Team:Heidelberg/Templates/DelH week11

From 2013.igem.org

Revision as of 13:06, 24 October 2013 by Anja R (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

08-07 - 14-07-13

Amplification of DelH F1b

PCR Conditions F1b.W11.A

Reagent	DelH F1b - from purified F1b 05-07 (genome amplified)	DelH F1b - from purified F1b 05-07 (genome amplified)
Template	1 µl of PCR 1b (19 ng/µl)	1 µl D. acidovorans
Primer fw 10 µM	1 µl DelH_EcoRI_fw	1 µl DelH_EcoRI_fw
Primer rev 10 µM	1 µl DelH_f1_SalI_rev 10	1 µl DelH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	68	5
	72	2:15 min
1	72	7 min
1	4	inf

Result

Expected band: 5 Kb

Fig.11.1 gel of amplified fragment F1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F1b with DMSO

There is a specific band, but not at 5 Kb.

=> We cannot amplify F1b from a PCR fragment. Use fresh bacteria instead.

Preparation of fresh ACM media

Mix ingrediants according to Acidovorax complex medium
Autoclave
pH adjust to 7,3
Mix 500 ml media and 6 g agar
Autoclave again
Pour plates

Preparation of fresh D. acidovorans

Inocculate 5 ml ACM media with D. acidovorans
Incubate ON
Prepare glycerol stock
Streak some of culture on plates

PCR Conditions F1b.W11.B

Reagent	DelH F1b	DelH F1b
Template	Fresh colony of plate by DN from 10-07	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	1 µl delH_EcoRI_fw	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl	10 µl
ddH₂O	7 µl	6 µl
DMSO	-	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.2 gel of amplified fragment 1B(loaded 20 µL)
l1:F1b without DMSO, l2: 2log ladder, l3: F 1b with DMSO
l3 shows a slight band at 5 Kb

There is a weak band at the probe 1b WITH DMSO above 5 Kb.

=> Start a new PCR with 50 µl with the same conditions.

PCR Conditions F1b.W11.C

Reagent	DelH 1b
Template	Fresh colony of plate by DN from 10-07
Primer fw 10 µM	2.5 µl delH_EcoRI_fw
Primer rev 10 µM	2.5 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	25 µl
ddH₂O	17.5 µl
DMSO	2.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0.5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5 Kb.

Fig.11.4gel of amplified fragment 1B(loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 band at 5 Kb was cut out

Fig.11.3 gel of amplified fragment 1B (loaded 50 µL)
l1:2log ladder, l2-4: F 1b with DMSO
l2-4 show expected band at 5 Kb and another lower band

The expected band at 5 Bk is weak, but visible. Note that there is sample left in the pocket.

=> The fragment was cut and gel extracted.

Generation of DelH plasmid

Restriction Digest

Of fragments F1a, F1b, F2 and backbone.

Fragment	DNA [µl]	ddH₂O [µl]	Enzymes [µl]	BSA [µl]	Buffer 4 [µl]
F1a (1)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1a (2)	30	7	1.5 Pac & EcoRI-HF each	5	5
F1b (11.7 - 20 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F1b (11.7 - 50 µl)	20	17	1.5 SalI-HF & EcoRI-HF each	5	5
F2	20	17	1.5 SalI-HF & KpnI-HF each	5	5
BB (6-7 of IK - 14 ng/µl)	20	17	1.5PacI & KpnI-HF each	5	5
BB (6-7)	20	17	1.5 PacI & KpnI-HF each	5	5

Result

Loaded 5 µl of restriction digested fragments on gel. The result stands in the table below:

Fragment	Band	Conclusion	Next step
F1a purified on 12-07	strong bands at 1, 2 and 3 Kb weak band at wanted 5 KB	PCR purification of F1a step was not the right purifying step	load complete probe on gel and gel extract
F1b purified on 12-07	weak band at 5 Kb	maybe only low concentration	run PCR again
F2	no band	maybe too low concentration	run PCR again
BB	weak band at 7.4 Kb	maybe only low concentration	run PCR again

Gel Extraction of DelH F1a

Expected band: 5 KB, loaded entire F1a purified on 12-07 on gel

Fig.11.5gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

No band visible.

=> Gel extract earlier PCR from 06-07.

Expected band: 5 Kb

Fig.11.6gel of minipreped and PCR-amplified DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep of BB (pSB6A1), l4:PCR of BB (pSB6A1)

PCR shows expected band.

=> F1a was cut and gel extracted.

Amplification of DelH F1b

PCR Conditions F1b.W11.D

Reagent	DelH F1b
Template	1 µl F1b digested 12-07
Primer fw 10 µM	1 µl delH_EcoRI_fw
Primer rev 10 µM	1 µl delH_f1_SalI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	6µl
DMSO	1 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	68 (touchdown -0,5°C)	5
	72	2:30 min
18	98	1
	68	5
	72	2:30 min
1	72	10 min
1	4	inf

Result

Expected band: 5.4 Kb

Fig.11.7gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR did not yield the specific band.

=> Use altered PCR conditions.

Amplification of DelH F2

PCR Conditions F2.W11.A

Reagent	DelH F2
Template	1 µl F2 digested 12-07
Primer fw 10 µM	1 µl delH_f2_SalI_fw
Primer rev 10 µM	1 µl delH_f2_KpnI_rev
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time
1	98	5 s
30	98	1 s
	66	5 s
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Further optimization.

Amplification of Backbone

PCR Conditions BB.W11.A

Reagent	Backbone
Template	1 µl backbone digested 12-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2 10
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
30	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Result

Expected band: 8 Kb

Fig.11.7Gel of PCR of DelH fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: F1b, l4:F2, l5: BB

PCR does not show the specific band.

=> Repeat using fresh backbone DNA from miniprep.

Miniprep

Inocculation of 10 ml LB Amp with DH10ß (pSB6A1-AraC-lacZ)
Perform mini prep

PCR Conditions BB.W11.B

Reagent	Backbone
Template	1 µl Miniprep A of 10-07
Primer fw 10 µM	1 µl AraCbb_KpnI_fw
Primer rev 10 µM	1 µl AraCbb_PacI_rev2
Phusion Flash Ready Mix	10 µl
ddH₂O	7 µl

Cycles	Temperature [°C]	Time [s]
1	98	5
12	98	1
	66 (touchdown -0.5°C)	5
	72	3:00 min
18	98	1
	66	5
	72	3:00 min
1	72	10 min
1	4	inf

Results

Expected band: 7.4 Kb, loaded miniprep and PCR product.

Fig.11.8gel of PCR of DelH-fragments (loaded 20 µL)
l1:F1a,l2:2log, l3: Miniprep A of BB, l4:PCR of BB

Miniprep shows weak band at ~7.4 Kb. PCR does not show expected band.

=> Prepare new mediprep of backbone (pSB6A1-AraC-lacZ)

Gibson Assembly Strategy

Vector map of the pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid.

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	tttt ttaattaa tcacacaggaaagtactag ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	tttt GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	tttt GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	tttt ggtacc TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	tttt ggtacc aaagaggagaaatactagatgaccatg
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	tttt ttaattaa gctagcccaaaaaaacgggtatg

Team:Heidelberg/Templates/DelH week11

From 2013.igem.org

Contents

08-07 - 14-07-13

Amplification of DelH F1b

PCR Conditions F1b.W11.A

Result

Preparation of fresh ACM media

Preparation of fresh D. acidovorans

PCR Conditions F1b.W11.B

Result

PCR Conditions F1b.W11.C

Result

Generation of DelH plasmid

Restriction Digest

Result

Gel Extraction of DelH F1a

Amplification of DelH F1b

PCR Conditions F1b.W11.D

Result

Amplification of DelH F2

PCR Conditions F2.W11.A

Result

Amplification of Backbone

PCR Conditions BB.W11.A

Result

Miniprep

PCR Conditions BB.W11.B

Results

Gibson Assembly Strategy