</div>
Contents |
There were essentially four DNA pieces that we wanted to combine together to make a construct: The tat signal sequence followed by GFP, a small linker region and RFP put into a plasmid backbone. As our cloning techniques rely on overlapping DNA fragments we used mostly primers with overhengs in the PCR reactions. As templates we used the biobricks <partinfo>BBa_E1010</partinfo> for RFP, <partinfo>BBa_E0040</partinfo> for GFP, <partinfo>BBa_J01101</partinfo> for the plasmid backbone and genomic DNA from ‘’Escherichia coli’’ strain ER2566 for the tat signal sequence.
Table: Primers applied in creating the tat_GFP_l_RFP construct. Lowercase letters indicate DNA that anneal to the template whereas the uppercase letters indicate DNA that serves as an overhang.
| Amplfing | Primer | Sequence |
|---|---|---|
| tat | F_pl.b_tat | AGAGAAAGAGGAGAAATACTAGatggccaataacgatctctttcaggcatcacg |
| tat | R_tat | cgcttgcgccgcagtcgcacgtcg |
| GFP | F_tat_GFP | CGACGTGCGACTGCGGCGCAAGCGatgcgtaaaggagaagaac |
| GFP | R_l_GFP | ACTACCACCGGATCCACCTGATCCACCGGATCCACCtttgtatagttcatccatgcc |
| RFP | F_l_RFP | GGTGGATCCGGTGGATCAGGTGGATCCGGTGGTAGTatggcttcctccgaagacg |
| RFP | R_pl.b_RFP | GCCTTTCGTTTTATTTGATGCCTGGgcgatctacactagcactatcagcg |
| Plasmid backbone | F_pl.b | ccaggcatcaaataaaacgaaagg |
| Plasmid backbone | R_pl.b | ctagtatttctcctctttctctagtagtgc |
The linker region is going to be only 36 bp long and will therefore be created by overlapping overhengs on the reverse primer of GFP and forward primer of RFP. The primers for the plasmid backbone is designed to include the TetR repressible promoter (<partinfo>BBa_R0040</partinfo>), RBS (<partinfo>BBa_B0034</partinfo>) and two terminators (<partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>) in the PCR product. All of the PCR products were treated with the enzyme DpnI that digests methylated DNA.
"
