"
Team:Heidelberg/Tyrocidine week16 ov
From 2013.igem.org
Revision as of 17:02, 4 October 2013 by TaniaChristiansen (Talk | contribs)
Primers ordered for Interspecies Fusion Experiments
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| PW14:C(TycC2)-indC_rev | 2013-08-16 | Amplification of C-domain from TycC2 from Brevibacillus parabrevis; Gibson overhang to IndC; for construct 1, 2 & 3 | ACATTGTGTAATATTATTTTCTAACAT CGTTTTGCTGCTGGCAGGCTG |
| PW15:C(TycC2)-indC_fwd | 2013-08-16 | Amplification of indC from Photorhabdus luminescens; Gibson overhang to C-domain from TycC2; for construct 1, 2 & 3 | CAGCCTGCCAGCAGCAAAACG ATGTTAGAAAATAATATTACACAATGT |
| PW16:indC_rev | 2013-08-16 | Amplification of indC from Photorhabdus luminescens; no Gibson overhang; for construct 1, 2 & 3 | TTAGATTATTTTCTCAATCTCAGCAACACCTTC |
| PW17:TycAdE-C(TycC2)_rev | 2013-08-16 | Amplification of TycAdE from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC2; for construct 1 | CGAAAGGAAGCGGGCCAGCTC AGCAACCTGCTCGATCGTCGGGTA |
| PW18:TycAdE-C(TycC2)_fwd | 2013-08-16 | Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycAdE; for construct 1 | TACCCGACGATCGAGCAGGTTGCT GAGCTGGCCCGCTTCCTTTCG |
| PW19:TycC4dC_fwd | 2013-08-16 | Amplification of TycC4-module from Brevibacillus parabrevis without the C-domain; no Gibson overhang, ATG added; for construct 3 | ATGTATCCGCGCGATCTGACGATTC |
| PW20:TycC4dC-C(TycC2)_rev | 2013-08-16 | Amplification of TycC4-module from Brevibacillus parabrevis without the C-domain; Gibson overhang to C-domain form TycC2; for construct 3 | GGTGTACTCGGTTTTTTCCGA AATATGCGCAGCCAACTCATG |
| PW21:TycC4dC-C(TycC2)_fwd | 2013-08-16 | Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycC4dC; for construct 3 | CATGAGTTGGCTGCGCATATT TCGGAAAAAACCGAGTACACC |
| PW22:pSB1C3-TycC4dC_rev | 2013-08-16 | Insertion of construct 3 into pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC4dC; for construct 3 | GAATCGTCAGATCGCGCGGATACAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG |
| PW23:indC-pSB1C3_fwd | 2013-08-16 | Insertion of either fragments into pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to indC from Photorhabdus luminescens; for constructs 1, 2 & 3 | GGTGTTGCTGAGATTGAGAAAATAATCTAA TAATAACGCTGATAGTGCTAGTGTAGATC |
| PW24:TycC1dC_fwd | 2013-08-16 | Amplification of the TycC1-module from Brevibacillus parabrevis without the C-domain; no Gibson overhang, ATG added; for construct 2 | ATGCAGACGAACAAACAACAGACG |
| PW25:pSB1C3-TycC1dC | 2013-08-16 | Insertion of construct 2 in pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC1-module without C-domain; for construct 2 | CGTCTGTTGTTTGTTCGTCTGCAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG |
