgatgc
    tggcccagcg ggtcggcgcc tgggttccac tgggcgaagt gcccgaggtg
    tgggcggcgg tcacctcggt gtttcgcgac tacggctacc ggcgactgcg
    cgccaaggcc cggctgaaat ttctgatcaa agactggggc atagcgaagt
    tccgcgaagt gctcgaaacc gagtacctca agcgtccgct gatcgacggt
    ccggcccccg aaccggtcaa gcatccgatc gaccacgtcg gggtgcaacg
    actcaagaac gggctcaacg ccgtcggagt cgcccccatc gccgggcggg
    tatcgggcac catcctcacg gcggtcgccg acctgatggc gcgggccggt
    tccgaccgga tccggttcac cccctaccag aagctggtca tcctcgacat
    tccggacgcc ttgctcgacg acttgatcgc cggtctggac gcgctggggc
    ttcagtcgcg cccgtcgcat tggcgccgga acttgatggc gtgcagcggg
    attgagttct gcaagttgtc attcgccgaa acccgggttc gagcacagca
    tttggtgccc gagctggaac gccggcttga ggacatcaac tcgcagctcg
    acgtaccgat caccgtcaac atcaacggct gcccgaactc atgtgcgcga
    gttcaaatcg ccgacatcgg attcaaggga cagatgatcg acgacggaca
    cggcggctcc gtcgaaggct tccaggtgca tctgggcgga cacctcggcc
    tggatgccgg attcggccgc aaactgcgcc agcacaaggt caccagtgac
    gaactcggcg actacatcga ccgggtggtg cgcaacttcg tcaaacaccg
    cagcgaaggt gaacgcttcg cgcagtgggt catccgggcc gaggaggacg
    acctgcgatg agcggccgcc taggactact agtctgcagt ttttcctt

    Mycobacterium smegmatis
    This reference also contains the cloning of sirA from T. smegmatis. We used the primers below taken from Pinto et al, blasted against the T. smegmatis genome and extracted the sirA sequence from genbank as above.
    Primers:
    smegsirA F      TACAGCTGATGCTCGAAGACGAGTACTTCAT
    smegsirA R      CCCAAGCTTTCACGTTGCCTACCTCAAATCCGCTTCGTC

    tacagctgat gctcgaagac gagtacttca tgctgcgcgt gcgctgcgat
    ggtggcgcgc tgaccactgc agcgctgcgc acgctcggcg gcatctcgac
    cgagttcgcg cgcgacaccg ccgacatctc cgaccgcgag aacgtccagt
    accactggat ccaggtcgag aacatgcccg agatctggaa gcgcctcgac
    gccgtcggcc tgcagaccac cgaggcgtgc ggcgactgcc cgcgtgtggt
    cctcggctcg ccgctggccg gtgagtccct cgacgaggtg atcgacggga
    cccccgcgat cgacgagatc gtgcgccgct acatcggcaa gcccgagtac
    tcgaacctgc cgcgcaagtt caagaccgcg atctcggggc ttcaggacgt
    ggtccacgag gtcaacgacg tcgcgttcat cggcgtcaac caccccgagc
    acggcccggg cttcgacctg tgggtcggtg gcggcctgtc gaccaacccg
    atgctggccc agcgcgtcgg ggtgtgggtg ccgctcgacg aggtgcccga
    cgtctgggag ggcgtcgtca gcatcttccg cgactacggt taccggcgtc
    tgcggtcgaa ggcgcggctg aagttcctga tcaaggactg gggcgtcgaa
    aagttcaggg aagtgctgga aaccgagtac ctcaagcgcc ccctgatcga
    cggcccggca cccgaaccgg tgacccgccc catcgaccac gtcggtgtgc
    agaagctcaa gaacggcctc aacgccgtgg gcgtcgcccc gatcgcgggt
    cgcgtctcgg gcacgatcct gaccaaggtg gccgatctcg ccgaggccgc
    cgggtccgac cggatccgct tcacgccgta ccagaagctg atcatcctcg
    acgtgcccga cgacaagatc gacgaactgc gcgctggcct cgacgcgctc
    ggactgccgt cgacgccgtc gcactggcgc cgcaacctca tggcgtgcac
    gggtatcgag ttctgcaagc tgagcttcgc cgagacccgc aagcgtgccc
    aggtgctggt tcccgagctg gagaaacggc tcgacgacat caacgcccag
    ctcgacgtgc ccatcacggt caacatcaac ggctgcccca actcgtgcgc
    ccgtatccag gtcgccgaca tcgggttcaa gggccagatg gtcgacgatg
    gcaacggccc cgaggagggt ttccaggtgc atctgggcgg cagcctgggc
    ctggacagcg ggttcggccg caagctgcgc cagcacaagg tgctctcgtc
    cgagctcggc gactacatcg agcgcgtcgt gcgcaacttc gtgaaacaac
    gcgaggacgg cgagcgtttc gcccagtggg ccgtgcgggc cgacgaagcg
    gatttgaggt aggcaacgtg aaagcttggg

    As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. This resulted in the following sequence for synthesis:

    tacagaattc tagaccatgg gcctcgaaga cgagtacttc atgctgcgcg
    tgcgctgcga tggtggcgcg ctgaccacta cagcgctgcg cacgctcggc
    ggcatctcga ccgagttcgc gcgcgacacc gccgacatct ccgaccgcga
    gaacgtccag taccactgga tccaggtcga gaacatgccc gagatctgga
    agcgcctcga cgccgtcggc ctacagacca ccgaggcgtg cggcgactgc
    ccgcgtgtgg tcctcggctc gccgctggcc ggtgagtccc tcgacgaggt
    gatcgacggg acccccgcga tcgacgagat cgtgcgccgc tacatcggca
    agcccgagta ctcgaacctg ccgcgcaagt tcaagaccgc gatctcgggg
    cttcaggacg tggtccacga ggtcaacgac gtcgcgttca tcggcgtcaa
    ccaccccgag cacggcccgg gcttcgacct gtgggtcggt ggcggcctgt
    cgaccaaccc gatgctggcc cagcgcgtcg gggtgtgggt gccgctcgac
    gaggtgcccg acgtctggga gggcgtcgtc agcatcttcc gcgactacgg
    ttaccggcgt ctgcggtcga aggcgcggct gaagttcctg atcaaggact
    ggggcgtcga aaagttcagg gaagtgctgg aaaccgagta cctcaagcgc
    cccctgatcg acggcccggc acccgaaccg gtgacccgcc ccatcgacca
    cgtcggtgtg cagaagctca agaacggcct caacgccgtg ggcgtcgccc
    cgatcgcggg tcgcgtctcg ggcacgatcc tgaccaaggt ggccgatctc
    gccgaggccg ccgggtccga ccggatccgc ttcacgccgt accagaagct
    gatcatcctc gacgtgcccg acgacaagat cgacgaactg cgcgctggcc
    tcgacgcgct cggactgccg tcgacgccgt cgcactggcg ccgcaacctc
    atggcgtgca cgggtatcga gttctgcaag ctgagcttcg ccgagacccg
    caagcgtgcc caggtgctgg ttcccgagct ggagaaacgg ctcgacgaca
    tcaacgccca gctcgacgtg cccatcacgg tcaacatcaa cggctgcccc
    aactcgtgcg cccgtatcca ggtcgccgac atcgggttca agggccagat
    ggtcgacgat ggcaacggcc ccgaggaggg tttccaggtg catctgggcg
    gcagcctggg cctggacagc gggttcggcc gcaagctgcg ccagcacaag
    gtgctctcgt ccgagctcgg cgactacatc gagcgcgtcg tgcgcaactt
    cgtgaaacaa cgcgaggacg gcgagcgttt cgcccagtgg gccgtgcggg
    ccgacgaagc ggatttgagg taggcaacgt gaaagcctag gtactagtct
    gcagtggg

    Target

    Tuesday 11th June

    Design of FdrA genes for synthesis

    FdrA

    Mycobacterium tuberculosis
    Reference: McLean et al. 2003. Kinetic, spectroscopic and thermodynamic characterization of the Mycobacterium tuberculosis adrenodoxin reductase homologue FprA. doi: 10.1042/BJ20021692
    Primers:
    MtbfdrA F      TATGACTCATATGCGTCCCTATTACATCGCCATCG
    MtbfdrA R      ATCCGGGATCCTCAGCCGAGCCCAATCCGCAACAGC
    The above primers were blasted to retrieve sequence of FprA from genebank resulting in the following sequence:


    tatgactcat atgcgtccct attacatcgc catcgtgggc tccgggccgt
    cggcgttctt cgccgcggca tccttgctga aggccgccga cacgaccgag
    gacctcgaca tggccgtcga catgctggag atgttgccga ctccctgggg
    gctggtgcgc tccggggtcg cgccggatca ccccaagatc aagtcgatca
    gcaagcaatt cgaaaagacg gccgaggacc cccgcttccg cttcttcggc
    aatgtggtcg tcggcgaaca cgtccagccc ggcgagctct ccgagcgcta
    cgacgccgtg atctacgccg tcggcgcgca gtccgatcgc atgttgaaca
    tccccggtga ggacctgccg ggcagtatcg ccgccgtcga tttcgtcggc
    tggtacaacg cacatccaca cttcgagcag gtatcacccg atctgtcggg
    cgcccgggcc gtagttatcg gcaatggaaa cgtcgcgcta gacgtggcac
    ggattctgct caccgatccc gacgtgttgg cacgcaccga tatcgccgat
    cacgctttgg aatcgctacg cccacgcggt atccaggagg tggtgatcgt
    cgggcgccga ggtccgctgc aggccgcgtt caccacgttg gagttgcgcg
    agctggccga cctcgacggg gttgacgtgg tgatcgatcc ggcggagctg
    gacggcatta ccgacgagga cgcggccgcg gtgggcaagg tctgcaagca
    gaacatcaag gtgctgcgtg gctatgcgga ccgcgaaccc cgcccgggac
    accgccgcat ggtgttccgg ttcttgacct ctccgatcga gatcaagggc
    aagcgcaaag tggagcggat cgtgctgggc cgcaacgagc tggtctccga
    cggcagcggg cgagtggcgg ccaaggacac cggcgagcgc gaggagctgc
    cagctcagct ggtcgtgcgg tcggtcggct accgcggggt gcccacgccc
    gggctgccgt tcgacgacca gagcgggacc atccccaacg tcggcggccg
    aatcaacggc agccccaacg aatacgtcgt cgggtggatc aagcgcgggc
    cgaccggggt gatcgggacc aacaagaagg acgcccaaga caccgtcgac
    accttgatca agaatcttgg caacgccaag gagggcgccg agtgcaagag
    ctttccggaa gatcatgccg accaggtggc cgactggcta gcagcacgcc
    agccgaagct ggtcacgtcg gcccactggc aggtgatcga cgctttcgag
    cgggccgccg gcgagccgca cgggcgtccc cgggtcaagt tggccagcct
    ggccgagctg ttgcggattg ggctcggctg aggatcccgg at

    As previously, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. However, in the case of FdrA, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:

    tatgaattct agatcatatg cgtccctatt acatcgccat cgtgggctcc
    gggccgtcgg cgttcttcgc cgcggcatcc ttgctgaagg ccgccgacac
    gaccgaggac ctcgacatgg ccgtcgacat gctggagatg ttgccgactc
    cctgggggct ggtgcgctcc ggggtcgcgc cggatcaccc caagatcaag
    tcgatcagca agcaattcga aaagacggcc gaggaccccc gcttccgctt
    cttcggcaat gtggtcgtcg gcgaacacgt ccagcccggc gagctctccg
    agcgctacga cgccgtgatc tacgccgtcg gcgcgcagtc cgatcgcatg
    ttgaacatcc ccggtgagga cctgccgggc agtatcgccg ccgtcgattt
    cgtcggctgg tacaacgcac atccacactt cgagcaggta tcacccgatc
    tgtcgggcgc ccgggccgta gttatcggca atggaaacgt cgcgctagac
    gtggcacgga ttctgctcac cgatcccgac gtgttggcac gcaccgatat
    cgccgatcac gctttggaat cgctacgccc acgcggtatc caggaggtgg
    tgatcgtcgg gcgccgaggt ccgcttcagg ccgcgttcac cacgttggag
    ttgcgcgagc tggccgacct cgacggggtt gacgtggtga tcgatccggc
    ggagctggac ggcattaccg acgaggacgc ggccgcggtg ggcaaggtct
    gcaagcagaa catcaaggtg ctgcgtggct atgcggaccg cgaaccccgc
    ccgggacacc gccgcatggt gttccggttc ttgacctctc cgatcgagat
    caagggcaag cgcaaagtgg agcggatcgt gctgggccgc aacgagctgg
    tctccgacgg cagcgggcga gtggcggcca aggacaccgg cgagcgcgag
    gagctgccag ctcagctggt cgtgcggtcg gtcggctacc gcggggtgcc
    cacgcccggg ctgccgttcg acgaccagag cgggaccatc cccaacgtcg
    gcggccgaat caacggcagc cccaacgaat acgtcgtcgg gtggatcaag
    cgcgggccga ccggggtgat cgggaccaac aagaaggacg cccaagacac
    cgtcgacacc ttgatcaaga atcttggcaa cgccaaggag ggcgccgagt
    gcaagagctt tccggaagat catgccgacc aggtggccga ctggctagca
    gcacgccagc cgaagctggt cacgtcggcc cactggcagg tgatcgacgc
    tttcgagcgg gccgccggcg agccgcacgg gcgtccccgg gtcaagttgg
    ccagcctggc cgagctgttg cggattgggc tcggctgagg atccctagga
    ctagtctgca gttacg

    Mycobacterium smegmatis
    We didn't find a reference of M. Smegmatis FprA being cloned into E. coli so we used the following sequenced data:


    atgcgcccgt accacgtagc gatcgtcggc tcaggaccct ccggattctt
    tgctgccgca tcgctgctga agtttgccga ctctcaaccc gaccgcgatg
    tccgcgtgga catgctcgag atgctgccga ccccgtgggg tctggtgcgc
    tccggcgtcg ctcccgacca tccgaagatc aagtcgatca gcgcccagtt
    cgagaagacc gcggccgacc cccgcttccg gttcttcggc aacgtccggg
    tcggtgagca cgtccaaccg ggcgaactcg ccgaacgcta cgacgccgtc
    gtctacgcca ccggcgcaca gtccgaccgc gcgctgaaca tccccggcga
    ggagctgccg ggcagcgtcg cggccgtcga cttcgtgggt tggtacaacg
    cgcatccgca tttccgcgag atggcgcccg atctctccgg cgggcgcgcc
    gtggtggtcg gcaacggcaa cgtcgcactc gatgtcgcac gcatcctggt
    cagcgatccg aaggcgttgg ccaacaccga cattgccgac catgcgctgg
    acaagctgga cacgcgcggt gtggacgagg tcgtggtgct cggccggcgt
    ggtccgctgc aggcgacgtt caccacgctg gagttgcgtg aactcggcga
    catggagggc ctcggcgacg tcgacgtgat cctggatccg gccgatttcg
    ccgacatcac cgacgaggat ctcgaagccg cgggcaagac cgtcaagcag
    aacatcaagg tgctgcgcgg ttacgccgag cgggaaccgc gaggcgccaa
    gcggcgcatc gtgttccggt tcttcacctc accgatcgag ctgcgcggcg
    aggaccgcgt ggaatcgatc gtgttgggac gcaacgaact cgtgcgcggc
    gccgacggca ggatggtggc caaggacacc ggtgagcgcg aagaactgcc
    ggcacagctg gtggtgcgtg cggtcggata ccgcggcgtg ccgactccag
    gcctgccgtt cgacgagcgt tcgggcacca tcccgcacac cgacggccgc
    gtcgagggca gcgccaacga gtacgtggtg ggctggatca agcgcggacc
    gtccggcgtc atcggcagca acaagaagga ctcacaggac accgtcaaca
    ccctgctcga cgacctcgcc gcggcccggc tgccccagcg cgggcccgac
    cactccgaga agctcgcggc gtggttgctg gaacgtcagc ccaaggtggt
    cacgggcgag cactggaagc tgatcgacga ctacgagcgc gccgcgggcg
    aaccgaccgg ccgaccccgg gtgaagctgg cgagcgtggc tgaactgctg
    cgcgtgggcc acggctga

    As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. Again, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:


    tatgaattct agatcatatg cgcccgtacc acgtagcgat cgtcggctca
    ggaccctccg gattctttgc tgccgcatcg ctgctgaagt ttgccgactc
    tcaacccgac cgcgatgtcc gcgtggacat gctcgagatg ctgccgaccc
    cgtggggtct ggtgcgctcc ggcgtcgctc ccgaccatcc gaagatcaag
    tcgatcagcg cccagttcga gaagaccgcg gccgaccccc gcttccggtt
    cttcggcaac gtccgggtcg gtgagcacgt ccaaccgggc gaactcgccg
    aacgctacga cgccgtcgtc tacgccaccg gcgcacagtc cgaccgcgcg
    ctgaacatcc ccggcgagga gctgccgggc agcgtcgcgg ccgtcgactt
    cgtgggttgg tacaacgcgc atccgcattt ccgcgagatg gcgcccgatc
    tctccggcgg gcgcgccgtg gtggtcggca acggcaacgt cgcactcgat
    gtcgcacgca tcctggtcag cgatccgaag gcgttggcca acaccgacat
    tgccgaccat gcgctggaca agctggacac gcgcggtgtg gacgaggtcg
    tggtgctcgg ccggcgtggt ccgcttcagg cgacgttcac cacgctggag
    ttgcgtgaac tcggcgacat ggagggcctc ggcgacgtcg acgtgatcct
    ggatccggcc gatttcgccg acatcaccga cgaggatctc gaagccgcgg
    gcaagaccgt caagcagaac atcaaggtgc tgcgcggtta cgccgagcgg
    gaaccgcgag gcgccaagcg gcgcatcgtg ttccggttct tcacctcacc
    gatcgagctg cgcggcgagg accgcgtgga atcgatcgtg ttgggacgca
    acgaactcgt gcgcggcgcc gacggcagga tggtggccaa ggacaccggt
    gagcgcgaag aactgccggc acagctggtg gtgcgtgcgg tcggataccg
    cggcgtgccg actccaggcc tgccgttcga cgagcgttcg ggcaccatcc
    cgcacaccga cggccgcgtc gagggcagcg ccaacgagta cgtggtgggc
    tggatcaagc gcggaccgtc cggcgtcatc ggcagcaaca agaaggactc
    acaggacacc gtcaacaccc tgctcgacga cctcgccgcg gcccggctgc
    cccagcgcgg gcccgaccac tccgagaagc tcgcggcgtg gttgctggaa
    cgtcagccca aggtggtcac gggcgagcac tggaagctga tcgacgacta
    cgagcgcgcc gcgggcgaac cgaccggccg accccgggtg aagctggcga
    gcgtggctga actgctgcgc gtgggccacg gctgacctag gactagtctg
    cagttacg

    Target

    Wednesday 12th June

    Design of FdxC and FdxA genes for synthesis

    FdxC

    Mycobacterium tuberculosis
    Reference: Cole, S.T. et al. 1998. Deciphering the biology of Mycobacterium tuber- culosis from the complete genome sequence. doi:10.1038/31159.
    We couldn’t find a reference of FdxC being cloned into E. coli and so we took the sequence data from genbank which is as follows:

    gtgacgtaca cgatcgccga accctgtgtc gacatcaagg acaaggcatg
    cattgaggag tgcccggtcg attgcatcta cgagggcgcc cggatgctgt
    atatccaccc cgacgaatgc gtcgactgtg gggcttgcga gccggtctgc
    cccgttgaag ctatcttcta cgaagacgat gtgcccgaac agtggagcca
    ttacacccag atcaacgccg atttcttcgc cgagctggga tcgccgggcg
    gtgcggccaa ggttggcatg accgagaacg acccgcaagc ggtcaaggat
    ctggcgccgc agagcgagga cgcctga

    The Gtg was replaced with the NcoI cut site and a glycine codon (ccatgggc) and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:

    cttagaattc tagaccatgg gcacgtacac gatcgccgaa ccctgtgtcg
    acatcaagga caaggcatgc attgaggagt gcccggtcga ttgcatctac
    gagggcgccc ggatgctgta tatccacccc gacgaatgcg tcgactgtgg
    ggcttgcgag ccggtctgcc ccgttgaagc tatcttctac gaagacgatg
    tgcccgaaca gtggagccat tacacccaga tcaacgccga tttcttcgcc
    gagctgggat cgccgggcgg tgcggccaag gttggcatga ccgagaacga
    cccgcaagcg gtcaaggatc tggcgccgca gagcgaggac gcctgaagct
    tgactagtct gcagaaatg

    FdxA

    Mycobacterium smegmatis
    Reference: Ricagno S. et al. 2008. The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis. http://dx.doi.org/10.1016/j.bbrc.2007.06.013 http://www.metacyc.org/MSME246196/NEW-IMAGE?type=GENE-IN-MAP&object=GJ4Y-1124
    Sequence:

    atgacatacg tgatcggccg gccgtgcgtg gacgtcaaag accgcgcatg
    cgtggatgag tgcccggtcg actgcatcta cgagggcgcg cggatgctct
    acatccaccc cgacgaatgt gtcgactgtg gcgcgtgtga acccgtgtgc
    ccggtggagg cgatctacta cgaggacgac ctgcccgagg atctgcagcc
    gtaccaggag gagaacgcga agttcttcac cgatgtcctg cccgggcgtg
    cccaaccgct cggatcaccg ggcggtgccg cgaaactcgg tgtcgtggac
    gccgatacgc ccatggttgc ggagctaccg ccgcaggggg attga

    The NcoI cut site and a glycine codon (ccatgggc) replaced the atg in green and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:

    cttagaattc tagaccatgg gcacatacgt gatcggccgg ccgtgcgtgg
    acgtcaaaga ccgcgcatgc gtggatgagt gcccggtcga ctgcatctac
    gagggcgcgc ggatgctcta catccacccc gacgaatgtg tcgactgtgg
    cgcgtgtgaa cccgtgtgcc cggtggaggc gatctactac gaggacgacc
    tgcccgagga tcttcagccg taccaggagg agaacgcgaa gttcttcacc
    gatgtcctgc ccgggcgtgc ccaaccgctc ggatcaccgg gcggtgccgc
    gaaactcggt gtcgtggacg ccgatacgcc catggttgcg gagctaccgc
    cgcaggggga ttgagcctag gtactagtct gcagtggg

    Target

    Tuesday 18th June

    In Silico Cloning

    We used geneious to perform in silico cloning on our constructed gene sequences to ensure that they were properly made. SirA and pACYCDuet-1 were both cut with NcoI and AvrII and then the large fragments were extracted and ligated together to form vector pD001. FdxA and pETDuet-1 were both cut with NcoI and HindIII and the large fragments were extracted and ligated together to form vector pD002. FprA and pD002 were both cut with NdeI and AvrII and the large fragments were extracted and ligated together to form vector pD003. Please see Geneious files on Google Drive (or send request for files) for exact sequences.

    Target

    24th June

    Codon Optimization

    The ORF of M. Smegmatis SirA, FprA, and FdxA were codon optimized for E. coli K-12 using JCat (www.jcat.de) with options to avoid using rho-independent terminators, prokaryotic RBS, and restriction sites used in vector construction (AvrII, HindIII, NdeI, NcoI) and Biobrick restriction sites (EcoRI, PstI, SpeI, XbaI). The optimization charts are shown below:

    Target

    Monday 1st July

    Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.

    4 strains were received from Jake:

    • E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
    • E. coli: NEBTurbo zmSIR Chloramphenicol
    • E. coli: NEBTurbo zmFNR Spectinomycin
    • E. coli: NEBTurbo soFD, zmSIR Chloramphenicol
    Media and Glycerol stock were prepared

    Media Preparation
    3 500ml bottles of LB broth and LB agar were prepared by standard methods.
    12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar.
    Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.

    Glycerol Stocks
    Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.
    750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
    Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.

    Target

    Tuesday2nd July

    MiniPrep: Plasmids pD004, pD005 and pD006 were extracted from NEBturbo vectors

    Plasmid Extraction
    Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in protocol (). Lacking Resuspention solution we used some from a different mini prep upstairs. Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC. More notes here tra la lalal

    Target

    Wednesday 3rd July

    Chemically Competent Cells : BL21 (DE3) dCysI dFpr dydbk, NEBturbo stocks

    Chemically Competent BL21 (DE3) Cells were made
    We grew 5ml of sD001 cells overnight from a single colony. This 5ml was used to innoculate 500ml of LB broth.
    Broth was incubated for 1.5h and optical density was read at 0.62 OD600.
    Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C.
    Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes.
    Cells were centrifuged again for 20 minutes at 4000xg.
    Supernatant was removed and cells were resuspended in 12ml Buffer 2.
    Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
    Buffer 1: 50mM CaCl2
    Buffer 2:

    • 0.53ml 2M CaCl2
    • 2.8ml 60% Glycerol
    • 8.67ml sterile H2O

    This is the correct Chemical Competent Cells protocol (Similar to Protocol 2) , that we should have used instead of the one above:
    1. Take a single colony of E. coli cells and inoculate 5ml of LB broth.
      Incubate over night at 37C and 200rpm and innoculate about 500ml to 1L sterile LB broth.
      DO NOT ADD antibiotics since these cells do not have a plasmid in them.
      Work as sterile as possible.
    2. Inoculate about 300-400ml sterile LB broth with 500ul of preculture.
    3. Grow the cells on a shaker at 37C until they reach an OD @ 600nm of 0.3 to 0.4 (1cm pathlength of the cuvette).
    4. Centrifuge at 3000xg for 10 minutes at 4C. Ice down 100mM CaCl2 and 100mM MgCl2 solutions at this point.
    5. Gently resuspend the bacteria pellet on ice in 50ml of ice cold 100mM MgCl2, taking 3-5 minutes for this procedure.
      Centrifuge the cell suspension at 3000xg for 10 minutes at 4C.
    6. Resuspend the bacteria pellet on ice 50ml of ice cold 100mM CaCl2, incubate the cells for 10 minutes on ice.
    7. Centrifuge the cell suspension at 3000xg for 10 minutes at 4C and resuspend the cell pellet in 4ml of ice cold, sterile 100mM CaCl2 in 15%(w/v) glycerol.
      Dispense in 50uL aliquots and freeze cells at -80C.

    Chemically competent cells (NEB Turbo)
    Prepared via iGEM chemically competent protocol with following changes.
    500ul of preculture used to inoculate 500ml LB broth. Grown at 37C for 3h hours to an OD600 of 0.536.
    Cells centrifuged at 3200 rpm on old centrifuge for 10m at 4C. Pellets resuspended in 80ml of CCMB80 buffer.
    Incubated on ice for 20m. Centrifuged for 10m at 3200 rpm for 10m at 4C.
    Pellets resuspended in 5ml of CCMB80 buffer. Aliquoted into Microcentrifuge tubes and frozen at -80C.

    Target

    Thursday 4th July

    Heat Shock Transformation

    Preparation of Agar Plates
    LB Agar was melted; 100ml was used to make 8 ampicillin plates,
    100ml was used to make 8 spectinomycin plates and the remaining was used to make 20 chloramphenicol plates.
    Antibiotic concentrations are: Ampicillin 50ug/ml, Spectinomycin 50ug/ml, Chloramphenicol 34ug/ml.

    Heat Shock Transformation
    sD001: BL21 (DE3) with deletions, was transformed with the following plasmids and plasmid combinations:

    • sD001+pD004 ( FNR, Spectinomycin)
    • sD001+pD005 ( SIR, Fdx, Chloramphenicol)
    • sD001+pD006 (Sir, Chloramphenicol)
    Transformation was done according to protocol 1 with the following specifications:
    BL21 (DE3) chemically competent cells were thawed on Ice. 1ul of plasmid DNA was added to a tube of BL21 (DE3) cells.
    Cells were incubated on ice for 30 minutes. Cells were transfered to heating block at 42C for 45s.
    Cells were returned to ice for 2 minutes. 1ml of LB Broth was added to the cells and they were incubated at 37C for 1h.
    Cells were then plated on agar with appropriate antibiotics (specified previously). These transformations worked; single colonies were lifted from plates, entered to catalog and stocked in glycerol stock (protocol 3).
    Catalog names:
    • sD006= sD001+pD004 ( FNR, Spectinomycin)
    • sD007= sD001+pD005 ( SIR, Fdx, Chloramphenicol)
    • sD008= sD001+pD006 (Sir, Chloramphenicol)

    Target

    Friday 5th July

    Planning transformations for the next week

    We decided to partly reproduce Figure 3C from: http://www.jbioleng.org/content/5/1/7:


    So, we would pursue to grow the following strains on a minimal media M9 plate, supplemented with all amino acids

    aside from the sulfur containing ones, and sulfite ans the only sulfur source:

    We already thought we have all of the strains we need, however, an overnight culture was launched of a few single colonies from this double plasmid strain (sD001+pD004+pD005, which supposedly had all 3 genes SIR FNR and Fdx) and it didn't grow.

    This most likely occurred because the strains didn't have Spec antibiotics resistance, as the other spec resistant strain containing

    the FNR gene (pD004), was found not to be resistant as well.


    Illustration 1: Strains will be grown on a minimal media M9 plate, supplemented with all amino acids aside from the sulfur containing ones; plates will have increased glucose, and sulfite as the only sulfur source. Growth is expected only for WT and the strain containing all three alternative genes of sulfur reduction.




    Therefore, we would  re-make:

    • sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes.

    • sD001+pD004: E.coli:ΔcysI, Δfpr, ΔydbK:: zmFNR; Spectinomycin



    and make


    • sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol


    These transformations will be done by using two strains of competent cells prepared using Protocol 2 :

    • sD001 competent cells were transformed with:

      • pD004

      • Double transformation: pD005 +pD004

    • sD007 (sD001+pD005) competent cells were transformed with:

      • pD004

    These transformations will be done by heat shock using protocol 1.




    Target

    Tuesday 16th July

    Transformation efficiency measurements

    Transformation of Puc18 to sD001 (BL21 ED3) competent cells. We have made a transformation of pUC18 into our sD001 BL21(DE3) strain of competent cells.
    Transformation was done by heat shock protocol 1 with the following specifications:
    200 ul Chemically Competent Cells were thawed on Ice. 0.5 ul DNA was added and incubate on ice for 30 minutes.
    HEAT SHOCK cells were Incubated at 42C for 45 seconds then incubated on ice for 2 minutes. 200 ul of LB broth was added and cells were incubated at 37C for 1 hour.
    10 ul of cells were plated on agar supplemented with Ampicillin. During the night 18 colonies grew.

    Target

    Wednesday 17th July

    Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent

    Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent, by using protocol 2 with these specifications:
    The night before, cells were inoculated in a 5 ml culture and grown overnight with selection.
    0.05 ml of the cell culture was diluted ~ 1:200 into 10 ml of selective media (Chl31,Spect) and grew to an OD600 of 0.6 – 0.7
    (sD001+pD004 didn’t grow and protocol was continued for sD001+pD005 - see comment). Cells were Spun down at 4 ºC, 4000 rpm, 15 minutes.
    Then were resuspended in 15 ml, ice-cold 100 mM CaCl2 and left for 3 hours.
    Next, cells were spun down at 4 ºC, 4000 rpm, for 15 minutes, Resuspended in 4 ml, ice-cold 100 mM CaCl2 + 15% glycerol
    and aliquoted into pre-chilled Eppendorf tubes. Tubes were immediately stored at -80ºC.
    10 ml CaCl2 100nM + glycerol 15% was made from:
    • 3.33 ml Glycerol 60% solution.
    • 6.17 ml Sterile water
    • 0.5 ml CaCl2 2 M solution.

    Comment: sD001+pD004 did not grow overnight (and possibly always) in Streptavidin
    instead of Spectinomycin so they most likely lost their resistance and we will make them again tomorrow by tranforming the BL21(DE3) cells with pD004.

    Target

    Thursday 18th July

    Heat shock Transformation

    Transformations made:
    • sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
    • sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
    • sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol
    Transformations were made with protocol 1 with the following specifications:
    BL21 (DE3) chemically competent cells were thawed on Ice.
    2ul of plasmid DNA was added to 20ul of BL21 (DE3) cells. Cells were incubated on ice for 30 minutes.
    Cells were transfered to heating block at 42C for 45s. Cells were returned to ice for 2 minutes.
    200ul of LB Broth was added to the cells and they were incubated at 37C for 1h.
    After incubations cells of each transformation were plated on two plates: one with 5 ul , and the other with 100 ul of the post recovery cells culture.

    Target

    Friday 19th July

    TRANSFORMATIONS WORKED!!! cells were stocked and entered in catalog.

    • sD012/sD013=sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
    • sD016/sD017=sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
    • sD014/sD015=sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol

    Glycerol Stocks were made of the above mentioned strains
    2 Single colonies from each agar plate of above mentioned strains were picked and used to inoculate 5ml LB broth overnight.
    750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
    Two sets of Glycerol stocks were used for each of sD001+pD004, sD001+sD004+sD005, sD001+sD004+sD006;
    one set was frozen at -20ºC and the other set was frozen at -80ºC.

    Target

    Wednesday 24th July


    24/7/13



    Made 500 ml of M9 Minimal Plates with Sulfur Dropout Powder accouding to the following recipe:



    Recipe: M9 Minimal Plates with Sulfur Dropout Powder



    These stock solutions can be pre-sterilized and stored indefinitely:



    5x M9 Salts (from scratch)


    Reagent

    Quantity

    Na2HPO4

    17 g

    KH2PO4

    7.5 g

    NaCl

    1.25 g

    (NH4)2SO4

    3.0 g


    Bring to a total volume of 500 ml.

    Adjust pH to 7.4 with NaOH.

    Sterilize by autoclaving or filtration



    or



    5x M9 Salts (from Difco Powder)


    Reagent

    Quantity

    M9 Salts

    28.2 g

    Bring to a total volume of 500 mL.

    Sterilize by autoclaving or filtration



    2x Yeast Plate Agar


    Reagent

    Quantity

    Agar

    30 g

    Bring to a total volume of 500 ml.

    Sterilize by autoclaving



    5x Amino Acid Dropout Powder


    Reagent

    Quantity

    Sulfur dropout powder

    0.5 g

    Bring to a total volume of 200 ml.

    Sterilize by autoclaving



    Sulfur dropout powder is a rich supplement mix with cysteine and methionine omitted:

    Amino acids


    Nucleotide bases




    Alanine

    2.0 g

    Leucine

    10.0 g

    Adenine

    0.5 g

    Arginine

    2.0 g

    Lysine

    2.0 g

    Uracil

    2.0 g

    Asparagine

    2.0 g

    Methionine

    0.0 g



    Aspartic acid

    2.0 g

    Phenylalanine

    2.0 g

    Vitamins


    Cysteine

    0.0 g

    Proline

    2.0 g

    p-Aminobenzoic acid

    0.2 g

    Glutamic acid

    2.0 g

    Serine

    2.0 g

    Inositol

    2.0 g

    Histidine

    2.0 g

    Tyrosine

    2.0 g



    Isoleucine

    2.0 g

    Valine

    2.0 g








    Recipe: M9 Minimal Plates with Sulfur Dropout Powder



    The plates can be made fresh from pre-sterilized stock solutions.


    Reagent

    Quantity

    5x M9 Salts

    200 mi

    5x Amino Acid Dropout Powder

    200 mi

    1 M MgSO4

    2 ml

    20% Glucose

    20 ml

    1M CaCl2

    0.1 ml



    Bring to a total volume of 500 mL

    Stir and warm on a hot plate to about 60 C (hot to the touch)



    Melt 500 ml 2x Yeast Plate Agar in the microwave for ~8 minutes on high

    Cool to about 60 C (hot to the touch)

    This takes about 30 minutes on the bench or 5 minutes in a water bath.



    Add the 2x Yeast Plate agar to the other reagents to make 1 L of media.

    This recipe will prepare 20 plates at 25 ml / plate.



    made 7 plates without antibiotics and 20 with Chloramphenicol and Spectinomycin - by mistake.

    Used one plate without AB to plate the following strains:

    • sD007=sD001+pD005

    • sD008=sD001+pD006

    • sD013= sD001+pD005+ pD004

    • sD015= sD001+pD006+ pD004


    Target

    Monday 5thAugust

    Confirmation of strains SD002 - SD018

    Strains sd002-sd018 were grown overnight in 5ml LB.

    Target

    Monday 5thAugust

    Confirmation of strains SD002 - SD018 using colony PCR

    Fresh single colonies of strains SD002-SD018 were prepared for PCR using the colony pcr protocol. The primers used for were FD_F, FD_R, FNR_F, FNR_R and SirA_F and SirA_R for each strain.
    Strains SD002-SD018 were confirmed.

    Target

    Day Numbersuffix Month

    Place your twit here

    Received FrpA and FdxA from IDT.
    Started cloning strategy:
    Ligated FdxA G block into pJET plasmid for stock purposes, using the following protocol:

    1. Set up the blunting reaction on ice:

    Component

    Volume

    2X Reaction Buffer

    10 µl

    Non-purified PCR product

    or

    purified PCR product/other sticky-end DNA fragment

    1 µl

    0.15 pmol ends

    Water, nuclease-free

    to 17 µl

    DNA Blunting Enzyme

    1 µl

    Total volume

    18 µl


    Vortex briefly and centrifuge for 3-5 s.

    2. Incubate the mixture at 70°C for 5 min. Chill on ice.

    3. Set up the ligation reaction on ice. Add the following to the blunting reaction mixture:

    Component

    Volume

    pJET1.2/blunt Cloning Vector (50 ng/µl)

    1 µl (0.05 pmol ends)

    T4 DNA Ligase

    1 µl

    Total volume

    20 µl


    Vortex briefly and centrifuge for 3-5 s to collect drops.

    4. Incubate the ligation mixture at room temperature (22°C) for 5 min.

    Target

    Tuesday 20th August

    Cloning of FdxA and FprA

    Digestion of FprA with NdeI and AvrII
    Gel Clean up of FprA fragment
    Digestion of pETDuet-1 with NdeI and AvrII
    Digestion of FdxA with NcoI and HindIII
    Digestion of pETDuet-1 NcoI and HindIII

    Target

    Wednesday 21st August

    Ligation and Transformations

    Ligation of FprA NdeI AvrII with pET NdeI AvrII
    Ligation of FdxA NcoI HindIII with pET NcoI HindIII
    Transformation of pET FprA into NEBTurbo
    Transformation of pET FdxA into NEBTurbo

    Target

    Thursday 22nd August

    Nano drop

    Plasmid mini-prep of transformations
    Nano dropped
    1. pETDuet: 59.1ng/ul
    2. pETDuet: 45.9ng/ul
    3. pJET Fdx: 54.2ng/ul
    4. pLS FRP: 19.7ng/ul

    Digest pLS FrpA with NdeI and AvrII
    Digest pETDuet with NdeI and AvrII
    Digest FdxA gBlock with NcoI and HindIII
    Digest pETDuet with NcoI and HindIII
    Ligation of FprA with pETDuet
    Ligation of FdxA with pETDuet
    Transformation of pET FprA and pET FdxA into NEBTurbo
    PCR of
    • FdxA gBlock with FdxA F/R
    • pLS FprA with FprA F/R
    • pET duet with MCSI F/R
    • pACYC duet with MCSI F/R

    Target

    Friday 23rd August

    Patching

    Patched colonies of pET FprA and colonies of pJET FdxA
    Transformations of pET Fdx didn't work
    Checking strains containing plasmids fpr to make sure genes are there.
    Results from Thursdays PCR:
    • no band for fdxA
    • band for fprA
    • band for pET
    • no band for pACYC

    Target

    Saturday 24th August

    Weekend warriors!

    Nanodrop
    • FdxA 1 3.1ng/ul
    • FdxA 2 4.3ng/ul
    • pET Duet 6.2ng/ul
    • pET Duet 4.9ng/ul

    Checking FdxA gBlock by PCR
    • 1 ul Fdx F
    • 1 ul Fdx R
    • 1 ul Template
    • 7 ul H20
    • 10 ul dreamTaq 2x master mix
    • PCR failed.

    Target

    Sunday 25th August

    Ligations

    For FprA and pET Duet:
    1. Miniprep more plasmid
    2. Digest plasmid and vector backbone
    3. Check DNA concentration
    4. Ligate

    Target

    Monday 26th August

    P1 phage transduction


    The p1 phage lysate was prepared as described in the P1 phage transduction protocol.
    BL21 (DE3) ΔCysI Δfpr ΔydbK was grown in 5ml Lb.
    One colony was discovered in transformed plate. This colony was re-streaked and grown overnight.
    the ligation product from overnight ligation was used to transorm NEB cc cells by heatshock
    5ul plate gave a few colonies
    10ul plate gave many colonies

    Target

    Tuesday 27th August

    Sequencing FdxA

    pJET FdxA sent for sequecing
    Steps 2-7 of the P1 phage transduction: Lysate preparation were carried out.
    BL21(AI) was picked and placed into 5ml LB and incubated at 37C overnight.

    Target

    Wednesday 28th August

    P1 phage transduction

    The transduction section of the P1 phage transduction protocol was carried out. Cells were plated on Kanamyocin plates to select for resistance and grown overnight.

    Target

    Thursday 29th August

    Colonies from the P1 phage transduction grew on the Kanomycin plates.

    Selected colonies were patched onto Kan and LBA plates and left to grow overnight.

    Target

    Friday 30th August

    Confirmation of P1 phage transduction:

    Colony PCR was used on patched colonies from the p1 phage transduction. The primers used for each colony were CysI F/R and KanR F/R.

    PCR confirmed that CysI was deleted in BL21(AI) and replaced with a Kanomycin resistance gene.
    2 Single colonies from each agar plate of the patched p1 phage transduced plates were picked and used to inoculate 5ml LB broth overnight. 750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.

    Target

    Monday 9th September

    Sevres Workshop

    Sevres Workshop

    Target

    Tuesday 10th September

    Sevres Workshop

    Sevres Workshop

    Target

    Monday 16th September

    Cloning gBlock FdxA and Biobricking FprA and SirA

    FprA and SirA were PCRed with FprA BB F, FprA BB R, SirA BB F and SirA BB R primers respectfully. The PCR was run with an annealing temperature of 60C with an extension time of 1m40s using Phusion polymerase. The band of ~1400bp was cut out and cleaned up using a Quagen Gel Extraction Kit.

    Restriction Digestion of gBlock FdxA with NcoI and HindIII. pET FprA was also digested with NcoI and HindIII. Digestion lasted 30 minutes at 37C afterwhich enzymes were heat inactivated at 80C for 20 minutes. Digestions were ligated together using 6.5ul of FdxA insert and 2ul of FprA into a total volume of 10ul.

    PCR products for FprA and SirA along with linearized pSB1c3 backbone were digested with EcoRI and PstI for 30m at 37C. Restriction enzymes were then heat inactivated at 80C for 20 minutes. Digestions were then ligated together using equal amounts of 2ul insert to 2ul of backbone.

    Target

    Tuesday 17th September

    Transforming gBlock FdxA and Biobricking FprA and SirA

    Ligations were transformed into E. coli NEBTurbo Chemically Competent Cells by Heat Shock transformation. Cells were recovered for 1.5 hours before being plated. pSB1c3 fprA and pSB1c3 SirA were plated onto Chloramphenicol plates (34ug/ul) and pET FprA FdxA were plated onto Ampicillin (50ug/ul) plates.

    Target

    Wednesday 18th September

    Patching gBlock FdxA and Biobricking FprA and SirA

    Colonies from Transformation were patched onto appropriate antibiotic plates, 15 colonies from SirA were patched, 6 colonies from FprA were patched and 4 colonies from FdxA were patched.

    Target

    Thursday 19th September

    PCR Verification of vectors

    Vectors (pET FprA FdxA, pSB1c3 SirA, and pSB1c3 FprA) were used for colony PCR using DreamTaq. Primers used were:

    pET FprA FdxA: MCSI F/R, MCSII F/R, FprA F/R, FdxA F/R

    pSB1c3 SirA: SB-prep-3P-1/SB-prep-2Ea, SirA F/R

    pSB1c3 FprA: SB-prep-3P-1/SB-prep-2Ea, FprA F/R

    Target

    Saturday 21st September

    Weekend Rush

    Gibson assembly of pSB9S1, pSB10K1, and pSB3C7.

    Digestion of sirA, fprA, fdxA and linearized backbone with XbaI and SpeI

    Digestion of Linearized pSB1C3 with XbaI, SpeI, and DpnI

    Ligation of sirA, fprA, and fdxA with pSB1C3

    Heat Shock transformation of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA into NEBTurbo

    Heat Shock transformation of pSB9S1, pSB10K1 and pSB3C7 into NEBTurbo

    Target

    Sunday 22nd September

    Verifying shipment vectors

    Growing Culture of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA.

    Mini-prep of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA vectors

    Colony PCR of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA with sirA F/R, fprA F/R, fdxA F/R, and biobrick verification primers F/R

    Target

    Friday 27th September

    Growth Curves

    IPTG Concentrations by column: 1 0nM, 2 10nM, 3 50nM, 4 100nM, 5 500nM, 6 1uM, 7 5uM, 8 10uM, 9 50uM, 10 100uM, 11 500uM, 12 1mM

    Arabinose Concentrations by column: 1 0%, 2 0.01%, 3 0.02%, 4 0.03%, 5 0.04%, 6 0.05%, 7 0.06%, 8 0.07%, 9 0.08%, 10 0.09%, 11 0.1%, 12 0.2%

    Row A: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row B: BL21 AI dcysI pACYC SirA pET FprA FdxA 1 Row C: BL21 AI dcysI pACYC SirA pET FprA FdxA 2 Row D: BL21 AI dcysI pACYC SirA pET FprA FdxA 2

    Row E: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row F: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1 Row G: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 Row H: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2 10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Glucose, 5ul CaCl2, 27.5mL H2O

    Target

    Saturday 28th September

    Growth Curves

    Growth curves of BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA. Column 1: Positive control WT E. coli BL21 (DE3), 2: Negative Control BL21 AI dcysI, 3: BL21 AI dcysI pACYC SirA pET FprA FdxA 0 Arabinose 0 IPTG, 4: 0.1% Arabinose 10uM IPTG, 5: 0.05% Arabinose 50uM IPTG, 6: 0.01% Arabinose 100uM IPTG, 7: 0.2% Arabinose 1mM IPTG, 8: Negative Control BL21 (DE3) dcysI dfpr dydbf, 9: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 0 IPTG, 10: 50nM IPTG, 11: 1uM IPTG, 12: 50uM IPTG

    Grown in M9 Media with Galactose.

    10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Galactose, 5ul CaCl2, 27.5mL H2O

    Target

    Sunday 29th September

    PCR's and more!

    Colony PCR on new Backbones. RFP and Biobrick verification primers This is for pSB2C and pSB3K

    Colony PCR on SirA, FprA, and FdxA Biobricked parts Using Biobrick primers and SirA, FprA and FdxA primers respectfully http://2013.igem.org/File:20130929_BioB.jpg http://2013.igem.org/File:20130929_RFP.jpg http://2013.igem.org/File:20190929_pSB3K.jpg

    Phusion PCR on Duet vectors and pSB1C3 using standard cloning primers

    Gel Clean up

    Digestion with NcoI and AvrII

    Standard cloning of new backbones (1h ligation at 16C)

    Transform into NEBTurbo

    Cutting Biobrick SirA, FprA, FdxA and Linearized backbone with EcoRI and SpeI

    Standard clonging of Biobrick parts (1h ligation at 16C)

    Transform into NEBTurbo

    Treat XbaI SpeI cut Backbone with TSAP 1h.

    Standard cloning of Biobrick parts (cut with XbaI, SpeI) into TSAP'd backbone (1h @ 16C)

    Colony PCR on BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA

    Target

    Monday 30th September

    Growth Curves

    We performed Growth Curves with the following strains in each column:
    1. WT BL21 AI
    2. BL21 AI dcysI
    3. BL21 AI dcysI pD002 pD003 0uM IPTG 0% Arabinose
    4. BL21 AI dcysI pD002 pD003 10uM IPTG 0.05% Arabinose
    5. BL21 AI dcysI pD002 pD003 100uM IPTG 0.1% Arabinose
    6. BL21 AI dcysI pD002 pD003 1mM IPTG 0.2% Arabinose
    7. WT BL21 DE3
    8. BL21 DE3 dcysI dfpr dydbf
    9. BL21 DE3 dcysI dfpr dydbf pD002 pD003 0uM IPTG
    10. BL21 DE3 dcysI dfpr dydbf pD002 pD003 10uM IPTG
    11. BL21 DE3 dcysI dfpr dydbf pD002 pD003 100uM IPTG
    12. BL21 DE3 dcysI dfpr dydbf pD002 pD003 1mM IPTG
    13. Results are http://2013.igem.org/File:20130930_GC_Glucose.xls

    Target

    Tuesday 1st October

    Israeli Collaboration

    Plasmids arrived. PCR CI plasmid with CI biobrick F/R primers.

    Gel Clean-up of CI promoter PCR

    Z score of BL21 dCysI pD002 pD003:Didn't Grow, forgot Sucrose in M9

    Transform pSB1A3 E0240 and pSB3K3 into NEB Turbo

    Target

    Wednesday 2nd October

    Race to finish stuff

    Grew up 5ml cultures of pSB3K3 and pSB1A3 E0240 from transformations

    Plasmid mini preps of pSB3K3 and pSB1A3 E0240

    Restriction Digest of CI promoter PCR product with XbaI and PstI

    Restriction Digest of Linearized Backbone pSB1C3 with XbaI, PstI, and DpnI

    Make new NEB Turbo Chemically Competent Cells: Modified protocol. 4mL of NEBTurbo into 2 x 2mL tubes. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of 100mM MgCl2 Ice cold. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of iGEM cc cell buffer Ice cold. Centrifige for 1 minute at 14000 rpm at 4C. resuspend in 100ul of iGEM cc cell buffer Ice cold.

    Heat Shock Transformation of pSB1C3 SirA, pSB1C3 FprA, pSB1C3 FdxA into NEBTurbo (new chemically competent cells)

    Ligation of CI promoter with pSB1C3 backbone.

    Heat Shock Transformation of pSB1C3 CI into NEB Turbo

    Target

    Thursday 3rd October

    Race to Finish stuff

    Plated new SirA, FprA, and FdxA transformations on CHL

    Picked pSB1C3 CI and grew in LB broth

    Z Score of BL21 dCysI pD002 pD003 with Gentamicin as positive hit control

    Analytical Digestions of New Vectors (pAD1S, pAD2C, pAD3K, pAD4A)

    Digest pSB1C3 CI with EcoRI and SpeI

    Digest pSB3K3 with EcoRI and PstI

    Digest pSB1A3 E0240 with XbaI and PstI

    Ligation of CI promoter with GFP reporter and pSB3K3 backbone

    Heat Shock Transformation of pSB3K3 CI GRP into NEBTurbo

    PCR verify SirA, FprA, FdxA, and CI biobrick constructs

    Infiltrate

    Monday 22nd July


    Transforming the NEB TURBO strain with the pET21b and the pUC18 plasmids. Competent cells were prepared by the CaCl2 protocol. The transformation cultures were plated on ampicilline plates. Transformation was unsuccessful.

    Infiltrate

    Tuesday 23rd July


    Transforming the new NEB strain with the pET21b and the pUC18 plasmids (as yesterday). We’ve also plated the leftovers from the yesterdays' transformation (190 µL of culture on ampicilline plates).

    Infiltrate

    Wednesday 24th July


    Transformation form yesterday didn’t work. We plated the leftovers on new ampicillin plates.

    Infiltrate

    Thursday 25th July


    The transformation worked, probably it failed the last two times because the recovery time was to short or the plates were wrong. We did a streak plate to get single colonies.

    Infiltrate

    Friday 26th July


    Single colonies were plated into LB + ampicillin. 4 liquid cultures were prepared: NEB + pET21b (1), NEB + pET21b (2), jNEB + pET21b (1), jNEB + pET21b (2). After 6 h of incubations the liquid cultures were used for

    • Glycerol stock preparation.
    • Plasmid purification (the protocol from the box).

    DNA concentrations were measured by the nanodrop (ng/µL):

    NEB1 134.4
    NEB2 55.6
    jNEB1 186.6
    jNEB2 138.6

    Infiltrate

    Monday 29th July


    We did an analytical digest of pET 21b that we purified yesterday. We used Nedl and Xhol so our fragments should be: the backbone of the plasmid (around 5000 bp long) and the cloned MSMEG_1529 gene (around 600 bp long). On the following picture is our plasmid and we suppose that the MSMEG_1592 gene is cloned somewhere in between the two restriction sites that we have chosen. But we still don't really know that because we need the full sequence of the plasmid.

    The protocol used for preparing the digestion:

    Reagent Volume 10x
    Plasmid Miniprep 5µl
    H2O 12 µl 120 µl
    10x FastDigest Buffer 2 µl 20 µl
    10x FastDigest Buffer 2 µl 20 µl
    FastDigest Enzyme 1 0.5µl 5 µl
    FastDigest Enzyme 2 0.5µl 5 µl
    Total Volume 20.0 µl 200 µl

    Digest for 1 h at 37 °C with shaking.



    NEB1 and 2 are plasmids isolated from two different liquid cultures of the NEB strain; jNEB1 and 2 are plasmids isolated from two different liquid cultures of the NEB strain which was made competent by Jake. The (-) stands for a negative control: only DNA was added, without any digestion enzymes. As you can see it on the gel there are 2 bands - one is around 5000 bp long (fits the length of our plasmids backbone), and the other one is around 700 bp long (fits the length of our gene).

    Infiltrate

    Tuesday 30th July


    Transformed the bl21 (DE3) strain with the pET21b (plated the transformation culture on 2 amp plates).

    Infiltrate

    Wednesday 31st July


    Transformation worked. The number of transformed colonies is: 78 on plate 1 and 284 on plate. We prepared the liquid cultures and glycerol stocks of bl21 (DE3) + pET21b strain.

    Infiltrate

    Thursday 1st August


    We want to see if 1 mM solution of IPTG induces the over expression in our strain. We prepared 4 liquid cultures (no antibiotics added):

    • bl21 (DE3) + pET21b strain induced with 1 mM IPTG
    • uninduced bl21 (DE3) + pET21b strain
    • untransformed bl21 (DE3) + 1 mM IPTG
    • untransformed bl21 (DE3)

    10 mL of culture had 500 µL of the overnight culture (O.D.600 was set to 0.2) and 100 µL of 100 mM IPTG. We measured the O.D. of the cultures (600 nm) for time 0 and after 6 h. We also diluted our cultures to calculate the CFU/mL (for time 0 10-1 and 10-2 dilutions were prepared, and 100 µL of each dilution was plated on LBA plates; for 6 h 10-3, 10-4 and 10-5 for the induced culture and 10-7, 10-8 and 10-9 for all the others, 10 µL of each were plated). We also saved 2 mL for each group in the fridge.

    Infiltrate

    Friday 2nd August


    We repeated the time 6 measurement (the cultures were over diluted, so this time we did 10-5, 10-6 and 10-7). We also did the 24 h measurement (we used the 10-6, 10-7 and 10-8 dilutions). The final results are:





    Growth inhibition could be noticed for the induced strain, which is probably a consequence of the over expression. The induced culture recovered and reached a greater CFU/mL value than in the previous groups. Maybe because we didn’t add any antibiotics in our media, the plasmid was lost and the culture could recover after achieving the over expression.

    Infiltrate

    Monday 5th August


    We want to repeat our previous experiment, but now we will add ampicillin in the media containing the transformed strains. We set everything as previously, did the 0 h (100 µL of 10-1 and 10-2) and 6 h measurement (100 µL of 10-1 and 10-2 for the induced strain; 100 µL of 10-1 and 10-6 for the others).

    Infiltrate

    Tuesday 6th August


    We did the 24 h measurement (100 µL of 10-6 and 10-7), and repeated the 0 h measurement (100 µL of 10-3 dilution).

    Infiltrate

    Wednesday 7th August

    Repeated the 0 h measurement for uninduced bl21 (DE3) + pET21b strain (100 µL of 10-3 dilution), and the 24 h measurement for the induced strain (100 µL of 10-5, 10-4, 10-3 and 10-2).

    Infiltrate

    Thursday 8th August



    The growth curve for uninduced and induced bl21 (DE3), with antibiotics in the liquid culture:





    The O.D. grows again after 24 h for the induced strain, but the CFU stays the same. Probably the O.D. grows because of the protein.

    Infiltrate

    Monday 12th August


    In order to grow M. smegmatis we should add Tween 80 (0.2 % / v.v) into the LB media (it stops the cells from forming clumps). In some papers we found that Tween 80 could inhibit the growth of E. coli, so we did a growth curve to check that. 500 μL of BL21 + pET21b culture (O.D. 600 nm = 1.00) was added to 10 mL of LB supplemented with different concentrations of Tween 80 – 0.2, 0.1 and 0.05 %. There were two sets of these cultures – one was induced with IPTG and the other one was not. O.D. was measured after 3 and 6 h. At these time periods cultures were also diluted to calculate the CFU. No growth inhibition was observed, so we can use Tween 80 in our E.coli – M. smegmatis co-cultures. We have also made some plates with malachite green (40, 4 and 0.4 μg/mL) and we have plated E. coli on them.

    Infiltrate

    Tuesday 13th August


    We finally got M. smegmatis today!!! We made liquid cultures in LB + 0.2% Tween 80 and we also plated it on LBA.
    E. coli doesn’t grow on plates with 40 and 4 μg/mL of malachite green, but it does on 0.4 μg/mL.

    Infiltrate

    Wednesday 14th August


    Streak plate and liquid cultures for M. smegmatis and E. coli BL21 + pET21b. We started a plate reading experiment in order to see which concentrations of nalidixic acid should we use in our selective media. The tested concentrations were: 50, 25, 12.5, 6.25,3.125, 1.5625, 0.78125, 0.390625, 0.1953125, 0.09765625, 0.048828125 μg/mL. We also tested different concentrations of IPTG, to see which ones induce the strain without killing it. The tested concentrations were: 1, 0.5, 0.25, 0.125, 0.0625, 0.03125, 0.015625, 0.0078125, 0.00390625, 0.001953125, 0.0009765625 μg/mL. The concentration of bacteria in each well was 1 % and the bl21 culture of O.D. = 0.5 was used.

    Infiltrate

    Thursday 15th August


    Another plate reading experiment, with M. smegmatis for nalidixic acid (50, 25, 12.5, 6.25,3.125, 1.5625, 0.78125, 0.390625, 0.1953125, 0.09765625, 0.048828125 μg/mL) and with malachite green (400, 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, 0.390625 μg/mL); The concentration of bacteria was 1 % in LB with 0.2 % of Tween 80 and the culture with O.D. of 0.5 was used.

    Infiltrate

    Friday 16th August


    We started a growth curve for M. smegatis. In 20 mL of LBA with 0.2 % of Tween 20 μL of the liquid culture was added (O.D. Of the culture which was inoculated was 1). O.D. And CFU were determined each 3 hours. Dilutions which were used are: 10-1 and 10-2 for time 0, 10-2 and 10-3 for 3 h, 10-5 and 10-6 for 9 h.

    Infiltrate

    Saturday 17th August


    Because we suspect that the culture was contaminated we repeated the experiment with 3 separate cultures. n 20 mL of LBA with 0.2 % of Tween 20 μL of the liquid culture was added (O.D. Of the culture which was inoculated was 1). O.D. And CFU were determined each 3 hours. Dilutions which were used are: 10-1 and 10-2 for time 0, 10-2 and 10-3 for 3 h, 10-5 and 10-6 for 9 h, 10-7 for 24 h. We saved some plates so we could perform acid fast staining and check if its really M. smegmatis. We have transformed bl21 by electroporation with pET21b and with pSB1C3, so we could get RFP E. coli expressing our protein. The transformed culture was plated on plates containing ampicilline and chloramphenicol.

    Infiltrate

    Sunday 18th August


    Made a liquid culture of BL21 + pET21b + pSB1C3. Plated the strain which contains the LLO plasmids (pACYZ184) on LBA + tetracycline + chloramphenicol, LBA + tetracycline and LBA + chloramphenicol because we don’t know which resistance the plasmid really has.

    Infiltrate

    Monday 19th August


    LLO plasmid containing bacteria are growing only on chloramphenicol containing plates, so tetracyclin resistance was lost due to the cloning of the hly downstream of the tet promoter.

    The cells we transformed with pET21b (ampiciline resistance) and with the pSB1C3 plasmid (chloramphenicol resistance) are not growing on amp and chl containing plates because the origins of the plasmids are not compatible. So we are repeating the transformation with the pSB3C5 plasmid, which has a different origin.

    We have started a co-culture with M. smegmatis and E. coli NEB turbo + pSB1C3 to see if our selective media with nalidixic acid is really working. Two cultures in their stationary phase were mixed (O.D. for M. smegmatis was 1.5 and for E. coli was 1): in 10 mL of LB 100 µL of each culture was added. We did dilution series for the start cultures and for the co-culture. Each was plated on: LBA plates where both strains should grow; on LBA + 3 µg/mL nalidixic acid plates, where only M. smegmatis should grow; on chl plates where only E. coli should grow.

    Infiltrate

    Tuesday 20th August


    We did a miniprep for the LLO plasmid (we had to do dialysis to purify the plasmid).

    We observed the RFP producing cells (BL21 + pET21b + pSB3C5) under the fluorescent microscope and the cells produce RFP. We made a liquid culutre of the strain with 1 mM IPTG. We also plated them on LBA + 1 mM IPTG.

    Liquid culture of M. smegmatis was made, but in the liquid culture 2 µL/mL of malachite green was added. We plated the culture on LBA + 3 µL/mL of nalidixic acid and on LBA to compare the number of colonies.

    Infiltrate

    Wednesday 21st August


    Our macrophages arrived today and we are staring a cell culture! The cells with pET21b and pSB3C5 can't survive the induction with 1 mM IPTG because they have two IPTG inducable promoters. We want to use a different insert, one with an uninducable promoter, such as BBa_J23100-118.

    Infiltrate

    Thursday 22nd August


    Counting the colonies from Monday; our plates with nalidixic acid are selective. We also noticed that the colonies showed up faster on the plates for the liquid culture supplemented with malachite green.

    Infiltrate

    Monday 26th August


    We started a killing assay for M. smegmatis: we had two groups; in the first one the ratio between M. smegmatis and E. coli BL21 + pET21b was 1:1 and in the other it was 1:2. BL21 was induced with 1 mM IPTG in the co-culture (10 mL of LB, 0.1 mL of each strain and 0.1 mL of 100 mM IPTG). For each group a control was made - same ratio between the strains but no induction. Also we had one group with only M. smegmatis. We did dilution series for time 0, after 3 and after 6 h. We also measured the O.D. (600 nm) for each time point.

    Infiltrate

    Tuesday 27th August


    We did a digestion of J23102 and J23104 with EcoRI and with and Pstl and we gel purified the RFP gene with a constitutive promoter. We also did a digestion for pSB3C5 with the same enzymes and we did gel purification for the backbone. The ligation product was then transformed into NEB Turbo.

    Infiltrate

    Wednesday 28th August


    Cloning from yesterday didn't work, so we will repeat everything with a different backbone. On gels for the digested pSB3C5 we couldn't see the part which was cut out, so we guess there is something wrong with this plasmid and we want to use a new one - pColaDuet-1 with a colA origin. We amplified the insert form J23102 and J23104 with biobrick verification primers and then we did PCR purification. We digested the insert and the backbone with EcoRI and Pstl and we did PCR purification for both of them. After measuring the concentration for both, we did a ligation in molar ration insert:backbone = 3:1 on 16 deg C for 1 h. The ligation product was transformed into NEB Turbo.

    Infiltrate

    Thursday 29th August


    We did a phagocytosis assay for our macrophages. First we passaged our cells and we determined their number (colored them with trypan blue and counted them): 2.68* 106, 3.72* 106 and 1.32* 106. To the first one we added 40, to the second 30 and to the last one 90 µl of NEB + pSB1A3 cell suspension. After 1 h we made this awesom picture:



    Cloning from yesterday didn't work, so we repeated everything with longer digestion time for the backbone.

    Infiltrate

    Friday 30th July


    Cloning worked. Made liquid cultures. Counted the colonies for the killing assay.

    Infiltrate

    Saturday 31st July


    miniprep for pColADuet-1 + J23102/104. PCR for pET21b and the LLO plasmid (it didn't work).

    Infiltrate

    Monday 2nd September


    Transformed BL21 + pET21b with pColA + J23102/104 (electroporation and heat shock), transformed BL21 + pET21b with pColA + J23102/104 and with the LLO plasmid. The PCR for the pET21b worked and we've sent it for sequencing; the PCR for the LLO plasmid didn't work :(

    Infiltrate

    Tuesday 3rd September


    Liquid cultures for BL21 + pET21b + pColA and for BL21 + pET21b + pColA + the LLO plasmid. We passaged the macrophages and we ordered new primers for sequencing the LLO plasmid.

    Infiltrate

    Wednesday 4th September


    The killing assay for M. smegamtis, with more time points. Now we can also follow the number of E. coli because it has RFP. In 20 mL of LB we added 100 µL of the M. smegmatis liquid culture (O.D. = 1.2) and 100 µL of the E. coli liquid culture (O.D. = 1) so we get 1:1 ratio. We measured the O.D. and the CFU for time 0, 1, 2, 3 and 6 h. To do the CFU for E. coli we plate the dilution on LBA + Kan + Amp, and for M. smegmatis we plate on LBA + 30 µL.

    Infiltrate

    Thursday 5th September


    Counted the colonies for E. coli and prepared everything for another killing assay. Liquid cultures for E. coli BL21 + pET21b + the LLO plasmid + the RFP plasmid; BL21 + pET21b + the RFP plasmid; M. smegmatis.

    Infiltrate

    Friday 6th September


    New killing assay with different E. coli and M.smegmatis ratio --> 0.1 : 1

    Infiltrate

    Saturday 7th September


    New killing assay with a new ratio --> E. coli : M. smegmatis = 0.01 : 1

    Infiltrate

    Monday 9th September


    Counting the colonies from the killing assay and doing the Bradford assay for each time point.

    Infiltrate

    Tuesday 10th September



    • PCR for the linearized backbone: template - pSB1C3 (1 µL), primers (SB-prep-2Eb, SB-prep-3P-1; 2.5 µL), HE buffer (10 µL), dNTPs (1 µL), polymerase (0.5 µL), dH2O (32.5 µL).

    program: 94.0 (30 s) - 94.0 (10 s), 55.0 (1 min), 72.0 (2 min), 72.0 (3 min) - 30 cycles.
    • touchdown PCR for the new backbones:

    Template Primers
    pACYC pDCA2 and pDCA
    pET pDCo4-F and pDCo4-R
    pCDF pDCA1 and pDCA
    pColA pDCA3 and pDCA


    program: 95.0 (10 s) - 95.0 (30 s), 60.0 (30 s), 59.0 (30 s),58.0 (30 s), 56.0 (30 s), 55.0 (30 s), 72.0 (30 s) - 72.0 (10 min)- 30 cycles.

    Infiltrate

    Wednesday 11th September


    PCR for biobricking TDMH, for sequencing the LLO plasmid and for adding biobrick cutsites to pET21b; PCR purification of the products. PCR for the linear backbone and PCR purification. PCR for the new backbones gel slice and purification.

    Infiltrate

    Thursday 12th September




    • linear bacbone PCR: Phusion protocol from the 10th of the September, new PCR program: 98.0 (30 s) - 98.0 (10 s), 58.0 (15 s), 72.0 (1:10) - 72.0 (3 min). This time the PCR worked fine - no unspecific binding; the band was 2 kb long.

    • PCR for biobricking TDMH: we designed primers to add biobrick cutsites on our TDMH gene. Template - pET21b+TDMH miniprep (150 ng/µL), primers - TDMH F (gaattcgcggccgcttctagATGATTTCCCTCCGGAAGCC) and TDMH R (ctgcagcggccgctactagtaTCAGTGGTGGTGGTGGTGGT). Program: 98.0 (30 s) - 98.0 (10 s), 62.0 - 58.0 (30 s), 72.0 (30 s) - 72.0 (10 min). It worked, bend size - 700 bp.

    • Gibson assembly for the new backbones: PCR products from the 10th of September were used (the same PCR reaction was done for the biobrick pSB2C3 backbone with all primers, so each PCR product for the Duet backbones was mixed with the corresponding pSB product. Protocol: 5 µL of each product, 10 µL of the Gibson master mix, 15 min on 50.0.

    • PCR for RFP - we wanna add biobrick cut sites on the RFP gene from pSB1C3 (Phusion protocol). Primers: gaattcgcggccgcttctagATGGCTTCCTCCGAAGACGT(RFP F), ctgcagcggccgctactagtaGCGATCTACACTAGCACTAT (RFP R).

    • PCR to biobrick pET, so we could clone RFP in it and put it under the T7 promoter: template is pET21b+TDMH (Phusion protocol). Primers: tactagtagcggccgctgcagGATCCGGCTGCTAACAAAGC (pET R), ctagaagcggccgcgaattcATGTATATCTCCTTCTTAAA (pET F)

    • miniprep for DB3.1 + pColA-pSB3C5 and for DB3.1 + pCDF-pSB3C5. Then we did colony PCR for the minipreps with the corresponding primers (pDCA/pDCA3 and pDCA/pDCA1) to check if the insert from the Duet vectors is inside. The bends were the right size.

    • Digestion of TDMH (biobricked) and the linear backbone:
    For the backbone: 10 µL of the plasmid, 10 µL of the Green buffer, 3 µL for EcoRI and Pstl, 14 µL of dH2O.
    For TDMH: 10 µL of the pcr product, 4 µL of the Green buffer, 1.5 µL for EcoRI and Pstl, 23 µL od dH2O.

    • PCR Ligation for biobricking TDMH: dH20 4.5 µL, TDMH 1 µL, linear backbone 3 µL, T4 ligation buffer 1 µL, T4 ligase 0.5 µL; 16.0 fr 1 h.

    Infiltrate

    Friday 13th September


    A lot of macrophages died (in suspension) because we forgot to add glutamine and pyruvate sodium. We repeated the experiment with the complete media (but again without antibiotics).


    • Results for the GA: because the Chl plates were off, I have to repeat everything for biobricking TDMH and for the pACYC derived backbone. The cloning for pCDF and pColA worked - patched the colonies, start liquid cultures.

    • Launch NEB Turbo to make competent cells.

    Infiltrate

    Saturday 14th September


    Fresh liquid cultures for: M smegmatis pMyC-GFP (kanamycine resistance) , M smegmatis, E.coli Bl21 carrying pET21b-TDMH and pColA-RFP (ampicilin and kanamycine resistances) and E.coli Bl21 carrying pET21b-TDMH, pColA RFP and pACyC-hly (ampicilin, kanamycine and chloramphenicol resistances)

    • CaCl2 competent cells for NEB Turbo - 25 mL of the culture (O.D. 1), 3 washing steps (1o min, 4 000 rpm, on 4.0). For the first one - 100 mM MgCl2, for the second - 100 mM CaCl 2, after the last one the cells were resuspended in CaCl2 + glycerol. I've also made electrocompetent cells (3 washes in dH20).

    • cloning biobricked TDMH in the linear backbone - protocol from the 12th of September. New competent cells and new Chl plates.

    • pET+pSB3C5 worked - miniprep; repeated the Gibson for pACYC

    • PCR for confirming pET+pSB3C5 - tamplet is the miniprep and the primers are pDCo4 R/F. pET Duet as the positive controle (Phusion protocol).

    Infiltrate

    Monday 15th September




    • Liquid culture for TDMH+pSB1C3.

    • Colony PCR for confirming TDMH+pSB1C3 with biobrick verification primers.

    • A new setup for testing if E. coli kills M. smegmatis in the macrophages: 2 wells with M. smegmatis, 1 well with M. smeg + E. coli uninduced, 1 well with only E. coli, 1 well with M. smeg + E. coli induced. First we infect the macropheges with the liquid culture of M. smeg GFP - we set the final O.D. of the culture in the well to 0.03 (100 µL of the liquid culture with O.D. 0.3 to 900 µL of RPMI with attached macrophages. After 2 h of incubation in the CO2 incubator we wash the cells with PBS 10 times and we add E. coli induced or uninduced (induced overnight with 10 µL IPTG).

    Infiltrate

    Monday 16th September




    • I have to repeat the biobricking of TDMH because I didn't use the DpnI and because the linear backbone which I was using didnt have the RFP cassette. So I've repeated the PCR with the right backbone.

    • Digesting the linear backbone: 10 µL plasmid, 10 µL fast digest buffer, 3 µL for EcoRI and Pstl, 1 µL od DpnI, 73 µL of dH20. 1 h, 37.0

    • Ligation of the digested linear backbone and TDMH - backbone 3 µL, insert 1 µL, ligation buffer 1 µL, ligation enzyme 0.5 µL, dH2O 4.5 µL.

    •A new setup for the macrophages; the protocol from the 15th of September; the groups were: macrophages alone, 2 x macrophages infected with M. smegmatis, 2 x macrophages infected with E. coli, 2 x M. smeg + E. coli uninduced, 2 x M. smeg + E. coli induced overnight, 2 x M. smeg + E. coli induced for 2 h. We also scratched the macrophages from yesterdays' setup and tried to get CFUs for them - 1 mL of the scratch (in PBS)was centrifuged (1 500 rpm, 10 min) to remove any cells which were not phagocytosed. The pallet was resuspended in 1 mL of PBS and the membranes of the macrophages were lysed with 5 µL of TritonX. 100 µL of the suspension was plated on LBA plates.

    Infiltrate

    Tuesday 17th September




    • A new setup (as yesterday); plated the scratches form yesterday. This time we washed our cells after the infection with e. coli.

    Infiltrate

    Wednesday 18th September


    Made pictures for the yesterdays' setup. The cloning from yesterday didn't work, so I plated the leftovers of the transformation culture.

    Infiltrate

    Friday 20th September




    • The cloning for biobricking TDMH worked, so we have to check if it has the insert. We run a PCR with the TDMH primers and we get a bend of around 700 bp, which is fine. We also did a PCR with the biobrick verification primers and the bend was around 1 kb and it was different then the band for the pSB1C3 (bigger, but the difference is not that obvious). So there is probably something inside.

    • We did a new setup where we also tried to use M. smegmatis which is not GFP and stain it with a fluorescent die for Mycobacteria, but its not working. After a few h the level of contamination was hughe so we are repeating everything tomorrow with adding antibiotics in the media.

    Infiltrate

    Tuesday 15th October


    Start fresh cultures for E.coli bl21 and M.smegmatis-GFP.
    Change the media of the macrophages J774.

    Infiltrate

    Tuesday 16th October


    We want to investigate the stability of the protein TDMH at different pH.
    To do this, I prepared buffers at different pH using monosodium phosphate and disodium phosphate.
    We used a calculator (http://home.fuse.net/clymer/buffers/phos2.html) to have an idea of how much miligrams should we add of each to get the right pH. Buffer strenght was 10mM.

    We prepared a range of pH and checked them using a pH meter.

    The pH were: 4,54 ; 5,15; 6,43; 7,36; 8,25 and 8,84

    pH lower than 4,5 and higher than 8,8 couldn't be reached (because of the pKa as it is a weak acid).

    We wanted to test another pH around 3, so we add HCl to reach pH 3.

    The buffer were made with osmosed water and have been autoclaved after the pH measurement.


    We also made glycerol stock of E.coli (the one with 3 plasmids carrying TDMH,LLO and RFP genes)from the overnight as described in the protocol.

    Infiltrate

    Thursday 17th October


    To study the stability of TDMH at 7 different pH we extracted it from E.coli using the kit B-PER.

    We have 4 groups:

    - M.smegmatis alone
    - M.smegmatis + E.coli's control (producing another protein) induced
    - M.smegmatis + E.coli's Bl21 (with TDMH gene) uninduced proteins
    - M.smegmatis+ E.coli's Bl21 (with TDMH gene) induced proteins

    We plate at time 0, 3h and 6 h using selective plates (nalidixic acid 3 micrograms/mL) and making 2 different dilutions

    We had 3 wells for each condition.
    We plated bacteria on 504 plates

    Infiltrate

    Friday 18th October


    Making fresh cultures to repeat the experiment.

    Infiltrate

    Saturday 19th October


    Repeating the pH experiment using smaller volume of detergent (3 microliters) because we were afraid that the detergent will affect M.smegmatis in the previous experiment.

    Infiltrate

    Tuesday 16th October


    Counting the colonies of M.smegmatis on the plates from Thursday.

    We stopped because we noticed no significant difference between what was tested and the controls.

    Maybe the protein wasn't extracted properly or it was extracted and inactive (denaturated)...

    Also we noticed a decrease of 10-20% of the number of M.smegmatis colonies growing in all the wells with the detergent (and the proteins) (around 50microliters per well).

    The very low pH (3 and 4,5) affected the growth of M.smegmatis by 20-30%

    Infiltrate

    Tuesday 21st October


    Counting the colonies from the second experiment ==> unsuccessful experiment.

    Infiltrate

    Tuesday 16th October


    Starting new cultures and making glycerol stocks for M.smegmatis-GFP.

    Infiltrate

    Tuesday 16th October


    We repeated the pH study using the plate reader and the OD this time.
    Same controls and conditions, the only difference is the protein extraction.
    We decided that we will just overexpressed E.coli (10mM IPTG as previously) and collect the supernatant.
    We centrifuged 5minutes at 4000 rpm and took the supernatant. Then, the supernatant was filter sterilized
    We add 200 microliters of M.smegmatis (OD 0,05) resuspended in the appropriate buffer and 20 microliters of E.coli (OD 0,5).
    To know precisely the initial number of bacteria, we made CFU for each pH (resuspended in a different buffer).
    We launched the plate reader for 24 hours.

    Contents

    Infiltrate

    <a href="http://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>

    Sunday 27th October

    </br>

    launched a plate reader experiment repeating the pH study (design as previously).


    M.smegmatis was resuspended in the buffers. The proteins of E.coli were collected by taking the supernatant (centrifugation 4000 rpm, 5 minutes). The supernatant was filtersterilized.

    Preparation of new buffers for the pH 3 and the pH 4,5. Former buffers weren't "strong" enough (pka = 7,2 for this couple). By adding chlorhydric acid we move on the second couple (pKa = 2,12) and have a sronger buffer.

    </html>

    Infiltrate

    <a href="http://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>

    Monday 28th October

    </br>

    Interpreting the plate reader experiment which shows many things (see results) including that pH doesn't affect TDMH action (except a small decrease for basic pH like 8,2)


    Grow the macrophages in a 12 well plate.


    We began the experiment to test the killing inside the macrophage. We will infect them with M.smegmatis-GFP then wash (5 times) and infect them with E.coli RFP producing TDMH (controls wells with E.coli uninduced and also an induced E.coli producing something else) and wash (5 times). Wait 3 hours and collect the bacteria from the macrophage using 2 different techniques:


    - Igepal detergent

    - Cold water for injectable preparations

    </br> </br>

    </html>

    Sabotage

    24th July


    starting bacterial culture of MG1655-6300 (Chantal’s glycerol)

    -streaking 2 Agar plate with it

    Sabotage

    25th July


    choosing a nice colony and launching overnight culture 37° in LB

    Sabotage

    28th July


    sRNA design

    A description...

    red sequences:

    pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT

    pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT

    We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be experimental issues with AmpR that is also on phagemid litmus28i.

    Sabotage

    2nd July


    Aude and Vincent

    glycerol stock

    from overnight culture of MG1655-6300 O/N : T001

    • Centrifuge 4000rpm, 10 minutes,

    • take out liquid

    • resuspend cells in 1mL glycerol, 2mL LB

    • separate in two cryotubes, one for the -80°C, one for the -20°C

    Electroporation

    - making MG1655-6300 competent (Aude’s protocol for electrocompetent cells & electroporation [ref needed])

    - test of the competent cells (negative

    -transforming with pCOLADuet-1 : Ec2 =>

    -transforming with pACYCDuet-1 : Ec2 =>

    - plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)

    Sabotage

    3rd July


    Aude and Vincent

    Transfo results :

    • negative controls are negative.

    • Transformed cells grew on plates

    • in the evening launch of 5mL Lb cultures from clones on the plates

    Igem Buffer for chemical competent cells

    Igem protocol for chemical competent cells

    Launch overnight culture of NEB turbo

    5mL LB inoculated with a clone from plate of drug team

    Sabotage

    4th July


    Aude

    • Glycerols of the overnight cultures of the transformation

    • sT002 : MG1655 pCOLADuet-1

    • sT003 : MG1655 pACYCDuet-1

    Aude and Clovis

    Making stocks of electro competent NEB turbo

    Prepare 10% glycerol solution

    Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes

    Cool down centrifuge to 4°C

    Prepare a rack with 50 microtubes at -80°C

    • Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured

    • Check the OD until it reached 0,5

    • Put 500mL cultures in 10 50mL falcon tubes in ice

    • Wait for 20 minutes for the culture to cool down

    • Centrifuge at 3400 rpm 4°C for 10 minutes

    • Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube)

    • Centrifuge 10 minutes, 4°C , 3400 rpm

    • Take out liquid and resuspend in 25 mL ice cold water

    • Centrifuge 10 minutes, 4°C, 3400 rpm

    • Resuspend all the content of the tubes in 20mL ice cold glycerol

    • Centrifuge 10 minutes, 4°C, 3400rpm

    • Resuspend in 5mL ice cold 10°C glycerol solution

    • Aliquot in 50 tubes (100uL per microtubes)

    • Store at -80°C

    Sabotage

    15th July


    Clovis and Anne

    Primer Design

    Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol

    Geneious files in the dropbox: LacZ primers, KanR primers

    Sabotage

    16th July


    Anne with Nico, Marguerite and Yonatan

    Transformation of pUC18 (NEB, NEB CC, BL21)

    1) Thaw competent cells on ice.

    2) Place 20 ul of cells in a pre-chilled Eppendorf tube.

    3) add o.5ul of plasmid to the cells

    4) Mix gently by flicking the tube.

    5) Chill on ice for 10 minutes.

    4) Heat shock at 42 °C for 30 seconds.

    5) Return to ice for 2 minutes.

    6) Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)

    7) Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)

    8. Incubate at 37 °C. Transformants should appear within 12 hrs.

    Result: Colonies (around 10)

    Vincent and Aude

    In silico cloning: sRNA gBlocks into pUC18 and litmus28-GFP

    Successful with both Gibson assembly and regular cloning.

    See file: “in silico cloning trojan horse.geneious”

    Vincent

    streaking Ortiz’s strain ELS-41 and ELS-13 containing Litmus28i_J23115-B0032-GFP and M13K07, respectively.

    Sabotage

    17th July


    Anne

    Redsign of Primers

    Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol

    Geneious files in the dropbox: LacZ primers, KanR primers

    Clovis and Anne

    Liquid Cultures (for Miniprep)

    7ml LB with proper antibiotics

    adding: 1) NEB with pUC18 (AmpR)

    2) sT002 : MG1655 pCOLADuet-1 (KanR)

    3) sT003 : MG1655 pACYCDuet-1 (ChlaR)

    Cultivate over night in the 37°C shaker

    Vincent

    Check: GFP expressed as expected in ELS-41

    Lauching O/N of ELS-41 and ELS-13 with Amp and Kan, respectively.

    Aude

    Lauching O/N of MGZ1 (Glycerol from lab upstairs) with Spec (500X)

    Sabotage

    18th July


    Vincent and Aude

    Glycerol stock of ELS-41 and ELS-13 and MGZ1 now renamed sT004, sT005, sT006 respectively:

    sT004: RP437, F+ Litmus28i_J23115-B0032-GFP AmpR

    sT005: XL1-Blue, M13K07 KanR

    Making electrocompetent cells from strain sT004, sT005 and MGZ1 => Bad old water => could not obtain competent cells.

    Conjugation :

    sT004: RP437, F+ Litmus28i_J23115-B0032-GFP + conjugate with MGZ1.

    F+ comes from XL1 Blue (Ortiz paper) => F+ is tetR

    Protocol :

    1. From O/N cultures Dilute both strains 1/100 , in LB

    2. Wait for OD to reach O,2

    3. Prepare 4 tubes (in BD tubes) :

    • Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control

    • Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control

    • Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004

    1. Incubate 2 hours at 37°C

    2. Plate 100ul for controls, 100uL, 50ul, 20ul for mixed tubes on LB antiobiotics (here tet and spec)

    3. Incubate overnight at 37°C

    Aude

    Miniprep pT005 (Litmus28i_J23115-B0032-GFP) pT006 (M13K07) (Thermo Scientific Miniprep Kit)

    pT005 : 280 ng /uL

    pT006 : 61 ng/ul

    Aude Vincent Sebastian and Yonatan

    Work on the model

    Define the players, the processes in place (more in Modeling file)

    A description...

    Anne and Clovis

    Miniprep (sT002, sT003, NEB+pUC18) using the Thermo Scientific Miniprep Kit

    1) Pellet 5ml of liquid culture (max speed, 1 min)

    2) Discard supernatant

    3) resuspend the cells in 250ul of resuspension olution

    4) add 250ul of lysis solution, mix by inverting 4-6 times

    5) add 350ul of neutralization solution

    4) centrifuge for 5 min

    5) transfer supernatant to spin column

    6) centrifuge for 1 min

    7) discard flow through

    8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)

    9) centrifuge for 1 min to remove left over liquid

    10) transfer the column on a 1.5ml tube

    11) add 50ul of elution buffer and incubate for 2 min

    12) centrifuge for 2 min

    13) Nanodrop the concentration and freeze at -20°

    pT.002: 53.9ng/ul -> redo with more liquid culture, it is only a low copy plasmid

    pT.003: 53.8ng/ul -> redo with more liquid culture, it is only a low copy plasmid

    pT.007: 214ng/ul

    Sabotage

    19th July


    Conjugation results :
    Controls => no colonies
    Mix = tapis
    Ie worked really well.
    To be sure to start only with one clone => restreak some colonies on tet/spec plates

    Transformation by electroporation : goal = get a phage factory.
    We do it three different ways in order to see which one works (best).
    Transform strain containing helper plasmid with phagemid
    Transform strain containing helper plasmid with phagemid
    Co Transform strain with both plasmids at the same time

    From strain sT004, sT005, sT006
    Transform sT004 with pT006
    Transform sT005 with pT005
    Co Transform sT006 with pT005 and pT006

    Tubes :
    1. sM13KO7 (control) : 5,60
    2. sM13KO7 + pLitmus : 5,70
    3. sM13KO7 + pLitmus : 5,70
    4. sLITMUS (control) : 5,60
    5. sLITMUS + pM13K07 : 5,60
    6. sLITMUS + pM13K07 : 5,60
    7. MG16165 : control = 5.70
    8. MG16165 + p (M13K07) and p(LITMUS) = 5.60
    9. MG16165 + p (M13K07) and p(LITMUS)= 5.60

    Recovery 2h

    Plate everything on Kan/ Amp

    Sabotage

    20th July


    Results of transformation
    • Controls : no colonies
    • Colonies on plates : every transformation worked

    Put plates of conjugation and transformation in the fridge.

    Sabotage

    22th July

    Place your twit here


    Check Colonies of transformation under iLumina tools: colonies are fluorescent.

    Launch culture.

    Sabotage

    23th July



    Infectiveness characterization experiments
    • The night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
    • Centrifugate phagemid producing cells
    • Filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
    • Dilute 200x MGZ1, F+ from O/N
    • Wait until OD600 = 0.7
    • Immediately mix MGZ1 and the supernatant in different proportions

    Here we tried 1/1 (vol supernatant/vol cells), 1/10 and 1/100
      Immediately dilute each of them to 10-3, 10-4, 10-5, 10-6
    • Plate 100uL of those dilutions on LB-agar, AMP, KAN, AMP+KAN
    • Incubate O/N
    • Count colonies
    • Interpretation: Colonies on AMP: infected by litmus28i
      Colonies on KAN: infected by M13K07
      Colonies on AMP+KAN: coinfected by litmus28i and M13K07 phagemid producing cells

    Results


    Conclusions:
    • Cells that were mixed with 1/1 supernatant didn't survive the excess of antibiotics that were present in the supernatant.
    • Even at low ratio like 1/100 the infection rate of litmus28i-GFP is about 100%. GFP detection confirmed this result: almost 100% of cells were fluorescent.
    • Co-infection did occur. It would be interesting to test if those colonies are indeed producing phages.


    Start O/N culture of M13K07 Start O/N culture of MGZ1,F+

    Sabotage

    24th July



    Glycerol stock:
    • sT008: MGZ1, F+
    • sT009: XL1-Blue Litmus28i

    Infectiveness characterization experiments
    • Dilute 1/100 MGZ1, F+ O/N culture in 5mL LB => wait OD(600) = 0.7
    • Centrifuge M13K07 4000rpm, 10 minutes
    • Retrieve surnageant and filter it with 0.2 filter
    • Once OD 0.7 is reached, make 4 tubes
      1. 1mL MGZ1,F+ + 100ul LB (not done, not enough cells left ofter OD test)
      2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
      3. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
      4. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
    • Incube 37°C for 45 minutes
    • Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
      • 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
    • Plate on LB (10^-6), Kan(10^-2 and 10^-3), Amp(10^-6), Kan and Amp(10^-2 and 10^-3)

    Experiment fail due to manipulation error (wrong dilution of the supernageant and plating of wrong dilutions)

    Start O/N culture of MGZ1,F+ (T008) + Tet 1/500
    Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000

    Sabotage

    25th July



    O/N culture of T007 didn't grow (100 ul instead of 10ul of antibiotics, Kan and Amp)
    Start O/N culture of MGZ1,F+ (T008) + Tet 1/500
    Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000

    Sabotage

    26th July



    Infectiveness characterization experiments
    • Dilute 1/100 MGZ1, F+ O/N culture in 10mL LB => wait OD(600) = 0.7
    • Centrifuge M13K07 4000rpm, 10 minutes
    • Retrieve surnageant and filter it with 0.2 filter
    • Once OD 0.7 is reached, make 4 tubes
      1. 1mL MGZ1,F+ + 100ul LB
      2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
      3. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
      4. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
    • Incube 37°C for 45 minutes
    • Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
      • 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
  • Plate on LB (10^-6), Kan(10^-2), Amp(10^-6), Kan and Amp(10^-3)
  • Sabotage

    Tuesday 30th July


    Transformed the bl21 (DE3) strain with the pET21b (plated the transformation culture on 2 amp plates).

    Sabotage

    31th July


    Vincent and Aude

    Conjugation MGZ1, F+ & MG1655:

    Protocol :

    1. From O/N cultures Dilute both strains 1/100 , in LB

    2. Wait for OD to reach O,2

    3. Prepare 4 tubes (in BD tubes) :

    • Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control

    • Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control

    • Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004

    1. Incubate 2 hours at 37°C

    2. Plate 50ul for controls, 50uL, 20ul, 10ul for mixed tubes on LB antiobiotics (here tet and spec)

    3. Incubate overnight at 37°C

    Vincent

    Infectiveness characterization experiments

    -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

    -centrifugate phagemid producing cells

    -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

    -dilute 200x MGZ1, F+ from O/N

    -wait until OD600 = 0.7

    -immediately mix MGZ1 and the supernatant in different proportions

    here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

    Unfortunately the supernatant was dropped on the bench.

    Sabotage

    1st August


    Aude & Vincent

    Cloning Kanamycin resistance gene into pACYCDuet-1:

    -PCR of Kanamycin resistance gene from pCOLADuet-1 with primer iT.0003 and iT.0004

    -electrophoresis of PCR product: 1 band between 900 and 1000bp: coherent with KanR length

    -cutting KanR bands:

    -digestion with ECOR1 and Xho1:

    PCR product digest for cloning

    Reagent

    Volume

    Purified PCR Product

    16 ul

    H2O

    0 ul

    10x FastDigest Buffer

    2 ul

    FastDigest Enzyme 1

    1 ul

    FastDigest Enzyme 2

    1 ul

    Total Volume

    20.0 ul

    Digest for 0.5 - 1 hours at 37 °C with shaking.

    -digestion of pACYCDuet-1 with ECOR1 and Xho1:

    Vector backbone digest for cloning

    Reagent

    Volume

    Purified Plasmid

    20 ul

    H2O

    65 ul

    10x FastDigest Buffer

    10 ul

    FastDigest Enzyme 1

    2.5 ul

    FastDigest Enzyme 2

    2.5 ul

    FastAP Phosphatase

    0 ul

    Total Volume

    100.0 ul

    Digest for 2 - 4 hours at 37 °C with shaking.

    -electrophoresis of pACYCDuet-1 digestion products:

    column 1: 1kb plus marker

    column 2 & 3: digestion product

    column 4: undigested pACYCDuet-1

    nothing appear on gel after digestion, therefore we will miniprep pACYCDuet-1 and try again to digest it.

    Sabotage

    12th August


    Clovis

    Start 2 cultures of MG1655 pACYCDuet-1 strain (ST003), 5mL each for further miniprep

    Phusion PCR of lacZalpha out of pUC18 (pT007)

    with primers :

    iT.0001 (Fw, added NcoI cut site) CCATGGCTGGCTTAACTATGCGG

    iT.0002 (Rv, added BglII cutsite) AGATCTGTGAGTTAGCTCACTCATTAGG

    Column 1; 100kb plus ladder

    Column 2,3,4,5,6; PCR product

    Gel purification of column 5 and 6 → 19,2 ng/ul

    Sabotage

    13th August


    Clovis

    Digestion of the PCR product (LacZalpha) with NcoI and BglII

    PCR purification using Thermo Scintific Kit of the digestion → 6,2 ng/ul

    Miniprep of pACYADuet-1 (pT002) using Thermo Scientific Kit → 132,7 ng/ul

    Start O/N sT005 and sT010

    Vincent

    PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006

    PCR Gradient of 8 tubes +-5°C around 54°C for both PCRs (pUC18 and Litmus18i-GFP)

    Failure, no bands appear on the gel.

    Infectiveness characterization experiments

    -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

    -centrifugate phagemid producing cells

    -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

    -dilute 200x MGZ1, F+ from O/N

    -wait until OD600 = 0.7

    -immediately mix MGZ1 and the supernatant in different proportions

    here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

    1. 1mL MGZ1,F+ + 100ul LB

    2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100

    3. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000

    4. 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000

    -incubate 45 minutes at 37°C for the protein to be expressed.

    • Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6

      1. 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

    • Plate on LB (10^-6), Kan( 10^-3), Amp(10^-5 - 10^-6), Kan and Amp(10^-2 - 10^-3)

    Sabotage

    14th August


    PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006 (Aude):

    Gel Purif (Aude)

    Using QiaGen Kit

    3 tubes (combined the band)

    1 : 13,2 ng/uL

    2 : 14 ng/uL

    3 : 2O ng/uL

    Digestions ( Aude )

    Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)

    Reagent

    Volume

    Purified Plasmid

    10 ul

    H2O

    75 ul

    10x FastDigest Green Buffer

    10 ul

    EcoRI

    2.5 ul

    XhoI

    2.5 ul

    FastAP Phosphatase

    0 ul

    Total Volume

    100.0 ul

    Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)

    Reagent

    Volume

    Purified Plasmid

    15 ul

    H2O

    75 ul

    10x FastDigest Green Buffer

    10 ul

    EcoRI

    2.5 ul

    XhoI

    2.5 ul

    FastAP Phosphatase

    0 ul

    Total Volume

    100.0 ul

    => 2h30 à 37°C

    • Run on a a gel.

    • only see a smear, Everything was digested ,

    • redigest but just 25 minutes as said on the thermoscientific protoc.

    Digestions ( CLovis )

    • Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)

    Reagent

    Volume

    Purified Plasmid

    10 ul

    H2O

    75 ul

    10x FastDigest Green Buffer

    10 ul

    EcoRI

    2.5 ul

    XhoI

    2.5 ul

    FastAP Phosphatase

    0 ul

    Total Volume

    100.0 ul

    • Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)

    Reagent

    Volume

    Purified Plasmid

    15 ul

    H2O

    75 ul

    10x FastDigest Green Buffer

    10 ul

    EcoRI

    2.5 ul

    XhoI

    2.5 ul

    FastAP Phosphatase

    0 ul

    Total Volume

    100.0 ul

    25 minutes at 37°C

    It worked!

    Gel purification (Clovis)

    ACY Nco Dig : 6,3 ng/ul

    ACY Xho Dig : 7,8 ng/uL

    PCR Gradient of 8 tubes +10°C around 54°C for both PCRs (Litmus18i-GFP) but start not from the miniprep ut from a fresh culture of litmus GFp

    Only see the primer => try again with new miniprep

    Sabotage

    15th August


    Miniprep (Clovis)

    pACY (pT002) : 109ng/uL

    litmus (pT005) : 610 ng/Ul

    Ligation (Aude, Clovis ,Vincent)

    masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)

    CHosen Vector mass = 50 ng

    lacZ :

    Digestion vector : 6,3 ng/ul

    Digestion insert : 6,2

    masse insert = 10*449/3770*50 = 59 ng

    Protocol

    Vector : 8 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Let incubate at 22°C for 30 min

    Kan :

    Digestion vector : 7,8 ng/ul

    Digestion insert : 12ng/ul

    Insert mass = 10*1052/3770*50 = 140 ng

    Protocole Ligation

    Vector : 7 uL

    Insert : 11 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Transformation : (in chemical competent NEB turbo (made on the …) Aude Clovis

    1) Thaw competent cells on ice.

    These can be prepared using the CaCl2 protocol.

    2) Add 5 ul of ligation product

    4) Mix gently by flicking the tube.

    5) Chill on ice for 30 minutes.

    4) Heat shock at 42 °C for 30 seconds.

    5) Return to ice for 2 minutes.

    6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

    7) Plate on selective media

    Plate on :

    Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

    Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm

    Tube 3 : ligation Kan-pACY (5uL) Kan Cm

    Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

    PCR (litmus = Backbone) Vincent

    8 tubes, gradient 10°C around 64°C , started from a new miniprep

    We see the plasmid => too concentrated

    PCR (litmus pour la gibbson) Clovis

    sTOO5 primer 005 006 protocol phusion (gradient around 64 + or – 5 °C)

    Elongaiton time 2min10. Started with the new miniprep diluted.

    Infectiveness characterization experiments (Vincent)

    -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

    After checking GFP fluorescence of sT007 and its negative result, we decided to make a new sT007 glycerol stock. We used a colony from the first successful Infectiveness characterization experiments that was both AMP+KAN resistant and expressed GFP.

    The following experiment was conducted with this new sT007 (strain MGZ1).

    -centrifugate phagemid producing cells

    -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

    -This experiment was conducted both on MGZ1(F+) and MG1655(F+)

    -dilute 200x MGZ1 and MG1655 from O/N

    -wait until OD600 = 0.7

    -immediately mix MGZ1 and the supernatant in different proportions

    here we planned to try 1/10 (vol supernatant/vol cells)

    1. 1mL MGZ1,F+ + 100ul LB

    2. 1mL MGZ1,F+ + 100ul surnageant diluted 1/100

    -incubate 45 minutes at 37°C for the protein to be expressed.

    • Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6

      1. 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

    Plate on LB (10^-4 10^-5 10^-6), Kan(10^-1 10^-2 10^-3), Amp(10^-4 10^-5 - 10^-6), Kan and Amp(10^-1 10^-2 - 10^-3)


    Sabotage

    16th August


    Results from Infectiveness characterization experiments (Vincent)

     See file “phage infectivness 15_08.xlsx”

    Results

    Transformations : (Aude)

    Lac : “tapis” on all the plates even the negative control => plates were not done correctly, antibio added to early => do another transformation

    Kan : Some colonies on the plates , but also colonies on the negative control => launch few colonies on liquid media (with Kan, Cm)

    Phage infectiveness : (Vincent)

    Run PCR (Litmus-Gibbson) (Aude)

    Small point around 3000-3500bp

    Run another gel with large holes to check if it is correct and purify => Not correct, nothing on the new gel

    Transformation : (in chemical competent NEB turbo ) Aude Clovis

    Rest of ligation product

    1) Thaw competent cells on ice.

    These can be prepared using the CaCl2 protocol.

    2) Add 5 ul of ligation product

    4) Mix gently by flicking the tube.

    5) Chill on ice for 30 minutes.

    4) Heat shock at 42 °C for 30 seconds.

    5) Return to ice for 2 minutes.

    6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

    7) Plate on selective media

    Plate on :

    Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

    Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm

    Tube 3 : ligation Kan-pACY (5uL) Kan Cm

    Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

    Gel from PCR litmus (Clovis)

    1kB ladder / triple puit (3*50uL) from column 2,3,4 of PCR

    50V

    Infectiveness characterization experiments (Aude)

    -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )

    -centrifugate phagemid producing cells

    -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)

    -dilute 200x MG, F+ from O/N

    -wait until OD600 = 0.7

    -immediately mix MG and the supernatant in different proportions

    here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000

    1. 1mL MG,F+ + 100ul LB

    2. 1mL MG,F+ + 100ul surnageant diluted 1/10

    3. 1mL MG,F+ + 100ul surnageant diluted 1/100

    4. 1mL MG,F+ + 100ul surnageant diluted 1/1000

    5. 1mL MG,F+ + 100ul surnageant diluted 1/10000

    -incubate 45 minutes at 37°C for the protein to be expressed.

    • Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5

      1. 4 times 5 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.

    Plate on LB (10^-5), Kan( 10^-2), Amp(10^-5), Kan and Amp(10^-2)


    Ligation (Vincent)

    masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)

    CHosen Vector mass = 50 ng

    lacZ :

    Digestion vector : 6,3 ng/ul

    Digestion insert : 6,2

    masse insert = 10*449/3770*50 = 59 ng

    Protocol

    Vector : 8 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Let incubate at 22°C for 30 min

    Kan :

    Digestion vector : 7,8 ng/ul

    Digestion insert : 12ng/ul

    Insert mass = 10*1052/3770*50 = 140 ng

    Protocole Ligation

    Vector : 7 uL

    Insert : 11 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Transformation : (in chemical competent NEB turbo (made on the …) vincent

    1) Thaw competent cells on ice.

    These can be prepared using the CaCl2 protocol.

    2) Add 5 ul of ligation product

    4) Mix gently by flicking the tube.

    5) Chill on ice for 30 minutes.

    4) Heat shock at 42 °C for 30 seconds.

    5) Return to ice for 2 minutes.

    6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour

    7) Plate on selective media

    Plate on :

    Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm

    Tube 2 : ligation lacZ-pacy (10uL) Xgal /IPTG /Cm

    Tube 3 : ligation Kan-pACY (10uL) Kan Cm

    Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm

    PCR pUC18 (pT007)

    5*50uL

    34 H2O

    10 Buffer 5x

    1 dNTP

    2.5 FW iT007

    2.5 RV iT008

    0.2 pUC18

    0.5 phusion

    50uL Tot

    Tm = 55°C

    te = 2min10

    no bands

    PCR Litmus (Clovis):

    Trouble shooting : since the temperature does not help, that it was not the mini prer = but that we see homodimere between the primers => try with less primers

    PCR litmus (pT005)

    5*50ul

    40 H2O

    10 Buffer 5x

    1 dNTP

    0.5 FW iT005

    0.5 RV iT006

    0.2 litmus

    0.5 phusion

    50ul Tot

    Tm = 64°C

    te = 2min10

    Sabotage

    17th August


    Results

    • Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.

    • Phage infectiveness : Experiment worked => results here

    Repcr inserts / redigest vector

    PCR KanR out of pCOLA (pT003)

    5*50ul

    34 H2O

    10 Buffer 5x

    1 dNTP

    2.5 FW iT003

    2.5 RV iT004

    0.2 pCOLA

    0.5 phusion

    50ul Tot

    Tm = 54°C

    te = 45sec

    PCR LacZ out of pUC18 (pT007)

    5*50ul

    34 H2O

    10 Buffer 5x

    1 dNTP

    2.5 FW iT001

    2.5 RV iT002

    0.2 pUC18

    0.5 phusion

    50ul Tot

    Tm = 54°C

    te = 45sec

    Gel of PCR Kan and LacZ

    5 puits LacZ / 100bP+ / 5 puits Kan

    Preparaiton of the vectors to clone the sRNA

    PCR litmus (pT005)

    5*50ul

    40 H2O

    10 Buffer 5x

    1 dNTP

    0.5 FW iT003

    0.5 RV iT004

    0.2 pCOLA (pT007)

    0.5 phusion

    50ul Tot

    Tm = 64°C

    te = 2min10

    Results

    • Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.

    • Phage infectiveness : Experiment worked => results here

    Repcr inserts / redigest vector

    PCR KanR out of pCOLA (pT003)

    5*50ul

    34 H2O

    10 Buffer 5x

    1 dNTP

    2.5 FW iT003

    2.5 RV iT004

    0.2 pCOLA

    0.5 phusion

    50ul Tot

    Tm = 54°C

    te = 45sec

    PCR LacZ out of pUC18 (pT007)

    5*50ul

    34 H2O

    10 Buffer 5x

    1 dNTP

    2.5 FW iT001

    2.5 RV iT002

    0.2 pUC18

    0.5 phusion

    50ul Tot

    Tm = 54°C

    te = 45sec

    Gel of PCR Kan and LacZ

    5 puits LacZ / 100bP+ / 5 puits Kan

    -->img 622<--

    Preparaiton of the vectors to clone the sRNA

    PCR litmus (pT005)

    5*50ul

    40 H2O

    10 Buffer 5x

    1 dNTP

    0.5 FW iT003

    0.5 RV iT004

    0.2 pCOLA (pT007)

    0.5 phusion

    50ul Tot

    Tm = 64°C

    te = 2min10


    Sabotage

    19th August


    CLONING the target Plasmids (Kan and lacZ)

    Gel purification of LacZ using Thermo Scientific Kit

    lacZ : 83 ng/ul

    Gel purification of Kan using Thermo Scientific Kit

    Kan : 80ng/ul

    Digestion of pACYC (pT002) with EcoRI and XhoI

    10 H2O

    2 Buffer

    4 pACYC

    2 EcoRI

    2 XhoI

    20uL Tot

    37°C

    20min

    Digestion of pACYC (pT002) with BglII and NcoI

    10 H2O

    2 Buffer

    4 pACYC

    2 BglII

    2 NcoI

    20uL Tot

    37°C

    20min

    Digestion of Kan insert with EcorI and XhoI

    10 H2O

    15 Kan insert

    3 Buffer

    1 EcoRI

    1 XhoI

    30uL Tot

    37°C

    20min

    Digestion of LacZ insert with BglII and NcoI

    10 H2O

    15 LacZ insert

    3 Buffer

    1 BglII

    1 NcoI

    30uL Tot

    37°C

    20min

    Gel of digestions

    100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI

    Colum purification of Kan insert digestions using Thermo Scientific Kit

    Column purification of LacZ insert digestions using Thermo Scientific Kit

    Colum purification of pACYC digestions using Thermo Scientific Kit

    Heat inactivation of Kan digestion

    65°C

    20min

    Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)

    Digestion vector : 6.8 ng/ul

    Digestion insert : 14

    masse insert = 10*1052/3770*50 = 140 ng

    Vector : 7.35 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Let incubate at 22°C for 30 min

    Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)

    Digestion vector : 6.8 ng/ul

    Digestion insert : 40/2 = 20

    masse insert = 10*1052/3770*50 = 140 ng

    Vector : 7.35 uL

    Insert : 7 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    H2O : 4 uL

    Let incubate at 22°C for 30 min

    Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)

    Digestion vector : 10? ng/ul

    Digestion insert : 33

    masse insert = 10*449/3770*50 = 59 ng

    Vector : 5 uL

    Insert : 1.8 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    H2O : 11 uL

    Let incubate at 22°C for 30 min

    Chemical transformation in NEB turbo

    Reference protocol

    Recovery 1 hour.

    Plate on

    Tube 1 = negative control

    Tube 2 : Kan (purif) Kan / Cm

    Tube 3 : Kan (heat inactivated) Kan/ Cm

    Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal

    Cloning the Weapon (ie sRNA into Litmus and pUC 18)

    Gel of litmus PCR

    Gel purification of litmus PCR using Thermo Scientific Kit

    PCR from mini Gene sRNA anti Kan

    35 H2O

    10 Buffer 5x

    1 dNTP

    2 FW iT009

    2 RV iT0010

    0.2 minigene-plasmid amp from IDT

    0.5 phusion

    PCR Phusion Gradient around 53 °C

    Time : 30 secondes

    Gibson Assembly

    Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL

    Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop = 26,7)

    Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene (nanodrop = 26,7)

    Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.

    Regular cloning using biobricks

    Digestion

    Insert sRNA cut by XbaI & PstI

    Vector Litmus cut by PstI & SpeI

    Insert sRNA cut by EcoRI & SpeI

    Vector Litmus cut by EcoRI & SpeI

    Digestion of Vectors

    10 H2O

    2 Buffer

    4 Vector

    2 Enz 1

    2 Enz 2

    20uL Tot

    37°C

    20min

    Digestion of Inserts

    10 H2O

    15 insert

    3 Buffer

    1 Enz 1

    1 Enz 2

    30uL Tot

    37°C

    20min

    Heat inactivation before ligation

    80°C for 20 minutes

    Ligation

    pUC= 40ng in 20 uL => 3ng/ul

    litmus 340ng =>17ng /ul

    insert 420 ng => 14 ng / uL

    Litmus :

    7uL vector

    8 ul insert

    2 uL Buffer

    O,2 uLT4 DNA ligase

    3ul Water

    Vtot = 20 uL

    pUC

    20 uL vector

    9 uL insert

    4 uL Buffer

    0,4 T4 DNA

    7 uL water

    Vtot = 40uL

    Chemical transformation in NEB turbo

    Tube 1 : negative control

    Tube 2 lig litmus

    Tube 3 lig pUC

    • plate everything on amp

    Sabotage

    20th August


    CLONING the target Plasmids (Kan and lacZ)

    Gel purification of LacZ using Thermo Scientific Kit

    lacZ : 83 ng/ul

    Gel purification of Kan using Thermo Scientific Kit

    Kan : 80ng/ul

    Digestion of pACYC (pT002) with EcoRI and XhoI

    10 H2O

    2 Buffer

    4 pACYC

    2 EcoRI

    2 XhoI

    20uL Tot

    37°C

    20min

    Digestion of pACYC (pT002) with BglII and NcoI

    10 H2O

    2 Buffer

    4 pACYC

    2 BglII

    2 NcoI

    20uL Tot

    37°C

    20min

    Digestion of Kan insert with EcorI and XhoI

    10 H2O

    15 Kan insert

    3 Buffer

    1 EcoRI

    1 XhoI

    30uL Tot

    37°C

    20min

    Digestion of LacZ insert with BglII and NcoI

    10 H2O

    15 LacZ insert

    3 Buffer

    1 BglII

    1 NcoI

    30uL Tot

    37°C

    20min

    Gel of digestions

    100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI

    Colum purification of Kan insert digestions using Thermo Scientific Kit

    Column purification of LacZ insert digestions using Thermo Scientific Kit

    Colum purification of pACYC digestions using Thermo Scientific Kit

    Heat inactivation of Kan digestion

    65°C

    20min

    Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)

    Digestion vector : 6.8 ng/ul

    Digestion insert : 14

    masse insert = 10*1052/3770*50 = 140 ng

    Vector : 7.35 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    Let incubate at 22°C for 30 min

    Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)

    Digestion vector : 6.8 ng/ul

    Digestion insert : 40/2 = 20

    masse insert = 10*1052/3770*50 = 140 ng

    Vector : 7.35 uL

    Insert : 7 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    H2O : 4 uL

    Let incubate at 22°C for 30 min

    Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)

    Digestion vector : 10? ng/ul

    Digestion insert : 33

    masse insert = 10*449/3770*50 = 59 ng

    Vector : 5 uL

    Insert : 1.8 uL

    Buffer : 2 uL

    T4 DNA ligase : 0,2 uL

    H2O : 11 uL

    Let incubate at 22°C for 30 min

    Chemical transformation in NEB turbo

    Reference protocol

    Recovery 1 hour.

    Plate on

    Tube 1 = negative control

    Tube 2 : Kan (purif) Kan / Cm

    Tube 3 : Kan (heat inactivated) Kan/ Cm

    Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal

    Cloning the Weapon (ie sRNA into Litmus and pUC 18)

    Gel of litmus PCR

    Gel purification of litmus PCR using Thermo Scientific Kit

    PCR from mini Gene sRNA anti Kan

    35 H2O

    10 Buffer 5x

    1 dNTP

    2 FW iT009

    2 RV iT0010

    0.2 minigene-plasmid amp from IDT

    0.5 phusion

    PCR Phusion Gradient around 53 °C

    Time : 30 secondes

    Gibson Assembly

    Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL

    Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop = 26,7)

    Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene (nanodrop = 26,7)

    Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.

    Regular cloning using biobricks

    Digestion

    Insert sRNA cut by XbaI & PstI

    Vector Litmus cut by PstI & SpeI

    Insert sRNA cut by EcoRI & SpeI

    Vector Litmus cut by EcoRI & SpeI

    Digestion of Vectors

    10 H2O

    2 Buffer

    4 Vector

    2 Enz 1

    2 Enz 2

    20uL Tot

    37°C

    20min

    Digestion of Inserts

    10 H2O

    15 insert

    3 Buffer

    1 Enz 1

    1 Enz 2

    30uL Tot

    37°C

    20min

    Heat inactivation before ligation

    80°C for 20 minutes

    Ligation

    pUC= 40ng in 20 uL => 3ng/ul

    litmus 340ng =>17ng /ul

    insert 420 ng => 14 ng / uL

    Litmus :

    7uL vector

    8 ul insert

    2 uL Buffer

    O,2 uLT4 DNA ligase

    3ul Water

    Vtot = 20 uL

    pUC

    20 uL vector

    9 uL insert

    4 uL Buffer

    0,4 T4 DNA

    7 uL water

    Vtot = 40uL

    Chemical transformation in NEB turbo

    Tube 1 : negative control

    Tube 2 lig litmus

    Tube 3 lig pUC

    • plate everything on amp

    Sabotage

    21st August

    Place your twit here

    Results of assemblies (Colonies on the transformation plates):

    sRNA –Kan into Litmus by Gibson: Success

    sRNA – Kan into Litmus by biobrick assembly: Success

    sRNA – Kan into pUC18 by Gibson: Failure

    sRNA – Kan into pUC18 by biobrick assembly: Success

    Colony PCR to check if sRNA-KAN is in our Litmus phagemid: positive band between 400 and 500: (expected length 419bp)

    Check the design of primers to clone out Kan => problem => redesign them

    Design of the primers to sequence all the cloning

    Launch 3 colonies of each successful cloning

    Glycerol and mini prep of all the launched colonies / need 3 before we have

    Construction of target strain

    Electroporation of pCOLA in MGZ1 F+

    Construction of weapon strains

    Electroporation of litmus-GFP-sRNA in XL1 Blue-M13KO7-Helper

    Electroporation of Litmus-GFP-sRNA and M13K07 in MGZ1 F+

    Chemical transformation of minigene+vector-sRNA anti Kan in NEB turbo

    Sabotage

    22nd August


    Results :

    All the transformation worked

    Launch cultures (to do experiment)

    • mGZ1 F+ -Cola

    • MGZ1 F+ litmus + Helper

    Launch overnigh culture to do glycerols.

    exploring the parameters in play in the phage infectiveness of our new phagemid construct

    -diluting 100x O/N of MGZ1, F+

    -mix with 1/10 vol of supernatant containing phagemids with the cells with the following combination of parameters:

    OD600 : 0.3 0.6 0.9

    Plate at different time (min) after first contact with the supernatant: 2, 30, 60

    Silencing experiments

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan

    - At OD 0,7 : 4 tubes : Ctrl, P1, P2 ,P3. Put 1 mL of cells in each tube. Centrifuge. Take out supernatant, resuspend in 1mL of LB. Add in tubes respectively : nothing, 100uL phages of Miniprep 1, Miniprep 2, miniprep 3.

    - Incubate 45 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 dilutions on Kan and LB and 100 ul of 10-2 and 10-3 dilution on Kan.

    Sabotage

    23th August


    Results: failure: as much GFP+ colonies growing on Kan than on LB

    PCR from mini Gene sRNA anti Cm

    35 H2O

    10 Buffer 5x

    1 dNTP

    2 FW iT009

    2 RV iT0010

    0.2 minigene-plasmid amp from IDT

    0.5 phusion

    PCR Phusion Gradient around 53 °C

    Time : 30 secondes

    Sabotage

    26th August


    Digestion of litmus miniprep (C=280ng/uL)with PstI and SpeI

    13 H2O

    3 litmus miniprep

    2 Buffer

    1 PstI

    1 SpeI

    20uL Tot

    37°C

    20min

    Digestion of sRNA_Cm insert (C=31ng/uL) with XbaI and PstI

    10 H2O

    15 sRNA_Cm insert

    3 Buffer

    1 XbaI

    1 PstI

    30uL Tot

    37°C

    20min

    PCR purification of litmus digestion using Thermo Scientific Kit

    PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit

    Ligation sRNA_Cm insert purif + litmus

    Digestion vector : 13,3 ng/ul

    Digestion insert : 10

    masse insert = 10*376/3626*50 = 52 ng

    Vector : 3.8 uL

    Insert : 5.2 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 8 uL

    Let incubate at 22°C for 30 min

    Ligation control litmus

    Vector : 3.8 uL

    Insert : 0 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 13,2 uL

    Let incubate at 22°C for 30 min

    Digestion of pUC18 PCR (C=13ng/uL) with EcorI and SpeI

    10 H2O

    15 pUC18 PCR

    3 Buffer

    1 EcorI

    1 SpeI

    30uL Tot

    37°C

    20min

    Digestion of sRNA_Cm insert (C=31ng/uL) with SpeI and EcorI

    10 H2O

    15 sRNA_Cm insert

    3 Buffer

    1 EcorI

    1 SpeI

    30uL Tot

    37°C

    20min

    PCR purification of pUC18 digestion using Thermo Scientific Kit

    PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit

    Ligation sRNA_Cm insert purif + pUC18

    Digestion vector : 4,3 ng/ul

    Digestion insert : 9,4

    masse insert = 10*362/2175*50 = 83 ng

    Vector : 11,6 uL

    Insert : 8,8 uL

    Buffer : 3 uL

    T4 DNA ligase : 1,5 uL

    H2O : 7,1 uL

    Let incubate at 22°C for 30 min

    Ligation control pUC18

    Vector : 11,6 uL

    Insert : 0 uL

    Buffer : 3 uL

    T4 DNA ligase : 1,5 uL

    H2O : 15,9 uL

    Let incubate at 22°C for 30 min

    Chemical transformation in NEB-Turbo only (control -)

    Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + litmus

    Chemical transformation in NEB-Turbo of ligation control litmus

    Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + pUC18

    Chemical transformation in NEB-Turbo of ligation control pUC18

    Chemical transformation in NEB-Turbo of litmus (control +)

    Plate all 5 on Amp

    PCR from mini Gene sRNA anti LacZ

    35 H2O

    10 Buffer 5x

    1 dNTP

    2 FW iT009

    2 RV iT0010

    0.2 minigene-plasmid amp from IDT

    0.5 phusion

    PCR Phusion Gradient around 53 °C

    Time : 30 secondes

    Sabotage

    27th August

    Place your twit here

    Building anti LacZ weapons:

    Gibson assembly of litmus (sT005) and sRNA_LacZ

    Digestion vector : 56 ng/ul

    Digestion insert : 9,6

    masse insert = 5*376/3626*50 = 26 ng

    Vector : 1 uL

    Insert : 3 uL

    Master Mix : 5 uL

    H2O : 1

    Heat shock following Gibson assembly kit protocole.

    Biobrick assembly of sRNA_LacZ in litmus-GFP and pUC18

    Using digested vectors (litmus-GFP and pUC18) from 26/08

    Digestion of sRNA_LacZ insert (C=48ng/uL) with XbaI and PstI

    10 H2O

    15 sRNA_LacZ insert

    3 Buffer

    1 PstI

    1 XbaI

    30uL Tot

    37°C

    20min

    Digestion of sRNA_LacZ insert (C=45ng/uL) with SpeI and EcorI

    10 H2O

    15 sRNA_LacZ insert

    3 Buffer

    1 EcorI

    1 SpeI

    30uL Tot

    37°C

    20min

    Purification on column

    ligation:

    Ligation sRNA_LacZ insert purif + pUC18

    Digestion vector : 4,3 ng/ul

    Digestion insert : 18

    masse insert = 10*362/2175*50 = 83 ng

    Vector : 11,6 uL

    Insert : 4,6 uL

    Buffer : 3 uL

    T4 DNA ligase : 1,5 uL

    H2O : 11 uL

    Let incubate at 22°C for 30 min

    Ligation sRNA_LacZ insert purif + litmus

    Digestion vector : 13,3 ng/ul

    Digestion insert : 11,4

    masse insert = 10*376/3626*50 = 52 ng

    Vector : 3.8 uL

    Insert : 4,56 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 8,64 uL

    Let incubate at 22°C for 30 min

    Preparing experiments of LacZ silencing

    Plating MGZ1, F+ ; MG1655, F+ ; NEB Turbo on IPTG+Xgal

    Sabotage

    28th August


    as expected MGZ1 and MG1655 turn blue.

    Result from assemblies:

    Gibson sRNA LacZ in litmus-GFP: failure

    Biobrick assembly sRNA LacZ in Litmus-GFP : success

    Biobrick assembly sRNA LacZ in pUC18 : success

    Miniprep of Litmus-GFP-sRNACm ,Litmus-GFP-sRNALacZ, pUC18-sRNACm , pUC18-sRNALacZ

    Building phagemid weapon producing cells: Transformation of electrocompetent MGZ1, F+ with M13K07 + Litmus-GFP-sRNALacZ / Litmus-GFP-sRNACm

    Transforming:

    -1) negative control : 5,2

    -2) IDT plasmid with sRNALacZ ( should form white colonies of MGZ1 on Xgal+IPTG):5,1

    -3) Litmus-GFP-sRNALacZ1 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2

    -4) Litmus-GFP-sRNALacZ3 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2

    -5) Litmus-GFP-sRNACm1 (control XGal ) : 5,2

    -6) Litmus-GFP-sRNACm1 + M13K07: 5,2

    -7) Litmus-GFP-sRNACm2 + M13K07 : 5,2

    -8) Litmus-GFP-sRNACm3 + M13K07: 5,2

    -9) Litmus-GFP-sRNALacZ1 + M13K07 : 5,2

    -10) Litmus-GFP-sRNALacZ3 + M13K07: 5,2

    plate on AMP+IPTG+Xgal ( silencing of LacZ on MGZ1 strain) and KAN+AMP (phage factories cells)

    Sabotage

    29th August

    Place your twit here

    silencing of LacZ failed on MGZ1: the sequence of LacZ might have mutation compared to MG1655 for which the sRNA was designed or the test is not quantitative enough (one sRNA => several proteins). Try to find a way to get quantitative data about the silencing => Miller Assay

    Sabotage

    30th August

    Place your twit here

    attempt to silence LacZ on MG1655, F+ with litmusGFP-LacZ1 & litmusGFP-LacZ2

    XXXXX

    Silencing experiments (LacZ)

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan

    - At OD 0,7 : 5 tubes. Put 1 mL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2, litmusGFP-Cm1 & litmusGFP-Cm2

    litmusGFP-Cm1 & litmusGFP-Cm2 are used as negative control.

    - Incubate 45 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 and 10-3 dilutions on IPTG+Xgal and LB and 100uL on AMP+IPTG+Xgal and LB.

    Sabotage

    3rd September


    Silencing experiments (Cm)

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

    - At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2, litmusGFP-Cm1 & litmusGFP-Cm2

    litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.

    - Incubate 45 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

    LB

    Cm 25 ug/ul

    Cm 250ug/ul

    Cm 500 ug/ul

    non infected

    10^-4

    10^-4

    10^-4

    10^-4

    sRNA anti lacz

    10^-4

    10^-4

    10^-3

    10^-3

    sRNA Cm1

    10^-4

    10^-4

    10^-3

    10^-3

    sRNA Cm2

    10^-4

    10^-4

    10^-3

    10^-3

    sRNA Cm3

    10^-4

    10^-4

    10^-3

    10^-3

    sRNA Cm4

    10^-4

    10^-4

    10^-3

    10^-3

    Sabotage

    4th September


    Results of silencing experiments

    It works !

    Miller assay

    XXXXXX

    Redo the silencing experiment

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

    - At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 & litmusGFP-Cm2

    litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.

    - Incubate 45 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

    LB

    Cm 25 ug/ul

    Cm 125 ug/ul

    Cm 250ug/ul

    Cm 500 ug/ul

    non infected

    10^-4

    10^-4

    10^-4

    10^-4

    10^-4

    sRNA anti lacz

    10^-4

    10^-4

    10^-3

    10^-3

    10^-3

    sRNA Cm1

    10^-4

    10^-4

    10^-3

    10^-3

    10^-3

    sRNA Cm2

    10^-4

    10^-4

    10^-3

    10^-3

    10^-3

    sRNA Cm3

    10^-4

    10^-4

    10^-3

    10^-3

    10^-3

    sRNA Cm4

    10^-4

    10^-4

    10^-3

    10^-3

    10^-3

    Sabotage

    5th September


    Confirmation of silencing (CmR)

    Cloning biobricks : ie clone sRNAs (Cm, Kan, lacZ) in pB1C3

    Reagent

    Volume

    Purified PCR Product

    16 ul

    H2O

    0 ul

    10x FastDigest Buffer

    2 ul

    FastDigest Enzyme 1

    1 ul

    FastDigest Enzyme 2

    1 ul

    Total Volume

    20.0 ul

    Digest for 0.5 - 1 hours at 37 °C with shaking

    Ligation sRNA into biobrick vector

    masse insert = 10*419/2000*100 = 210 ng

    Vector : 5 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 2uL

    Let incubate at 22°C for 30 min

    Transformation in NEB turbo chemical competent . Plate on Cm

    Sabotage

    7th September

    Place your twit here

    07/09/13

    Results Transformation

    Colonies on the different paltes (no colonies on the negative controls)

    PCR Colonies

    Primer from Phage sensor team : XXXXX

    Gel :

    XXXXX

    Sabotage

    10th September

    Place your twit here

    Experiment Silencing Cm (try to reduce the noise, aka the variability)

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)

    - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 & litmusGFP-Cm2

    -3 replicates for each condition. Plate each Dilution 2 times to limit the variability

    Non infected cells (1,2,3)

    Cells infected with anti lacZ (1,2,3)

    Cells infected with anti CmA (1,2,3)

    Cells infected with antiCmB (1,2,3

    - Incubate 45 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

    LB

    Cm 25 ug/ul

    Cm 250ug/ul

    Cm 500 ug/ul

    non infected 1

    10^-5/4

    10^-5/4

    10^-5/4

    10^-5/4

    non infected 2

    10^-5/4

    10^-5/4

    10^-5/4

    10^-5/4

    non infected 3

    10^-5/4

    10^-5/4

    10^-5/4

    10^-5/4

    sRNA lacZ 1

    10^-4

    10^-4

    10^-4/2

    10^-2/1

    sRNA lacZ 2

    10^-4

    10^-4

    10^-4/2

    10^-2/1

    sRNA lacZ 3

    10^-4

    10^-4

    10^-4/2

    10^-2/1

    sRNA Cm A 1

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    sRNA Cm A 2

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    sRNA Cm A 3

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    sRNA Cm B 1

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    sRNA Cm B 2

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    sRNA Cm B 3

    10^-4/3

    10^-4/3

    10^-3

    10^-2/1

    Sabotage

    11th September


    Results experiment Silencing


    AT a concentration of 500mg/ul, we get 99,1% of killing (on 12 replicates) with a standard déviation of 1,19

    • When you try to understand why are the cells surviving, it is mainly due to the non silencing of the cells

    • This problem can be due to the necessity of the sRNA to match to the plasmid sequence perfectly (and therefore problemsof mutations, especially on phage).

    Sabotage

    14th September

    Place your twit here

    Cloning two sRNA on the same phagemid

    P009 (litmus Kan) + sRNA Cm :

    P027 (litmus Cm) + sRNA Kan :

    Inserts

    sRNA Cm : 35 ng/uL Final (16*35/20) = 28 ng/uL

    sRNA Kan : 16 ng/uL Final (16*16/20) = 12,8 ng/uL

    Reagent

    Volume

    Purified PCR Product

    16 ul

    H2O

    0 ul

    10x FastDigest Buffer

    2 ul

    XbaI

    1 ul

    Pst1

    1 ul

    Total Volume

    20.0 ul

    Vectors

    Litmus Kan : 350 ng /uL Final (3*350/20) = 52,5 75 ng/ul

    Litmus Cm : 750 ng /ul Final (2*750/20) = 75 ng/uL

    Reagent

    Volume

    Purified PCR Product

    3

    H2O

    13 ul

    10x FastDigest Buffer

    2 ul

    Pst1

    1 ul

    SpeI

    1 ul

    Total Volume

    20.0 ul

    Ligation sRNA into biobrick vector

    Litmus Kan + sRNA anti Cm

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 3 uL

    Insert : 4 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 10uL

    Litmus Cm + sRNA anti Kan

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 1,5 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 5,5uL

    Let incubate at 22°C for 30 min

    Launch cultures :

    Glycerol of the different biobricks : sT040 ; sT041 ; sT042 sT043 ; sT044 ; sT045 ; sT046 ; sT047 on Cm

    MG F+ + pCola sT027 on Kan :

    MGZ1, F+ Litmus-GFP-sRNA antiKan + M13KO7 Helper col : sT022 sT023 sT024 on Kan Amp

    Sabotage

    15th September


    Exp Silencing Kan

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)

    - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2

    -2 replicates for each condition. Plate each Dilution 2 times to limit the variability

    Non infected cells (1,2)

    Cells infected with anti lacZ (1,2)

    Cells infected with anti KanA (1,2)

    Cells infected with anti KanB (1,2,)

    - Incubate 70 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

    LB

    Kan 25 ug/ul

    Kan 250ug/ul

    Kan 500 ug/ul

    non infected 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-4/3

    non infected 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-4/3

    sRNA lacZ 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA lacZ 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan A 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan A 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan B 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan B 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    Miniprep biobricks

    Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2

    Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector

    Litmus Kan + sRNA anti Cm

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 3 uL

    Insert : 4 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 10uL

    Litmus Cm + sRNA anti Kan

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 1,5 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 5,5uL

    Let incubate at 22°C for 30 min

    Transformation in chemical competent 10G cells : plate on Amp;

    Sabotage

    18th September


    Exp Silencing Kan

    - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.

    -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)

    - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2

    -2 replicates for each condition. Plate each Dilution 2 times to limit the variability

    Non infected cells (1,2)

    Cells infected with anti lacZ (1,2)

    Cells infected with anti KanA (1,2)

    Cells infected with anti KanB (1,2,)

    - Incubate 70 minutes at 37°C

    - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table

    LB

    Kan 25 ug/ul

    Kan 250ug/ul

    Kan 500 ug/ul

    non infected 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-4/3

    non infected 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-4/3

    sRNA lacZ 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA lacZ 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan A 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan A 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan B 1

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    sRNA Kan B 2

    10^-5/4

    10^-4/3

    10^-4/3

    10^-3/2

    Miniprep biobricks

    Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2

    Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector

    Litmus Kan + sRNA anti Cm

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 3 uL

    Insert : 4 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 10uL

    Litmus Cm + sRNA anti Kan

    masse insert = 10*419/4000*100 = 110 ng

    Vector : 1,5 uL

    Insert : 10 uL

    Buffer : 2 uL

    T4 DNA ligase : 1 uL

    H2O : 5,5uL

    Let incubate at 22°C for 30 min

    Transformation in chemical competent 10G cells : plate on Amp;

    Sabotage

    20th September


    results from sequencing:

    Litmus-Anti LacZ: OK

    Litmus-Anti Kan: OK

    Litmus-Anti Cm: OK