http://2013.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=TULIO007&year=&month=2013.igem.org - User contributions [en]2024-03-28T17:34:17ZFrom 2013.igem.orgMediaWiki 1.16.5http://2013.igem.org/Team:UNITN-Trento/Project/EthyleneTeam:UNITN-Trento/Project/Ethylene2013-10-04T18:34:01Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Project_pages&amp;action=raw&amp;ctype=text/javascript" type="text/javascript"></script><br />
<br />
<!--PAGE--><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Ethylene</span><br />
<p><br />
EFE (Ethylene Forming Enzyme - 2-Oxoglutarate Oxygenase/Decarboxylase) is our keyplayer in triggering fruit ripening. It catalyzes ethylene synthesis from 2-Oxoglutarate, a TCA cycle intermediate molecule <span class="tn-ref">(Goto M., Plant and Cell Physiology 2012, 26: 141-150)</span>.<br />
</p><br />
<br />
<img class="no-border" src="https://static.igem.org/mediawiki/2013/f/f8/Tn-2013-project_ethylene-Eth_path.jpg" alt="Ethylene pathway" /><br />
<br />
<p><br />
We characterized this gene in two chassis: <i>E. coli</i> and <i>B. subtilis</i>, using different constructs that we designed.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/9/9b/Tn-2013-project_ethylene-BBa_K1065000.jpg" alt="E. coli EFE parts" /><br />
<p><br />
In <i>E. coli</i>, EFE-catalyzed ethylene production was characterized using <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, which is a composed part with EFE under the control of an araC-pBAD promoter.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Ethylene detection</span><br />
<p><br />
Ethylene production was detected using a Micro Gas Chromatograph (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#ethylene-detection-assay">protocol page</a> for the adopted methodology, <b>Figure 1</b>). The instrument was calibrated using two different air mixtures with well-defined quantities of each molecule (carbon dioxide, oxygen and ethylene).<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/c/cf/Tn-2013_EFE_chromatogram.jpg" alt="Ethylene chromatogram" /><br />
<span class="tn-caption"><b>Fig. 1:</b> Ethylene production. <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were grown in a thermoshaker until an O.D. of 0.5, placed in hermetically closed vials with a rubber septum and induced with 5 mM arabinose. Ethylene was measured after 4 hours of induction at 37 °C by connecting the vial to an Agilent Micro GC 3000.</span><br />
<br />
<p><br />
To quantify the amount of ethylene produced the peak integral was converted into ppm.<br />
</p><br />
<br />
<table class="no-bottom" id="ethylene_detected"><br />
<tr><br />
<th class="center"><br />
Sample<br />
</th><br />
<th class="center"><br />
Ethylene detected<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Not induced<br />
</td><br />
<td class="right"><br />
0 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 1.5 ml<br />
</td><br />
<td class="right"><br />
61 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 3 ml<br />
</td><br />
<td class="right"><br />
101 ± 15 ppm<br />
</td><br />
</tr><br />
</table><br />
<br />
<span class="tn-caption center"><b>Table. 1:</b> ethylene detected quantities.</span><br />
<br />
<span class="tn-sub-subtitle">Kinetic assay for ethylene production</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#kinetic-ethylene-production">protocol page</a> for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013_kinetic_EFE_plot-2.png" alt="kinetic_EFE_plot" /><br />
<img class="photo no-bottom" src="https://static.igem.org/mediawiki/2013/9/98/Tn-2013_ethylene_kinetic_img.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 2:</b> Ethylene production (ppm) over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, induced with 5 mM arabinose at different O.D.600 and cultured in different conditions. The control (not-induced sample) did not show any amount of ethylene.</span><br />
<br />
<p><br />
<b>Figure 2</b> shows that induction of the culture at O.D.600 equal to 0.8 caused a 2-fold increase in ethylene production.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Toxicity test</span><br />
<p><br />
A toxicity test was performed inducing EFE expression with 5 mM arabinose (<b>Figure 3</b>). The growth curve was then compared to a non-induced sample.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/6/6f/Tn-20130627-Efe_Toxicity_test-PLOT.png" alt="Toxicity test plot" /><br />
<span class="tn-caption center"><b>Fig. 3:</b> growth curves of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> and of controls.</span><br />
<br />
<p><br />
As expected, induced samples showed a decreased growth rate.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE under the control of a Blue light circuit in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/5/59/BluelightEFE.jpg" alt="e.coli_bluelight-EFE_parts" /><br />
<p><br />
To build our final system we placed EFE under the control of a photoinducible circuit. We assembled the photoinducible circuit exploiting many subparts from different teams (Uppsala 2011 and Berkeley 2006). The construct <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> includes an inverter that allows ethylene production only in presence of light. For more details on the design and characterization of the circuit check the <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue_light"> <b> blue light page </b> </a> of our wiki.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Photoinduced ethylene production - kinetic assay</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time using <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> (<b>Figure 4</b>). At an O.D. of 0.7, the culture was transferred to an hermetically closed vial and exposed to a blue light LED (470 nm). This airtight vial was also connected to the micro GC (see the protocol page for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/2/28/Blue_light_EFE_kinetic.png" alt="EFE-blue_light_plot" /><br />
<img class="photo no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/d/dc/Tn-2013_bluelight_kinetic.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 4:</b> Ethylene production (ppm) upon photoinduction with a blue LED light over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a>.</span><br />
<br />
<br />
When we first obtained these results we were really excited. However, the negative control (dark) showed also some ethylene production. The DNA sequencing also indicated some problems in the construct. We have recently fixed this part, confirmed it by sequencing, and submitted it to the registry. We did not have the possibility yet to test it for ethylene production. However this updated version of <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> is able to produce amilCP when photoinduced. Since the blue reporter correctly appeared only in the induced sample, we think that ethylene could be properly produced. <br><br/><br />
<br />
<img style="width:50%;"src="https://static.igem.org/mediawiki/2013/7/7e/Tn-2013Pelletts.png"/><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5: </b> amilCP production upon photoinduction. <i>E. coli</i> NEB10&beta; tranformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> were grown in the dark until O.D. 0.6 was reached. The culture was then splitted in two samples and one of them was exposed to a blue LED. The samples were grown overnight and the following morning were pelletted. The image clearly shows how only the photoinduced sample (2) produced amilCP while the control (1) kept in the dark remained white.</span> <br />
<br />
<span class="tn-subtitle">EFE in <i>B. subtilis</i></span><br />
<p><br />
In order to transform <i>B. subtilis</i> with EFE, we decided to exploit two type of vectors designed by the <a href="https://2012.igem.org/Team:LMU-Munich/Data/Vectors">LMU-Munich 2012 iGEM team</a>: pXyl and pSpac. These two vectors were not functionally active: pXyl had a point mutation resulting in a non-transformable vector, and pSpac had a point mutation in the promoter resulting in a non-inducible but constitutive vector. We received from the LMU-Munich team the <b>corrected and functionally active version of both plasmids</b> (functionality was characterized by them).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/8/85/Tn-2013-project_ethylene-BBa_K1065001.jpg" /><br />
<p><br />
EFE was inserted in two <i>B. subtilis</i> plasmids under the control of two different inducible promoters. We tried to express EFE and measure ethylene by GC. However, ethylene was not detected. We are now trying to understand if it is a problem of expression or functionality of the enzyme.<br />
<br />
Interestingly, induced samples showed a distinct smell of sulfur. The presence of sulfur was confirmed by exposure of the culture to a lead acetate paper strip. One hypothesis could be that <i>B. subtilis</i> is capable of converting rapidly ethylene into other mercapto-compounds.<br />
</p><br />
<span class="tn-subtitle">Ethylene diffusion in jars</span><br />
<p><br />
Our ripening machine device is composed of a jar connected to a flask with induced ethylene-producing culture, where the jar contains the fruit to be ripened. A kinetic assay of ethylene in the atmosphere inside our system (jar, connector and flask) was performed by Micro Gas Chromatography and ethylene diffusion from the culture medium was predicted assuming inverse proportionality between detected ethylene and air/culture volume ratio. The estimated data were compared to the results of the kinetic assay as reported in <b>Table 2</b>.<br />
</p><br />
<table><br />
<tr><br />
<th><br />
<center> Jar volume (ml) </center><br />
</th><br />
<th><br />
<center>Air volume in the jar + connections (ml) /<center><br />
</th><br />
<th><br />
<center> Culture volume (ml)</center><br />
</th><br />
<th><br />
<center> Air/culture volumes ratio </center><br />
</th><br />
<th><br />
<center> Concentration Expected </center><br />
</th> <br />
</tr> <br />
<tr><br />
<td><br />
<center> 500 </center> <br />
</td><br />
<td><br />
<center> 800 </center> <br />
</td><br />
<td><br />
<center> 300 </center> <br />
</td><br />
<td><br />
<center> 2.66 </center> <br />
</td><br />
<td><br />
<center> 150.37 </center> <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<center>1000 </center> <br />
</td> <br />
<td><br />
<center>1300 </center> <br />
</td><br />
<td><br />
<center>300 </center> <br />
</td><br />
<td><br />
<center> 4.33 </center> <br />
</td><br />
<td><br />
<center> 92.37 </center> <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<center>1500 </center> <br />
</td> <br />
<td><br />
<center>1800 </center> <br />
</td><br />
<td><br />
<center>300 </center> <br />
</td><br />
<td><br />
<center>6 </center> <br />
</td><br />
<td><br />
<center>66.66 </center><br />
</td><br />
</tr><br />
</table> <br />
<span class="tn-caption center"><b>Table 2:</b> prediction of ethylene diffusion in jars.</span><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013_eth_diff_apparatus.JPG" style="display:inline-block;width:40%;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="photo"/><br />
<img src="https://static.igem.org/mediawiki/2013/a/af/Ethylene_diffusion_in_jars.png" style="display:inline-block;width: 58%;height: 307px;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="plot"/><br />
<span class="tn-caption"><b>Fig 6:</b> In the left panel, experimental set-up for kinetic measurement of ethylene diffusion. In the right panel, comparison between detected and expected ethylene values. 300 ml of NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were induced at O.D. 0.5 and placed into a 500 ml flasks connected to a jar. The jar was simultaneusly connected to the Agilent A3000 micro GC, and a measurment was taken every 45 min for about 12 h.</span><br />
<br />
<span class="tn-quote center">Interestingly, we underextimated the ethylene level in the jars!</span><br />
<br />
<br />
<span class="tn-title">Ethylene experiments - Summary</span><br />
<p><br />
2-Oxoglutarate Oxygenase/Decarboxylase (EFE) is a very powerful enzyme that we successfully characterized. We achieved the following results:<br />
</p><br />
<ul><br />
<li><br />
EFE was expressed under the control of an arabinose inducible promoter in <i>E. coli</i>;<br />
</li><br />
<li><br />
ethylene was detected at the Micro Gas Chromatograph and a quantitative kinetic curve was registered;<br />
</li><br />
<li><br />
EFE was then inserted into a photoinducible promoter and preliminary analysis showed ethylene production (unfortunately also in the dark control);<br />
</li><br />
<li><br />
EFE was inserted into <i>B. subtilis</i> expression vectors, unfortunately ethylene was not detected upon expression;<br />
</li><br />
<li><br />
successfully demonstrated and quantified the presence of ethylene in the jars;<br />
</li> <br />
<li><br />
our system was successfully exploited to accelerate fruit ripening.<br />
</li><br />
</ul><br />
<br/><br />
<br />
<span class="tn-effect">We succeeded in producing ethylene with our system!</span><br />
<span class="tn-effect">Follow our results to discover how we used it to ripen fruit.</span><br />
<img style="width:60%;" src="https://static.igem.org/mediawiki/2013/a/a9/Tn-2013_fruit_exp_pic.jpg" /><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Introduction"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/7/7f/Tn-2013-arr-ETH_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Methyl%20Salicylate"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/b/b9/Tn-2013-arr-ETH_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/8/81/Tn-2013-tour-T_AAA_DSC_0076.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/EthyleneTeam:UNITN-Trento/Project/Ethylene2013-10-04T18:25:19Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Project_pages&amp;action=raw&amp;ctype=text/javascript" type="text/javascript"></script><br />
<br />
<!--PAGE--><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Ethylene</span><br />
<p><br />
EFE (Ethylene Forming Enzyme - 2-Oxoglutarate Oxygenase/Decarboxylase) is our keyplayer in triggering fruit ripening. It catalyzes ethylene synthesis from 2-Oxoglutarate, a TCA cycle intermediate molecule <span class="tn-ref">(Goto M., Plant and Cell Physiology 2012, 26: 141-150)</span>.<br />
</p><br />
<br />
<img class="no-border" src="https://static.igem.org/mediawiki/2013/f/f8/Tn-2013-project_ethylene-Eth_path.jpg" alt="Ethylene pathway" /><br />
<br />
<p><br />
We characterized this gene in two chassis: <i>E. coli</i> and <i>B. subtilis</i>, using different constructs that we designed.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/9/9b/Tn-2013-project_ethylene-BBa_K1065000.jpg" alt="E. coli EFE parts" /><br />
<p><br />
In <i>E. coli</i>, EFE-catalyzed ethylene production was characterized using <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, which is a composed part with EFE under the control of an araC-pBAD promoter.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Ethylene detection</span><br />
<p><br />
Ethylene production was detected using a Micro Gas Chromatograph (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#ethylene-detection-assay">protocol page</a> for the adopted methodology, <b>Figure 1</b>). The instrument was calibrated using two different air mixtures with well-defined quantities of each molecule (carbon dioxide, oxygen and ethylene).<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/c/cf/Tn-2013_EFE_chromatogram.jpg" alt="Ethylene chromatogram" /><br />
<span class="tn-caption"><b>Fig. 1:</b> Ethylene production. <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were grown in a thermoshaker until an O.D. of 0.5, placed in hermetically closed vials with a rubber septum and induced with 5 mM arabinose. Ethylene was measured after 4 hours of induction at 37 °C by connecting the vial to an Agilent Micro GC 3000.</span><br />
<br />
<p><br />
To quantify the amount of ethylene produced the peak integral was converted into ppm.<br />
</p><br />
<br />
<table class="no-bottom" id="ethylene_detected"><br />
<tr><br />
<th class="center"><br />
Sample<br />
</th><br />
<th class="center"><br />
Ethylene detected<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Not induced<br />
</td><br />
<td class="right"><br />
0 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 1.5 ml<br />
</td><br />
<td class="right"><br />
61 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 3 ml<br />
</td><br />
<td class="right"><br />
101 ± 15 ppm<br />
</td><br />
</tr><br />
</table><br />
<br />
<span class="tn-caption center"><b>Table. 1:</b> ethylene detected quantities.</span><br />
<br />
<span class="tn-sub-subtitle">Kinetic assay for ethylene production</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#kinetic-ethylene-production">protocol page</a> for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013_kinetic_EFE_plot-2.png" alt="kinetic_EFE_plot" /><br />
<img class="photo no-bottom" src="https://static.igem.org/mediawiki/2013/9/98/Tn-2013_ethylene_kinetic_img.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 2:</b> Ethylene production (ppm) over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, induced with 5 mM arabinose at different O.D.600 and cultured in different conditions. The control (not-induced sample) did not show any amount of ethylene.</span><br />
<br />
<p><br />
<b>Figure 2</b> shows that induction of the culture at O.D.600 equal to 0.8 caused a 2-fold increase in ethylene production.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Toxicity test</span><br />
<p><br />
A toxicity test was performed inducing EFE expression with 5 mM arabinose (<b>Figure 3</b>). The growth curve was then compared to a non-induced sample.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/6/6f/Tn-20130627-Efe_Toxicity_test-PLOT.png" alt="Toxicity test plot" /><br />
<span class="tn-caption center"><b>Fig. 3:</b> growth curves of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> and of controls.</span><br />
<br />
<p><br />
As expected, induced samples showed a decreased growth rate.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE under the control of a Blue light circuit in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/5/59/BluelightEFE.jpg" alt="e.coli_bluelight-EFE_parts" /><br />
<p><br />
To build our final system we placed EFE under the control of a photoinducible circuit. We assembled the photoinducible circuit exploiting many subparts from different teams (Uppsala 2011 and Berkeley 2006). The construct <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> includes an inverter that allows ethylene production only in presence of light. For more details on the design and characterization of the circuit check the <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue_light"> <b> blue light page </b> </a> of our wiki.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Photoinduced ethylene production - kinetic assay</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time using <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> (<b>Figure 4</b>). At an O.D. of 0.7, the culture was transferred to an hermetically closed vial and exposed to a blue light LED (470 nm). This airtight vial was also connected to the micro GC (see the protocol page for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/2/28/Blue_light_EFE_kinetic.png" alt="EFE-blue_light_plot" /><br />
<img class="photo no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/d/dc/Tn-2013_bluelight_kinetic.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 4:</b> Ethylene production (ppm) upon photoinduction with a blue LED light over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a>.</span><br />
<br />
<br />
When we first obtained these results we were really excited. However, the negative control (dark) showed also some ethylene production. The DNA sequencing also indicated some problems in the construct. We have recently fixed this part, confirmed it by sequencing, and submitted it to the registry. We did not have the possibility yet to test it for ethylene production. However this updated version of <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> is able to produce amilCP when photoinduced. Since the blue reporter correctly appeared only in the induced sample, we think that ethylene could be properly produced. <br><br/><br />
<br />
<img style="width:50%;"src="https://static.igem.org/mediawiki/2013/7/7e/Tn-2013Pelletts.png"/><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5: </b> amilCP production upon photoinduction. <i>E. coli</i> NEB10&beta; tranformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> were grown in the dark until O.D. 0.6 was reached. The culture was then splitted in two samples and one of them was exposed to a blue LED. The samples were grown overnight and the following morning were pelletted. The image clearly shows how only the photoinduced sample (2) produced amilCP while the control (1) kept in the dark remained white.</span> <br />
<br />
<span class="tn-subtitle">EFE in <i>B. subtilis</i></span><br />
<p><br />
In order to transform <i>B. subtilis</i> with EFE, we decided to exploit two type of vectors designed by the <a href="https://2012.igem.org/Team:LMU-Munich/Data/Vectors">LMU-Munich 2012 iGEM team</a>: pXyl and pSpac. These two vectors were not functionally active: pXyl had a point mutation resulting in a non-transformable vector, and pSpac had a point mutation in the promoter resulting in a non-inducible but constitutive vector. We received from the LMU-Munich team the <b>corrected and functionally active version of both plasmids</b> (functionality was characterized by them).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/8/85/Tn-2013-project_ethylene-BBa_K1065001.jpg" /><br />
<p><br />
EFE was inserted in two <i>B. subtilis</i> plasmids under the control of two different inducible promoters. We tried to express EFE and measure ethylene by GC. However, ethylene was not detected. We are now trying to understand if it is a problem of expression or functionality of the enzyme.<br />
<br />
Interestingly, induced samples showed a distinct smell of sulfur. The presence of sulfur was confirmed by exposure of the culture to a lead acetate paper strip. One hypothesis could be that <i>B. subtilis</i> is capable of converting rapidly ethylene into other mercapto-compounds.<br />
</p><br />
<span class="tn-subtitle">Ethylene diffusion in jars</span><br />
<p><br />
Our ripening machine device is composed of a jar connected to a flask with induced ethylene-producing culture, where the jar contains the fruit to be ripened. A kinetic assay of ethylene in the atmosphere inside our system (jar, connector and flask) was performed by Micro Gas Chromatography and ethylene diffusion from the culture medium was predicted assuming inverse proportionality between detected ethylene and air/culture volume ratio. The estimated data were compared to the results of the kinetic assay as reported in <b>Table 2</b>.<br />
</p><br />
<table><br />
<tr><br />
<th><br />
<center> Jar volume (ml) </center><br />
</th><br />
<th><br />
<center>Air volume in the jar + connections (ml) /<center><br />
</th><br />
<th><br />
<center> Culture volume (ml)</center><br />
</th><br />
<th><br />
<center> Air/culture volumes ratio </center><br />
</th><br />
<th><br />
<center> Concentration Expected </center><br />
</th> <br />
</tr> <br />
<tr><br />
<td><br />
<center> 500 <br />
</td><br />
<td><br />
800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
2.66<br />
</td><br />
<td><br />
150.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1000<br />
</td> <br />
<td><br />
1300<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
4.33<br />
</td><br />
<td><br />
92.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1500<br />
</td> <br />
<td><br />
1800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
6<br />
</td><br />
<td><br />
66.66 </center><br />
</td><br />
</tr><br />
</table> <br />
<span class="tn-caption center"><b>Table 2:</b> prediction of ethylene diffusion in jars.</span><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013_eth_diff_apparatus.JPG" style="display:inline-block;width:40%;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="photo"/><br />
<img src="https://static.igem.org/mediawiki/2013/a/af/Ethylene_diffusion_in_jars.png" style="display:inline-block;width: 58%;height: 307px;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="plot"/><br />
<span class="tn-caption"><b>Fig 6:</b> In the left panel, experimental set-up for kinetic measurement of ethylene diffusion. In the right panel, comparison between detected and expected ethylene values. 300 ml of NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were induced at O.D. 0.5 and placed into a 500 ml flasks connected to a jar. The jar was simultaneusly connected to the Agilent A3000 micro GC, and a measurment was taken every 45 min for about 12 h.</span><br />
<br />
<span class="tn-quote center">Interestingly, we underextimated the ethylene level in the jars!</span><br />
<br />
<br />
<span class="tn-title">Ethylene experiments - Summary</span><br />
<p><br />
2-Oxoglutarate Oxygenase/Decarboxylase (EFE) is a very powerful enzyme that we successfully characterized. We achieved the following results:<br />
</p><br />
<ul><br />
<li><br />
EFE was expressed under the control of an arabinose inducible promoter in <i>E. coli</i>;<br />
</li><br />
<li><br />
ethylene was detected at the Micro Gas Chromatograph and a quantitative kinetic curve was registered;<br />
</li><br />
<li><br />
EFE was then inserted into a photoinducible promoter and preliminary analysis showed ethylene production (unfortunately also in the dark control);<br />
</li><br />
<li><br />
EFE was inserted into <i>B. subtilis</i> expression vectors, unfortunately ethylene was not detected upon expression;<br />
</li><br />
<li><br />
successfully demonstrated and quantified the presence of ethylene in the jars;<br />
</li> <br />
<li><br />
our system was successfully exploited to accelerate fruit ripening.<br />
</li><br />
</ul><br />
<br/><br />
<br />
<span class="tn-effect">We succeeded in producing ethylene with our system!</span><br />
<span class="tn-effect">Follow our results to discover how we used it to ripen fruit.</span><br />
<img style="width:60%;" src="https://static.igem.org/mediawiki/2013/a/a9/Tn-2013_fruit_exp_pic.jpg" /><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Introduction"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/7/7f/Tn-2013-arr-ETH_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Methyl%20Salicylate"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/b/b9/Tn-2013-arr-ETH_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/8/81/Tn-2013-tour-T_AAA_DSC_0076.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/EthyleneTeam:UNITN-Trento/Project/Ethylene2013-10-04T18:23:38Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Project_pages&amp;action=raw&amp;ctype=text/javascript" type="text/javascript"></script><br />
<br />
<!--PAGE--><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Ethylene</span><br />
<p><br />
EFE (Ethylene Forming Enzyme - 2-Oxoglutarate Oxygenase/Decarboxylase) is our keyplayer in triggering fruit ripening. It catalyzes ethylene synthesis from 2-Oxoglutarate, a TCA cycle intermediate molecule <span class="tn-ref">(Goto M., Plant and Cell Physiology 2012, 26: 141-150)</span>.<br />
</p><br />
<br />
<img class="no-border" src="https://static.igem.org/mediawiki/2013/f/f8/Tn-2013-project_ethylene-Eth_path.jpg" alt="Ethylene pathway" /><br />
<br />
<p><br />
We characterized this gene in two chassis: <i>E. coli</i> and <i>B. subtilis</i>, using different constructs that we designed.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/9/9b/Tn-2013-project_ethylene-BBa_K1065000.jpg" alt="E. coli EFE parts" /><br />
<p><br />
In <i>E. coli</i>, EFE-catalyzed ethylene production was characterized using <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, which is a composed part with EFE under the control of an araC-pBAD promoter.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Ethylene detection</span><br />
<p><br />
Ethylene production was detected using a Micro Gas Chromatograph (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#ethylene-detection-assay">protocol page</a> for the adopted methodology, <b>Figure 1</b>). The instrument was calibrated using two different air mixtures with well-defined quantities of each molecule (carbon dioxide, oxygen and ethylene).<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/c/cf/Tn-2013_EFE_chromatogram.jpg" alt="Ethylene chromatogram" /><br />
<span class="tn-caption"><b>Fig. 1:</b> Ethylene production. <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were grown in a thermoshaker until an O.D. of 0.5, placed in hermetically closed vials with a rubber septum and induced with 5 mM arabinose. Ethylene was measured after 4 hours of induction at 37 °C by connecting the vial to an Agilent Micro GC 3000.</span><br />
<br />
<p><br />
To quantify the amount of ethylene produced the peak integral was converted into ppm.<br />
</p><br />
<br />
<table class="no-bottom" id="ethylene_detected"><br />
<tr><br />
<th class="center"><br />
Sample<br />
</th><br />
<th class="center"><br />
Ethylene detected<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Not induced<br />
</td><br />
<td class="right"><br />
0 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 1.5 ml<br />
</td><br />
<td class="right"><br />
61 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 3 ml<br />
</td><br />
<td class="right"><br />
101 ± 15 ppm<br />
</td><br />
</tr><br />
</table><br />
<br />
<span class="tn-caption center"><b>Table. 1:</b> ethylene detected quantities.</span><br />
<br />
<span class="tn-sub-subtitle">Kinetic assay for ethylene production</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#kinetic-ethylene-production">protocol page</a> for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013_kinetic_EFE_plot-2.png" alt="kinetic_EFE_plot" /><br />
<img class="photo no-bottom" src="https://static.igem.org/mediawiki/2013/9/98/Tn-2013_ethylene_kinetic_img.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 2:</b> Ethylene production (ppm) over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, induced with 5 mM arabinose at different O.D.600 and cultured in different conditions. The control (not-induced sample) did not show any amount of ethylene.</span><br />
<br />
<p><br />
<b>Figure 2</b> shows that induction of the culture at O.D.600 equal to 0.8 caused a 2-fold increase in ethylene production.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Toxicity test</span><br />
<p><br />
A toxicity test was performed inducing EFE expression with 5 mM arabinose (<b>Figure 3</b>). The growth curve was then compared to a non-induced sample.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/6/6f/Tn-20130627-Efe_Toxicity_test-PLOT.png" alt="Toxicity test plot" /><br />
<span class="tn-caption center"><b>Fig. 3:</b> growth curves of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> and of controls.</span><br />
<br />
<p><br />
As expected, induced samples showed a decreased growth rate.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE under the control of a Blue light circuit in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/5/59/BluelightEFE.jpg" alt="e.coli_bluelight-EFE_parts" /><br />
<p><br />
To build our final system we placed EFE under the control of a photoinducible circuit. We assembled the photoinducible circuit exploiting many subparts from different teams (Uppsala 2011 and Berkeley 2006). The construct <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> includes an inverter that allows ethylene production only in presence of light. For more details on the design and characterization of the circuit check the <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue_light"> <b> blue light page </b> </a> of our wiki.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Photoinduced ethylene production - kinetic assay</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time using <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> (<b>Figure 4</b>). At an O.D. of 0.7, the culture was transferred to an hermetically closed vial and exposed to a blue light LED (470 nm). This airtight vial was also connected to the micro GC (see the protocol page for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/2/28/Blue_light_EFE_kinetic.png" alt="EFE-blue_light_plot" /><br />
<img class="photo no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/d/dc/Tn-2013_bluelight_kinetic.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 4:</b> Ethylene production (ppm) upon photoinduction with a blue LED light over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a>.</span><br />
<br />
<br />
When we first obtained these results we were really excited. However, the negative control (dark) showed also some ethylene production. The DNA sequencing also indicated some problems in the construct. We have recently fixed this part, confirmed it by sequencing, and submitted it to the registry. We did not have the possibility yet to test it for ethylene production. However this updated version of <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> is able to produce amilCP when photoinduced. Since the blue reporter correctly appeared only in the induced sample, we think that ethylene could be properly produced. <br><br/><br />
<br />
<img style="width:50%;"src="https://static.igem.org/mediawiki/2013/7/7e/Tn-2013Pelletts.png"/><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5: </b> amilCP production upon photoinduction. <i>E. coli</i> NEB10&beta; tranformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> were grown in the dark until O.D. 0.6 was reached. The culture was then splitted in two samples and one of them was exposed to a blue LED. The samples were grown overnight and the following morning were pelletted. The image clearly shows how only the photoinduced sample (2) produced amilCP while the control (1) kept in the dark remained white.</span> <br />
<br />
<span class="tn-subtitle">EFE in <i>B. subtilis</i></span><br />
<p><br />
In order to transform <i>B. subtilis</i> with EFE, we decided to exploit two type of vectors designed by the <a href="https://2012.igem.org/Team:LMU-Munich/Data/Vectors">LMU-Munich 2012 iGEM team</a>: pXyl and pSpac. These two vectors were not functionally active: pXyl had a point mutation resulting in a non-transformable vector, and pSpac had a point mutation in the promoter resulting in a non-inducible but constitutive vector. We received from the LMU-Munich team the <b>corrected and functionally active version of both plasmids</b> (functionality was characterized by them).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/8/85/Tn-2013-project_ethylene-BBa_K1065001.jpg" /><br />
<p><br />
EFE was inserted in two <i>B. subtilis</i> plasmids under the control of two different inducible promoters. We tried to express EFE and measure ethylene by GC. However, ethylene was not detected. We are now trying to understand if it is a problem of expression or functionality of the enzyme.<br />
<br />
Interestingly, induced samples showed a distinct smell of sulfur. The presence of sulfur was confirmed by exposure of the culture to a lead acetate paper strip. One hypothesis could be that <i>B. subtilis</i> is capable of converting rapidly ethylene into other mercapto-compounds.<br />
</p><br />
<span class="tn-subtitle">Ethylene diffusion in jars</span><br />
<p><br />
Our ripening machine device is composed of a jar connected to a flask with induced ethylene-producing culture, where the jar contains the fruit to be ripened. A kinetic assay of ethylene in the atmosphere inside our system (jar, connector and flask) was performed by Micro Gas Chromatography and ethylene diffusion from the culture medium was predicted assuming inverse proportionality between detected ethylene and air/culture volume ratio. The estimated data were compared to the results of the kinetic assay as reported in <b>Table 2</b>.<br />
</p><br />
<table><br />
<tr><br />
<th><br />
<center> Jar volume (ml) </center><br />
</th><br />
<th><br />
Air volume in the jar + connections (ml)<br />
</th><br />
<th><br />
Culture volume (ml)<br />
</th><br />
<th><br />
Air/culture volumes ratio<br />
</th><br />
<th><br />
Concentration Expected<br />
</th> <br />
</tr> <br />
<tr><br />
<td><br />
500 <br />
</td><br />
<td><br />
800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
2.66<br />
</td><br />
<td><br />
150.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1000<br />
</td> <br />
<td><br />
1300<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
4.33<br />
</td><br />
<td><br />
92.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1500<br />
</td> <br />
<td><br />
1800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
6<br />
</td><br />
<td><br />
66.66<br />
</td><br />
</tr><br />
</table> <br />
<span class="tn-caption center"><b>Table 2:</b> prediction of ethylene diffusion in jars.</span><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013_eth_diff_apparatus.JPG" style="display:inline-block;width:40%;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="photo"/><br />
<img src="https://static.igem.org/mediawiki/2013/a/af/Ethylene_diffusion_in_jars.png" style="display:inline-block;width: 58%;height: 307px;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="plot"/><br />
<span class="tn-caption"><b>Fig 6:</b> In the left panel, experimental set-up for kinetic measurement of ethylene diffusion. In the right panel, comparison between detected and expected ethylene values. 300 ml of NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were induced at O.D. 0.5 and placed into a 500 ml flasks connected to a jar. The jar was simultaneusly connected to the Agilent A3000 micro GC, and a measurment was taken every 45 min for about 12 h.</span><br />
<br />
<span class="tn-quote center">Interestingly, we underextimated the ethylene level in the jars!</span><br />
<br />
<br />
<span class="tn-title">Ethylene experiments - Summary</span><br />
<p><br />
2-Oxoglutarate Oxygenase/Decarboxylase (EFE) is a very powerful enzyme that we successfully characterized. We achieved the following results:<br />
</p><br />
<ul><br />
<li><br />
EFE was expressed under the control of an arabinose inducible promoter in <i>E. coli</i>;<br />
</li><br />
<li><br />
ethylene was detected at the Micro Gas Chromatograph and a quantitative kinetic curve was registered;<br />
</li><br />
<li><br />
EFE was then inserted into a photoinducible promoter and preliminary analysis showed ethylene production (unfortunately also in the dark control);<br />
</li><br />
<li><br />
EFE was inserted into <i>B. subtilis</i> expression vectors, unfortunately ethylene was not detected upon expression;<br />
</li><br />
<li><br />
successfully demonstrated and quantified the presence of ethylene in the jars;<br />
</li> <br />
<li><br />
our system was successfully exploited to accelerate fruit ripening.<br />
</li><br />
</ul><br />
<br/><br />
<br />
<span class="tn-effect">We succeeded in producing ethylene with our system!</span><br />
<span class="tn-effect">Follow our results to discover how we used it to ripen fruit.</span><br />
<img style="width:60%;" src="https://static.igem.org/mediawiki/2013/a/a9/Tn-2013_fruit_exp_pic.jpg" /><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Introduction"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/7/7f/Tn-2013-arr-ETH_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Methyl%20Salicylate"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/b/b9/Tn-2013-arr-ETH_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/8/81/Tn-2013-tour-T_AAA_DSC_0076.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/EthyleneTeam:UNITN-Trento/Project/Ethylene2013-10-04T18:08:32Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Project_pages&amp;action=raw&amp;ctype=text/javascript" type="text/javascript"></script><br />
<br />
<!--PAGE--><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Ethylene</span><br />
<p><br />
EFE (Ethylene Forming Enzyme - 2-Oxoglutarate Oxygenase/Decarboxylase) is our keyplayer in triggering fruit ripening. It catalyzes ethylene synthesis from 2-Oxoglutarate, a TCA cycle intermediate molecule <span class="tn-ref">(Goto M., Plant and Cell Physiology 2012, 26: 141-150)</span>.<br />
</p><br />
<br />
<img class="no-border" src="https://static.igem.org/mediawiki/2013/f/f8/Tn-2013-project_ethylene-Eth_path.jpg" alt="Ethylene pathway" /><br />
<br />
<p><br />
We characterized this gene in two chassis: <i>E. coli</i> and <i>B. subtilis</i>, using different constructs that we designed.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/9/9b/Tn-2013-project_ethylene-BBa_K1065000.jpg" alt="E. coli EFE parts" /><br />
<p><br />
In <i>E. coli</i>, EFE-catalyzed ethylene production was characterized using <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, which is a composed part with EFE under the control of an araC-pBAD promoter.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Ethylene detection</span><br />
<p><br />
Ethylene production was detected using a Micro Gas Chromatograph (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#ethylene-detection-assay">protocol page</a> for the adopted methodology, <b>Figure 1</b>). The instrument was calibrated using two different air mixtures with well-defined quantities of each molecule (carbon dioxide, oxygen and ethylene).<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/c/cf/Tn-2013_EFE_chromatogram.jpg" alt="Ethylene chromatogram" /><br />
<span class="tn-caption"><b>Fig. 1:</b> Ethylene production. <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were grown in a thermoshaker until an O.D. of 0.5, placed in hermetically closed vials with a rubber septum and induced with 5 mM arabinose. Ethylene was measured after 4 hours of induction at 37 °C by connecting the vial to an Agilent Micro GC 3000.</span><br />
<br />
<p><br />
To quantify the amount of ethylene produced the peak integral was converted into ppm.<br />
</p><br />
<br />
<table class="no-bottom" id="ethylene_detected"><br />
<tr><br />
<th class="center"><br />
Sample<br />
</th><br />
<th class="center"><br />
Ethylene detected<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Not induced<br />
</td><br />
<td class="right"><br />
0 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 1.5 ml<br />
</td><br />
<td class="right"><br />
61 ± 15 ppm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Induced V = 3 ml<br />
</td><br />
<td class="right"><br />
101 ± 15 ppm<br />
</td><br />
</tr><br />
</table><br />
<br />
<span class="tn-caption center"><b>Table. 1:</b> ethylene detected quantities.</span><br />
<br />
<span class="tn-sub-subtitle">Kinetic assay for ethylene production</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time (see the <a href="https://2013.igem.org/Team:UNITN-Trento/Protocols#kinetic-ethylene-production">protocol page</a> for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013_kinetic_EFE_plot-2.png" alt="kinetic_EFE_plot" /><br />
<img class="photo no-bottom" src="https://static.igem.org/mediawiki/2013/9/98/Tn-2013_ethylene_kinetic_img.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 2:</b> Ethylene production (ppm) over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a>, induced with 5 mM arabinose at different O.D.600 and cultured in different conditions. The control (not-induced sample) did not show any amount of ethylene.</span><br />
<br />
<p><br />
<b>Figure 2</b> shows that induction of the culture at O.D.600 equal to 0.8 caused a 2-fold increase in ethylene production.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Toxicity test</span><br />
<p><br />
A toxicity test was performed inducing EFE expression with 5 mM arabinose (<b>Figure 3</b>). The growth curve was then compared to a non-induced sample.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/6/6f/Tn-20130627-Efe_Toxicity_test-PLOT.png" alt="Toxicity test plot" /><br />
<span class="tn-caption center"><b>Fig. 3:</b> growth curves of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> and of controls.</span><br />
<br />
<p><br />
As expected, induced samples showed a decreased growth rate.<br />
</p><br />
<br />
<span class="tn-subtitle">EFE under the control of a Blue light circuit in <i>E. coli</i></span><br />
<img src="https://static.igem.org/mediawiki/2013/5/59/BluelightEFE.jpg" alt="e.coli_bluelight-EFE_parts" /><br />
<p><br />
To build our final system we placed EFE under the control of a photoinducible circuit. We assembled the photoinducible circuit exploiting many subparts from different teams (Uppsala 2011 and Berkeley 2006). The construct <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> includes an inverter that allows ethylene production only in presence of light. For more details on the design and characterization of the circuit check the <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue_light"> <b> blue light page </b> </a> of our wiki.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Photoinduced ethylene production - kinetic assay</span><br />
<p><br />
We performed a kinetic assay in order to analyze ethylene production over time using <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> (<b>Figure 4</b>). At an O.D. of 0.7, the culture was transferred to an hermetically closed vial and exposed to a blue light LED (470 nm). This airtight vial was also connected to the micro GC (see the protocol page for the adopted method).<br />
</p><br />
<br />
<div class="tn-doublephoto-wrap"><br />
<img class="plot no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/2/28/Blue_light_EFE_kinetic.png" alt="EFE-blue_light_plot" /><br />
<img class="photo no-bottom" style="height: 300px;" src="https://static.igem.org/mediawiki/2013/d/dc/Tn-2013_bluelight_kinetic.JPG" /><br />
</div><br />
<span class="tn-caption"><b>Fig. 4:</b> Ethylene production (ppm) upon photoinduction with a blue LED light over time (min) of <i>E. coli</i> NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a>.</span><br />
<br />
<br />
When we first obtained these results we were really excited. However, the negative control (dark) showed also some ethylene production. The DNA sequencing also indicated some problems in the construct. We have recently fixed this part, confirmed it by sequencing, and submitted it to the registry. We did not have the possibility yet to test it for ethylene production. However this updated version of <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> is able to produce amilCP when photoinduced. Since the blue reporter correctly appeared only in the induced sample, we think that ethylene could be properly produced. <br><br/><br />
<br />
<img style="width:50%;"src="https://static.igem.org/mediawiki/2013/7/7e/Tn-2013Pelletts.png"/><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5: </b> amilCP production upon photoinduction. <i>E. coli</i> NEB10&beta; tranformed with <a href="http://parts.igem.org/Part:BBa_K1065311">BBa_K1065311</a> were grown in the dark until O.D. 0.6 was reached. The culture was then splitted in two samples and one of them was exposed to a blue LED. The samples were grown overnight and the following morning were pelletted. The image clearly shows how only the photoinduced sample (2) produced amilCP while the control (1) kept in the dark remained white.</span> <br />
<br />
<span class="tn-subtitle">EFE in <i>B. subtilis</i></span><br />
<p><br />
In order to transform <i>B. subtilis</i> with EFE, we decided to exploit two type of vectors designed by the <a href="https://2012.igem.org/Team:LMU-Munich/Data/Vectors">LMU-Munich 2012 iGEM team</a>: pXyl and pSpac. These two vectors were not functionally active: pXyl had a point mutation resulting in a non-transformable vector, and pSpac had a point mutation in the promoter resulting in a non-inducible but constitutive vector. We received from the LMU-Munich team the <b>corrected and functionally active version of both plasmids</b> (functionality was characterized by them).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/8/85/Tn-2013-project_ethylene-BBa_K1065001.jpg" /><br />
<p><br />
EFE was inserted in two <i>B. subtilis</i> plasmids under the control of two different inducible promoters. We tried to express EFE and measure ethylene by GC. However, ethylene was not detected. We are now trying to understand if it is a problem of expression or functionality of the enzyme.<br />
<br />
Interestingly, induced samples showed a distinct smell of sulfur. The presence of sulfur was confirmed by exposure of the culture to a lead acetate paper strip. One hypothesis could be that <i>B. subtilis</i> is capable of converting rapidly ethylene into other mercapto-compounds.<br />
</p><br />
<span class="tn-subtitle">Ethylene diffusion in jars</span><br />
<p><br />
Our ripening machine device is composed of a jar connected to a flask with induced ethylene-producing culture, where the jar contains the fruit to be ripened. A kinetic assay of ethylene in the atmosphere inside our system (jar, connector and flask) was performed by Micro Gas Chromatography and ethylene diffusion from the culture medium was predicted assuming inverse proportionality between detected ethylene and air/culture volume ratio. The estimated data were compared to the results of the kinetic assay as reported in <b>Table 2</b>.<br />
</p><br />
<table><br />
<tr><br />
<th><br />
Jar volume (ml)<br />
</th><br />
<th><br />
Air volume in the jar + connections (ml)<br />
</th><br />
<th><br />
Culture volume (ml)<br />
</th><br />
<th><br />
Air/culture volumes ratio<br />
</th><br />
<th><br />
Concentration Expected<br />
</th> <br />
</tr> <br />
<tr><br />
<td><br />
500 <br />
</td><br />
<td><br />
800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
2.66<br />
</td><br />
<td><br />
150.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1000<br />
</td> <br />
<td><br />
1300<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
4.33<br />
</td><br />
<td><br />
92.37<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
1500<br />
</td> <br />
<td><br />
1800<br />
</td><br />
<td><br />
300<br />
</td><br />
<td><br />
6<br />
</td><br />
<td><br />
66.66<br />
</td><br />
</tr><br />
</table> <br />
<span class="tn-caption center"><b>Table 2:</b> prediction of ethylene diffusion in jars.</span><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013_eth_diff_apparatus.JPG" style="display:inline-block;width:40%;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="photo"/><br />
<img src="https://static.igem.org/mediawiki/2013/a/af/Ethylene_diffusion_in_jars.png" style="display:inline-block;width: 58%;height: 307px;border:2px solid white;box-shadow:2px 2px 4px #323232;" class="plot"/><br />
<span class="tn-caption"><b>Fig 6:</b> In the left panel, experimental set-up for kinetic measurement of ethylene diffusion. In the right panel, comparison between detected and expected ethylene values. 300 ml of NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065001">BBa_K1065001</a> were induced at O.D. 0.5 and placed into a 500 ml flasks connected to a jar. The jar was simultaneusly connected to the Agilent A3000 micro GC, and a measurment was taken every 45 min for about 12 h.</span><br />
<br />
<span class="tn-quote center">Interestingly, we underextimated the ethylene level in the jars!</span><br />
<br />
<br />
<span class="tn-title">Ethylene experiments - Summary</span><br />
<p><br />
2-Oxoglutarate Oxygenase/Decarboxylase (EFE) is a very powerful enzyme that we successfully characterized. We achieved the following results:<br />
</p><br />
<ul><br />
<li><br />
EFE was expressed under the control of an arabinose inducible promoter in <i>E. coli</i>;<br />
</li><br />
<li><br />
ethylene was detected at the Micro Gas Chromatograph and a quantitative kinetic curve was registered;<br />
</li><br />
<li><br />
EFE was then inserted into a photoinducible promoter and preliminary analysis showed ethylene production (unfortunately also in the dark control);<br />
</li><br />
<li><br />
EFE was inserted into <i>B. subtilis</i> expression vectors, unfortunately ethylene was not detected upon expression;<br />
</li><br />
<li><br />
successfully demonstrated and quantified the presence of ethylene in the jars;<br />
</li> <br />
<li><br />
our system was successfully exploited to accelerate fruit ripening.<br />
</li><br />
</ul><br />
<br/><br />
<br />
<span class="tn-effect">We succeeded in producing ethylene with our system!</span><br />
<span class="tn-effect">Follow our results to discover how we used it to ripen fruit.</span><br />
<img style="width:60%;" src="https://static.igem.org/mediawiki/2013/a/a9/Tn-2013_fruit_exp_pic.jpg" /><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Introduction"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/7/7f/Tn-2013-arr-ETH_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Methyl%20Salicylate"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/b/b9/Tn-2013-arr-ETH_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/8/81/Tn-2013-tour-T_AAA_DSC_0076.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Extra/Fruit_InfoTeam:UNITN-Trento/Extra/Fruit Info2013-10-02T18:26:34Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Extra/Fruit_Info?action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Project_pages&amp;action=raw&amp;ctype=text/javascript" type="text/javascript"></script><br />
<br />
<!--PAGE--><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Fruit Info</span><br />
<br />
<span class="tn-subtitle">Do you know how plants produce ethylene?</span><br />
<img class="no-border no-bottom" src="https://static.igem.org/mediawiki/2013/b/bb/Tn-2013-project_ethylene-Plants_path.jpg" /><br />
<p><br />
Plants naturally produce ethylene starting from a common amino acid: methionine (MET), which is transformed in S-adenosyl-methionine (SAM) by a reaction catalyzed by SAM synthetase. The key enzyme of the pathway, ACC synthase, converts SAM to 1-aminocycloprane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Quite recently, the final enzyme of the pathway was identified: ACC oxidase, which converts ACC to ethylene.<br />
</p><br />
<br />
<span class="tn-subtitle">Do you know that ethylene is used commercially to ripen some fruits before they enter the market?</span><br />
<p><br />
All fruit, with a few exceptions (European pears, avocados and bananas), reach their best eating quality when allowed to ripen on the tree or plant. However, some fruits are usually picked mature but unripe, and threated with ethylene during transport or when they arrive at destination, before being brought to the market. Bananas for example are threated with 10 to 100 ppm of ethylene to trigger the ripening process. This approach allows long term storage of fruit and helps the distributors to bring fruit to the consumer.<br />
</p><br />
<br />
<span class="tn-subtitle">Do you know that fruit is generally classified in two main categories?</span><br />
<p><br />
Fruit is generally classified in two main groups: climacteric and non-climacteric.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Climacteric fruit:</span><br />
<p><br />
Some examples are: apples, bananas, pears, melons, apricoats and tomatoes.<br><br />
This kind of fruit presents a characteristic climacteric peak, which consists in an acceleration of both cellular respiration and ethylene production. Depending on the fruit, ethylene can influence all the different steps of the ripening process like colour, pulp texture, flavour... Exogenous ethylene treatment can have an effect on these fruit before the climacteric peak.<br />
</p><br />
<br />
<span class="tn-sub-subtitle">Non-climacteric:</span><br />
<p><br />
Some examples are: strawberries, citrus, oranges, cherries and grapes.<br><br />
This type of fruit have a constant low endogenous production of ethylene with no climacteric peak. Non-climacteric fruit do not respond to exogenous ethylene treatment except for in term of degreening and they should be picked up only when completely ripened in order to mantain all the flavour quality <span class="tn-ref">(Mary Lu Arpaia et Al., Fruit Ripening &amp; Ethylene Management 2010, 3-10)</span>.<br />
</p><br />
<br />
<div id="jms-slideshow" class="jms-slideshow" style="height:250px !important;"><br />
<div id="step-1" style="height:390px !important;" class="step" data-x="0"><br />
<img style="width:100% !important;" src="https://static.igem.org/mediawiki/2013/3/38/Climacteric.jpg"><br />
</div><br />
<div id="step-2" style="height:390px !important;" class="step" data-x="500"><br />
<img style="width:100% !important;" src="https://static.igem.org/mediawiki/2013/5/51/Tn-2013Non_climacteric.jpg"><br />
</div><br />
</div><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Attributions"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/6/6a/Tn-2013-arr-FRINFO_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Human_Practice"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/4/44/Tn-2013-arr-FRINFO_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/e/ef/Tn-2013-headerbg-Sfondogr2.jpg</html>|<html>https://static.igem.org/mediawiki/2013/5/52/Tn-2013-headerbg-Sfondogr2_OR.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/IntroductionTeam:UNITN-Trento/Project/Introduction2013-10-02T18:21:13Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Introduction&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!-- PAGE --><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Introduction</span><br />
<span class="tn-quote"><br />
Have you ever thrown away some bananas because they were too ripe?<br><br />
Are you one of many that hates waiting ages to eat the immature kiwis that you find at the supermarket?<br><br />
Do you know how bananas and other fruits are picked unripe from the tree and arrive to the supermarket ready to be sold and eaten?<br><br />
Have you ever thought about how much fruit is wasted in restaurants, markets, and industry?<br />
</span><br />
<p><br />
We have decided to solve both these problems by designing and engineering a bacterial system able to control fruit's ripening in response to different stimuli: <i>B. fruity</i>.<br />
</p><br />
<p><br />
Furthermore, we have planned two different commercial products in order to eliminate fruit waste and to make its consumption more accessible, even in unusual places like schools and offices: the "<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Vending%20Machine"><i>B. fruity </i>Vending Machine</a>" and the "<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Home%20Edition"><i>B. fruity </i>Home Edition</a>".<br />
</p><br />
<br />
<span class="tn-subtitle">How does B. fruity work?</span><br />
<p><br />
We designed and started to build a genetic circuit that allows our bacteria to synthesize ethylene in order to boost fruit maturation. Ethylene is an horomone naturally produced by fruit and it affects growth, development, ripening, and senescence. <span class="tn-ref">(C. J. Brady, Plant Physiology 1987, 38: 155-178)</span> However, we did not engineer <i>B. fruity</i> to use the complicated ethylene synthesis pathway present in plants, because of the undesirable production of hydrogen cyanide. <span class="tn-ref">(Shang Fa Yang et Al., Plant Physiol. 2001, 126(2): 742–749.)</span> Instead, we decided to follow a different metabolic pathway, present in <i>Pseudomonas syringae</i>, which involves only one enzyme: 2-Oxoglutarate Oxygenase/Decarboxylase, an Ethylene Forming Enzyme (EFE). For more information see the <a href =" https://2013.igem.org/Team:UNITN-Trento/Safety"> <b>Safety Page </b> </a><br />
</p><br />
<p><br />
As ripening inhibitor, we went for methyl salicylate (MeSA): an ester also known as wintergreen oil and naturally produced by many plants as a defense mechanism. It was previously shown to slow down the ripening process in tomatoes, at high concentration (5 mM) <span class="tn-ref">(Chang-Kui Ding et Al., Food Chemistry 2001, 76 213–218)</span>. To achieve its production we used parts submitted by the 2006 MIT iGEM team, as well as others which we built ourselves.<br />
</p><br />
<br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q1">Do you know how plants produce ethylene?</a></span><br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q2">Do you know that ethylene is used commercially to ripen some fruits before they enter the market?</a></span><br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q3">Do you know that fruit is generally classified in two main categories?</a></span><br />
<br />
<span class="tn-subtitle">How is B. fruity activated?</span><br />
<p><br />
We envisioned a system that is coupled to a blue light photoreceptor, the same receptor that has been used previously by other labs and iGEM teams. Our system in the OFF state (no blue light) will produce methyl salicylate and, in the absence of ethylene, will stop unwanted ripening (<b>Figure 2</b>), while in the ON state ( Blue light exposure) it will produce ethylene and repress methyl salicylate production, thus promoting fruit ripening (<b>Figure 2</b>).<br />
</p><br />
<p><br />
Thus far we have succesfully built the device shown in <b>Figure 1</b> plus many other functional genetic constructs that you can find in the <a href="https://2013.igem.org/Team:UNITN-Trento/Parts">Parts page</a>.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/5/5b/Tn-2013_intro_Efe_lineare.jpg"><br />
<span class="tn-caption"><b>Fig. 1:</b> a schematic representation of ethylene production regulated by a photo-inducible circuit. The inverter ensures that in presence of blue Light 2-Oxoglutarate Oxygenase/Decarboxylase (EFE) gene can be expressed.</span><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_intro_Mesa_lineare.jpg"><br />
<span class="tn-caption"><b>Fig. 2:</b> a schematic representation of methyl salicylate production regulated by a photo-repressible circuit. Blue light blocks the blue receptor cassette inducing activity, resulting in the repression of MeSA production.</span><br />
<br />
<p><br />
You can check our <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Datapage">DATA page</a> for a full description of the complete circuit.<br />
</p><br />
<br />
<span class="tn-subtitle">Why B. fruity?</span><br />
<p><br />
We engineered the full system and characterized each component of the system in <i>Escherichia coli</i>. We have also tried to demonstrate the functionality of the enzymes in <i>Bacillus subtilis</i>.<br />
</p><br />
<p><br />
In order to develop a possible commercial product it is more desirable to use a chassis able to survive without nutrients for a longer time: we thought that <i>Bacillus subtilis</i> could fit perfectly our purpose! It can make spores and be easily re-activated by removing the source of stress and adding, for example, water/nutrients. Moreover, <i>B. subtilis</i> is not a human pathogen. Although this bacterium can degrade or contaminate food, with the right precautions this chassis seems to be the best system for our project.<br />
</p><br />
<br />
<span class="tn-effect">Follow our results to discover how we successfully ripen fruit!</span><br />
<img style="width:60%;"src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013_fruit_img_intro.JPG"><br />
<br/><br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/4/47/Tn-2013-arr-HOME_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/d/d0/Tn-2013-arr-HOME_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6a/Tn-2013-tour-F_AAA_DSC_0054.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/IntroductionTeam:UNITN-Trento/Project/Introduction2013-10-02T18:20:18Z<p>TULIO007: </p>
<hr />
<div>{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Introduction&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&amp;action=raw&amp;ctype=text/css" type="text/css"><br />
<br />
<!-- PAGE --><br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Introduction</span><br />
<span class="tn-quote"><br />
Have you ever thrown away some bananas because they were too ripe?<br><br />
Are you one of many that hates waiting ages to eat the immature kiwis that you find at the supermarket?<br><br />
Do you know how bananas and other fruits are picked unripe from the tree and arrive to the supermarket ready to be sold and eaten?<br><br />
Have you ever thought about how much fruit is wasted in restaurants, markets, and industry?<br />
</span><br />
<p><br />
We have decided to solve both these problems by designing and engineering a bacterial system able to control fruit's ripening in response to different stimuli: <i>B. fruity</i>.<br />
</p><br />
<p><br />
Furthermore, we have planned two different commercial products in order to eliminate fruit waste and to make its consumption more accessible, even in unusual places like schools and offices: the "<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Vending%20Machine"><i>B. fruity </i>Vending Machine</a>" and the "<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Home%20Edition"><i>B. fruity </i>Home Edition</a>".<br />
</p><br />
<br />
<span class="tn-subtitle">How does B. fruity work?</span><br />
<p><br />
We designed and started to build a genetic circuit that allows our bacteria to synthesize ethylene in order to boost fruit maturation. Ethylene is an horomone naturally produced by fruit and it affects growth, development, ripening, and senescence. <span class="tn-ref">(C. J. Brady, Plant Physiology 1987, 38: 155-178)</span> However, we did not engineer <i>B. fruity</i> to use the complicated ethylene synthesis pathway present in plants, because of the undesirable production of hydrogen cyanide. <span class="tn-ref">(Shang Fa Yang et Al., Plant Physiol. 2001, 126(2): 742–749.)</span> Instead, we decided to follow a different metabolic pathway, present in <i>Pseudomonas syringae</i>, which involves only one enzyme: 2-Oxoglutarate Oxygenase/Decarboxylase, an Ethylene Forming Enzyme (EFE).For more information see the <a href =" https://2013.igem.org/Team:UNITN-Trento/Safety"> <b>Safety Page </b> </a><br />
</p><br />
<p><br />
As ripening inhibitor, we went for methyl salicylate (MeSA): an ester also known as wintergreen oil and naturally produced by many plants as a defense mechanism. It was previously shown to slow down the ripening process in tomatoes, at high concentration (5 mM) <span class="tn-ref">(Chang-Kui Ding et Al., Food Chemistry 2001, 76 213–218)</span>. To achieve its production we used parts submitted by the 2006 MIT iGEM team, as well as others which we built ourselves.<br />
</p><br />
<br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q1">Do you know how plants produce ethylene?</a></span><br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q2">Do you know that ethylene is used commercially to ripen some fruits before they enter the market?</a></span><br />
<span class="tn-quote-link"><a href="https://2013.igem.org/Team:UNITN-Trento/Fruit_Info#q3">Do you know that fruit is generally classified in two main categories?</a></span><br />
<br />
<span class="tn-subtitle">How is B. fruity activated?</span><br />
<p><br />
We envisioned a system that is coupled to a blue light photoreceptor, the same receptor that has been used previously by other labs and iGEM teams. Our system in the OFF state (no blue light) will produce methyl salicylate and, in the absence of ethylene, will stop unwanted ripening (<b>Figure 2</b>), while in the ON state ( Blue light exposure) it will produce ethylene and repress methyl salicylate production, thus promoting fruit ripening (<b>Figure 2</b>).<br />
</p><br />
<p><br />
Thus far we have succesfully built the device shown in <b>Figure 1</b> plus many other functional genetic constructs that you can find in the <a href="https://2013.igem.org/Team:UNITN-Trento/Parts">Parts page</a>.<br />
</p><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/5/5b/Tn-2013_intro_Efe_lineare.jpg"><br />
<span class="tn-caption"><b>Fig. 1:</b> a schematic representation of ethylene production regulated by a photo-inducible circuit. The inverter ensures that in presence of blue Light 2-Oxoglutarate Oxygenase/Decarboxylase (EFE) gene can be expressed.</span><br />
<br />
<img class="no-bottom" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_intro_Mesa_lineare.jpg"><br />
<span class="tn-caption"><b>Fig. 2:</b> a schematic representation of methyl salicylate production regulated by a photo-repressible circuit. Blue light blocks the blue receptor cassette inducing activity, resulting in the repression of MeSA production.</span><br />
<br />
<p><br />
You can check our <a href="https://2013.igem.org/Team:UNITN-Trento/Project/Datapage">DATA page</a> for a full description of the complete circuit.<br />
</p><br />
<br />
<span class="tn-subtitle">Why B. fruity?</span><br />
<p><br />
We engineered the full system and characterized each component of the system in <i>Escherichia coli</i>. We have also tried to demonstrate the functionality of the enzymes in <i>Bacillus subtilis</i>.<br />
</p><br />
<p><br />
In order to develop a possible commercial product it is more desirable to use a chassis able to survive without nutrients for a longer time: we thought that <i>Bacillus subtilis</i> could fit perfectly our purpose! It can make spores and be easily re-activated by removing the source of stress and adding, for example, water/nutrients. Moreover, <i>B. subtilis</i> is not a human pathogen. Although this bacterium can degrade or contaminate food, with the right precautions this chassis seems to be the best system for our project.<br />
</p><br />
<br />
<span class="tn-effect">Follow our results to discover how we successfully ripen fruit!</span><br />
<img style="width:60%;"src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013_fruit_img_intro.JPG"><br />
<br/><br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/4/47/Tn-2013-arr-HOME_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/d/d0/Tn-2013-arr-HOME_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<a id="tn-sp-tour" href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene#tour"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6a/Tn-2013-tour-F_AAA_DSC_0054.png" /><br />
<span>Continue the tour!</span><br />
</a><br />
<br />
<!--end content--><br />
</html>|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-TrentoTeam:UNITN-Trento2013-10-02T17:37:41Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
<br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!-- CSS --><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Home?action=raw&ctype=text/css" /><br />
<br />
<!-- JS --><br />
<script type="text/javascript" src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Home&action=raw&ctype=text/javascript"></script><br />
<br />
<!-- PAGE --><br />
<div class="pre-footer"><br />
<span class="silhouette"><br />
<img class="photo-1" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-silhouette.png"><br />
<img style="display: none;" class="photo-2" src="https://static.igem.org/mediawiki/2013/2/21/Tn-2013-silhouette-2.png" /><br />
</span><br />
<div class="sheet"><br />
<div class="container"><br />
<p>Hi everybody, our team is proud to introduce you <i>B. fruity</i>!</p><br />
<br />
<p><i>B. fruity</i> envisions a new environmental friendly way to control fruit ripening by exploiting an engineered, light-regulated strain of <i>B. subtilis</i>. The system works by synthesizing ethylene or methyl salicylate (MeSA) upon photoinduction.</p><br />
<br />
<p><b>Ethylene</b> is a plant hormone widely used to ripen fruit. However its synthesis, handling and storage is expensive and dangerous. In contrast, <i>B. fruity</i> produces ethylene from inexpensive material by a metabolic intermediate: 2-oxoglutarate. Our system converts this metabolite to ethylene through the activity of an ethylene forming enzyme (EFE) from <i>Pseudomonas syringae</i>.</p><br />
<br />
<p><i>B. fruity</i> does not just accelerate ripening, but can also slow the process down, when desired, through the incorporation of a <b>methyl salicylate</b> (MeSA) synthesis pathway. MeSA was previously shown to inhibit the ripening of kiwifruit and tomatoes. The explored MeSA pathway builds upon the 2006 MIT iGEM project “<i>Eau de coli</i>”.</p><br />
<br />
<p>As a proof of concept, we engineered <i>E. coli</i> with the above system plus the YF1/FixJ blue light receptor device.</p><br />
<br />
<p>We are hopeful that <i>B. fruity</i> will simplify the process of bringing fresh fruit from the field to the consumer.</p><br />
</div><br />
</div><br />
</div><br />
<br />
<div class="grid"><br />
<div class="column first"><br />
<div class="cell first"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Introduction#tour"></a><br />
</div><br />
<div class="cell second"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Fruit%20ripening"></a><br />
</div><br />
</div><br />
<div class="column second"><br />
<div class="cell first"><br />
<span class="tn-title">Achievements</span><br />
<img class="plasmid" src="https://static.igem.org/mediawiki/2013/b/b6/Tn-2013-home-ach-Plasmids.png" /><br />
<ul class="plasmid"><br />
<li>Built and submitted 16 New BioBricks;</li><br />
<li>Successfully characterized 9 BioBricks;</li><br />
<li>Improved 4 parts;</li><br />
</ul><br />
<img class="human" src="https://static.igem.org/mediawiki/2013/f/f9/Tn-2013-home-ach-Human-Practice_150.png" /><br />
<ul class="human"><br />
<li>Hosted a high school student in the lab for the summer;</li><br />
<li>Asked the opinion of local fruit consumers on our project;</li><br />
</ul><br />
<img class="product" src="https://static.igem.org/mediawiki/2013/f/fb/Tn-2013-home-ach-Products.png" /><br />
<ul class="product"><br />
<li>Designed a fruit Vending Machine and a Home Edition <i>B. fruity</i> market product;</li><br />
</ul><br />
<img class="fruit" src="https://static.igem.org/mediawiki/2013/3/30/Tn-2013-home-ach-Fruit.png" /><br />
<ul class="fruit"><br />
<li>Ripened 5 bananas, 5 tomatoes, 3 kiwis, 2 plums, 2 apples;</li><br />
<li>Eaten one banana bread, one plums crumble and one apple strudel. </li><br />
</ul><br />
</div><br />
</div><br />
<div class="column third"><br />
<div class="cell first"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Vending%20Machine"></a><br />
</div><br />
<div class="cell second"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Extra/Fruit%20Info"></a><br />
</div><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/5/53/Tn-2013-headerbg-Sfondobb.png</html>|<html>https://static.igem.org/mediawiki/2013/d/d2/Tn-2013-headerbg-Sfondobb_or.png</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-02T17:27:41Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see <a href=" https://2013.igem.org/Team:UNITN-Trento/Protocols#MeSA-detection"> here </a> <br />
</p><br />
<br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class = " plot " src = " https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
</div><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 3:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. It was choice to use ethanol to build up the calibration curve because at the beginning we had some problems with the solubility of the methyl salicylate. However, during our experience were also performed many measures to verify the equivalence of using ethanol and LB as matrix for dissolving MeSA. Right panel: GC-FID in aciton </span><br />
<br />
Once obtained the calibration curve, NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 4:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<br />
Once we had all the chromatograms, with the software <i> Finningan Xcalibur® </i>, we were able to obtain directly the MeSA quantities from each bacteria’s samples. Below we have reported the most significant data.<br />
<br />
<img src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
<br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5:</b> Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown). MANCA GRAFICO</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
For the details about how we employed MeSA to block the fruit maturation visit the <a href=" https://2013.igem.org/Team:UNITN-Trento/Project/Fruit_ripening"> <b> Fruit Ripening </b> </a> page.<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-02T17:15:04Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see (<a href=" https://2013.igem.org/Team:UNITN-Trento/Protocols#MeSA-detection"> here </a>) <br />
</p><br />
<br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class = " plot " src = " https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
</div><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 3:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. It was choice to use ethanol to build up the calibration curve because at the beginning we had some problems with the solubility of the methyl salicylate. However, during our experience were also performed many measures to verify the equivalence of using ethanol and LB as matrix for dissolving MeSA. Right panel: GC-FID in aciton </span><br />
<br />
Once obtained the calibration curve, NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 4:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<br />
<img src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
<br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5:</b> Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown). MANCA GRAFICO</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
For the details about how we employed MeSA to block the fruit maturation visit the <a href=" https://2013.igem.org/Team:UNITN-Trento/Project/Fruit_ripening"> <b> Fruit Ripening </b> </a> page.<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-02T17:03:55Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see (<a> href=" https://2013.igem.org/Team:UNITN-Trento/Protocols#MeSA-detection"> here </a>) <br />
</p><br />
<br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class = " plot " src = " https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
</div><br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 3:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. During our experience were also performed many measures to verify the equivalence of using ethanol and LB for dissolving MeSA. .</span><br />
<br />
<br />
NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 4:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
<br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 5:</b> Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown).</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-02T16:53:15Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see (<a> href=" https://2013.igem.org/Team:UNITN-Trento/Protocols#MeSA-detection" here </a>) <br />
</p><br />
<br />
NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 3:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
</div> <br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 4:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. Right panel: Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown).</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
<img src = " https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-01T21:35:14Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see here(<a> href=" https://2013.igem.org/Team:UNITN-Trento/Protocols#MeSA-detection" </a>) <br />
</p><br />
<br />
NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 3:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
</div> <br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 4:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. Right panel: Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown).</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
<img src = " https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
<br />
<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/ProtocolsTeam:UNITN-Trento/Protocols2013-10-01T21:31:47Z<p>TULIO007: </p>
<hr />
<div>__NOTOC__<br />
<br />
{{:Team:UNITN-Trento/Templates/Default|<html><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/CSS/Protocols&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/JS/Protocols&action=raw&ctype=text/javascript"></script><br />
<br />
<!--Protocol page--><br />
<div class="container"><div class="sheet"></html><br />
<br />
<h2>PCRs</h2><br />
<br />
<html><a href="https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator">Tm Calculator (1)</a><br/><br />
<a href="http://eu.idtdna.com/analyzer/applications/oligoanalyzer/">Tm Calculator (2)</a></html><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|RBC Taq DNA Polymerase Protocol V2.0|<html><br />
The optimal conditions for the concentration of RBC Taq DNA Polymerase, MgCl2, primers and template DNA will depend on the system being utilized. It may be necessary to determine the optimal conditions for each individual component.<br/><br />
<br/><br />
1) Add the following components to a sterile microtube on ice:<br/><br />
<table><br />
<tr><br />
<th>Components</th><br />
<th>Volume</th><br />
<th>Final Concentration</th><br />
</tr><br />
<tr><br />
<td>10X Reaction buffer</td><br />
<td>5&micro;l</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>10mM dNTP mix</td><br />
<td>0.5&micro;l</td><br />
<td>0.1&micro;m</td><br />
</tr><br />
<tr><br />
<td>Primer mix (10&micro;M each)</td><br />
<td>1&micro;l</td><br />
<td>0.2&micro;m</td><br />
</tr><br />
<tr><br />
<td>Template DNA</td><br />
<td>0.5&#8275;10&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
<tr><br />
<td>RBC Taq DNA polymerase (5U/&micro;l)</td><br />
<td>0.25&micro;l</td><br />
<td>1.25units</td><br />
</tr><br />
<tr><br />
<td>ddH2O</td><br />
<td>to 50&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
</table><br />
<br/><br />
2) Suggested Reaction Parameters for RBC Taq DNA Polymerase<br/><br />
<table><br />
<tr><br />
<th>Segment</th><br />
<th>Number of cycles</th><br />
<th>Temperature</th><br />
<th>Duration</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>1&#8275;3 minutes</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>25&#8275;35</td><br />
<td><br />
94&deg;C (<i>denature</i>)<br/><br />
5 degree lower than Tm of Primer<br/><br />
72&deg;C (<i>extend</i>)<br />
</td><br />
<td><br />
30 seconds&#8275;1 30<br/><br />
seconds&#8275;1 minute<br/><br />
1minute/Kbp<br />
</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>1</td><br />
<td><br />
72&deg;C<br/><br />
4&deg;C<br />
</td><br />
<td>7 minutes</td><br />
</tr><br />
</table><br />
<br/><br />
3) Analyze the amplification products by agarose gel electrophoresis and visualize by ethidium bromide staining.<br/><br />
<br/><br />
<a href="http://webdownload.rbcbioscience.com/RBC%20Polymerases/DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase%20Protocol%20V2.0.pdf" target="_blank">External link</a><br/><br />
</html>|RBC-Taq-DNA-pol-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Phusion PCR Protocol|<html><br />
<table><br />
<tr><br />
<th><br />
Component<br />
</th><br />
<th><br />
50 &micro;l Reaction<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Nuclease-free water<br />
</td><br />
<td><br />
to 50 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
5X Phusion HF or GC Buffer<br />
</td><br />
<td><br />
10 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 mM dNTPs<br />
</td><br />
<td><br />
1 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Forward Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Reverse Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Template DNA<br />
</td><br />
<td><br />
Variable<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
DMSO (optional)<br />
</td><br />
<td><br />
(1.5 &micro;l)<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Phusion DNA Polymerase<br />
</td><br />
<td><br />
0.5 &micro;l <br />
</td><br />
</tr><br />
</table><br/><br />
<br />
For the template DNA, use 1 &micro;l (50 ng/ &micro;l) of E.coli genomic DNA.<br/><br />
<br/><br />
Set the PCR with the following parameters:<br/><br />
<br/><br />
<br />
<table><br />
<tr><br />
<th>Cycle step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Initial denaturation</td><br />
<td>1</td><br />
<td>98</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>98</td><br />
<td>5-10</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30</td><br />
</tr><br />
<tr><br />
<td>Extention</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30*kb</td><br />
</tr><br />
<tr><br />
<td>Final extention</td><br />
<td>1</td><br />
<td>72</td><br />
<td>5-10 [min]</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&infin;</td><br />
</tr><br />
</table><br />
</html>|Phusion-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|OneTaq + Phu PCR|<html><br />
1) Add the following components in a sterile microtube on ice:<br />
<table><br />
<tr><br />
<th colspan="2"><br />
Reaction Mix<br />
</th><br />
</tr><br />
<tr><br />
<th>5x One Taq Buffer</th><br />
<td>10 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Fwd Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Rev Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>10 mM dNTP's</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>One Taq</th><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Template DNA</th><br />
<td>50-100 ng</td><br />
</tr><br />
<tr><br />
<th>H20</th><br />
<td>up to 50 &micro;l</td><br />
</tr> <br />
</table><br />
<br />
2) Suggested reaction parameters:<br />
<table><br />
<tr><br />
<th>Cycle Step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Inital denaturation</td><br />
<td>1</td><br />
<td>94</td><br />
<td>120</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>94</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td></td><br />
<td>60 *</td><br />
<td>60</td><br />
</tr><br />
<tr><br />
<td>Extension</td><br />
<td></td><br />
<td>68</td><br />
<td>60 s/Kbase</td><br />
</tr><br />
<tr><br />
<td>Final Extension</td><br />
<td>1</td><br />
<td>68</td><br />
<td>300</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&#8734;</td><br />
</tr><br />
</table><br />
</html>|OneTaq-Phu-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Illustra GFX PCR DNA and Gel Band Purification Kit|<html><br />
<ol><br />
<li><br />
Sample Capture:<br />
<ul><br />
<li>Add 250 &micro;l of <i>Capture buffer</i> type 3 to the sample.</li><br />
<li>Mix and control that the color is yellow or pale orange.</li><br />
</ul><br />
</li><br />
<li><br />
Sample Binding:<br />
<ul><br />
<li>Transfer the mix in the assembled <i>GFX MicroSpin column</i> and Collection tube.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Replace <i>GFX MicroSpin column</i> in the same Collection tube.</li><br />
</ul><br />
</li><br />
<li><br />
Wash and Dry:<br />
<ul><br />
<li>Add 500 &micro;l of <i>Wash buffer</i> type 1.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Transfer the <i>GFX MicroSpin column</i> in a clean tube.</li><br />
</ul><br />
</li><br />
<li><br />
Eluition:<br />
<ul><br />
<li>Add 50 &micro;l of distilled water.</li><br />
<li>Incubate for 1 minute at room temperature.</li><br />
<li>Spin for 1 minute at 13000rpm.</li><br />
<li>Retain flowthrough.</li><br />
<li>Quantify the sample at <i>Nanodrop</i> and label it with its concentration.</li><br />
</ul><br />
</li><br />
</ol><br />
<br/><br />
<a href="https://www.gelifesciences.com/gehcls_images/GELS/Related%20Content/Files/1314774443672/litdoc28951562AA_20110831111511.pdf" target="_blank">External protocol</a><br/><br />
<a href="http://www.gelifesciences.com/webapp/wcs/stores/servlet/catalog/en/GELifeSciences/products/AlternativeProductStructure_17513/28903470" target="_blank">External site</a><br/><br />
</html>|Illustra-GFX-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; SV Gel and PCR Clean-Up System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/101/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (136kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (75kb)<br />
</html>|Promega-PCR-Gel}}<br />
<br />
<h2>Cells</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells preparation|<html><br />
<ul><br />
<li>Transformation Buffer: sterile 10 mM Tris-HCl, pH 7.0, 50 mM CaCl2</li><br />
<li>Grow a 50 mL culture in LB at 37 deg C from 1 colony.</li><br />
<li>When OD ~ 0.5, collect the cells in a sterile Falcon tube and chill on ice for 10min.</li><br />
<li>Centrifuge at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 15 mL of transformation buffer.</li><br />
<li>Chill on ice for 15 min. Spin at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 4 mL of transformation buffer.</li><br />
</ul><br />
<br/><br />
The cells are now ready to be transformed. They can be stored in this state at 4 deg C for under a week.<br/><br />
Alternatively, the competent cells can be aliquoted (200&micro;L), adding glycerol to a final conc of 15% (v/v), and the cells stored at –80 deg C.<br/><br />
Every time you make new competent cells you should check for possible contaminations. Plate an aliquot of the new cells in LB plates + antibiotic (i.e. ampicillin, chloramphenicol, kanamycin). Strains such as DH5a, NEB10b, Novablue, should not grow in the presence of antibiotics.<br/><br />
</html>|Competent-cells-prep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation|<html><br />
<b>Competent cells must always stay in ice</b><br />
<ul><br />
<li>Thaw home made CaCl2 competent cells on ice.</li><br />
<li>Add 1&micro;L of DNA to 200&micro;L of competent cells (concentration of DNA stock should be between 50–150 ng/&micro;L).</li><br />
<li>Incubate on ice for 30 min.</li><br />
<li>Heat shock at 42&deg;C for exactly 2 min.</li><br />
<li>Incubate on ice 1 min.</li><br />
<li>Add 500-700&micro;L of LB (or SOC) and shake at 37&deg;C for 1 h.</li><br />
<li>Plate the cells (use plates with the appropriate antibiotic according to your plasmid).</li><br />
</ul><br />
<br/><br />
You can either plate a small amount (200&micro;L) of the cells or more.<br/><br />
You should try a few conditions the first time and then choose the one that gives 30–300 separate colonies.<br/><br />
If few cells are expected: spin down the cells at 2500 rpm, discard supernatant and resuspend in 150–200&micro;L of LB and plate all the cells.<br/><br />
<br/><br />
Plates must be labeled as follow:<br/><br />
strain – [resistance] – part – “(plasmid)” – YOUR_NAME – date<br/><br />
<br/><br />
For ligation you should increase the amount of DNA to be transformed (see cloning protocol).<br/><br />
<ul><li>Incubate the plates O/N upside down at 37&deg;C.</li></ul><br />
<b>!!!Don't plate before four o'clock!!!</b><br/><br />
</html>|Competent-cells-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|B. subtilis transformation (from Groeningen iGEM2013 team)|<html><br />
<span>Prepare the competence medium as follow:</span><br />
<table class="tn-sp-table"><br />
<tr colspan="2"><br />
<th>Competence medium (MC completed)</th><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
1.8 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
10x MC<br />
</td><br />
<TD><br />
200 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
MgSO4 1M<br />
</td><br />
<TD><br />
6.7 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
trp 1% (for trp - strains)<br />
</td><br />
<TD><br />
10 ul<br />
</TD><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2"><br />
MC 10x<br />
</th><br />
</tr><br />
<tr><br />
<td colspan="2"><br />
for 100 ml<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
K2HPO4 3H2O<br />
</td><br />
<TD><br />
14.036 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
KH2PO4<br />
</td><br />
<TD><br />
5.239 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Glucose<br />
</td><br />
<TD><br />
20 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Tri-Na Citrate 300 mM<br />
</td><br />
<TD><br />
10 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Ferric NH4 Citrate<br />
</td><br />
<TD><br />
1 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Casein Hydrolysate<br />
</td><br />
<TD><br />
1 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
K glutamate<br />
</td><br />
<TD><br />
2 g<br />
</TD><br />
</tr><br />
<tr><br />
<td colspan="2">Mix everything in 40-50 ml H2O, then adjust to 100 ml, filter sterilize, freeze at -20 C</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th><br />
Tri-Na Citrate 300mM<br />
</th><br />
<td><br />
8.823 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
Ferric NH4 citrate<br />
</th><br />
<td><br />
2.2 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<td colspan="3"><br />
--> wrap in aluminium foil!!<br />
</td><br />
</tr><br />
</table><br />
<br/><br />
<ol><br />
<li><br />
Pick up a nice big colony and drop it in 2 ml of completed MC (1x) (see below);<br />
</li><br />
<li><br />
Grow at 37 &deg;C for 5 hours (or more if culture is not really turbid);<br />
</li><br />
<li><br />
Mix 400 ul of culture with DNA (usually 1 ug) in fresh tube (i.e. 15 ml tubes losely closed);<br />
</li><br />
<li><br />
Grow for additional 2 h at 37 &deg;C;<br />
</li><br />
<li><br />
Plate all on selective antibiotic plates, and incubate at 37 &deg;C O/N<br />
</li><br />
</ol><br />
</html>|subtilis-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation efficiency kit (registry)|<html><br />
<a href="http://parts.igem.org/Help:Transformation_Efficiency_Kit" target="_blank">External link (registry)</a><br />
</html>|Competent-cells-transformation-efficiency}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Gram Staining Protocol|<html><br />
<ol><br />
<li><br />
Transfer 100 ul of sterile distilled water in an eppendorf;<br />
</li><br />
<li><br />
Pick up a colony using a tip and resuspend it in the sterile water;<br />
</li><br />
<li><br />
Verify that the glass slide is cleaned and degreased or clean it with 70% alcohol;<br />
</li><br />
<li><br />
Transfer 20 ul of bacterial suspension on the slide;<br />
</li><br />
<li><br />
Swipe gently bacterial suspension with the aid of a sterile loop to occupy 1-2 cm at the center of the slide;<br />
</li><br />
<li><br />
Let dry the slide by evaporation;<br />
</li><br />
<li><br />
Cover the central part of the slide with methanol, remove the excess and let it evaporate;<br />
</li><br />
<li><br />
Sock the slide in the crystal violet solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Sock the slide in the lugol solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Pour Gram bleach solution on the product for 20-30 s, wash then with sterile water;<br />
</li><br />
<li><br />
Sock the slide in the safranin solution for 1 min, wash then with sterile water;<br />
</li><br />
<li><br />
Finally let dry the slide and observe it with the microscope.<br />
</li><br />
</ol><br />
</html>|gram-staining}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MNGE medium|<html><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MNGE medium 40 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>10xMN-Medium</td><br />
<td>3,68ml</td><br />
</tr><br />
<tr><br />
<td>Sterile water</td><br />
<td>33,12ml</td><br />
</tr><br />
<tr><br />
<td>Glucose (20%)</td><br />
<td>4ml</td><br />
</tr><br />
<tr><br />
<td>K-Glutamat (40%)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Fe[III]-ammonium-citrate (2,2 mg/ml)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Tryptophan (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
<tr><br />
<td>MgSO4 (1M)</td><br />
<td>120&micro;l</td><br />
</tr><br />
<tr><br />
<td>threonine (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
</table><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MN medium 10X 50 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>K2HPO4 (x3 H2O)</td><br />
<td>6,8 g</td><br />
</tr><br />
<tr><br />
<td>KH2PO4</td><br />
<td>3 g</td><br />
</tr><br />
<tr><br />
<td> Na-citrate (x 2 H2O)</td><br />
<td>0.5 g</td><br />
</tr><br />
</table><br />
<br />
</html>|mnge-medium}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Difco Sporulation Medium (from LMU - Munich iGEM team)|<html><br />
<table><br />
<tr><br />
<td>Nutrienti Broth</td><br />
<td>8 g</td><br />
</tr><br />
<tr><br />
<td>KCl</td><br />
<td>1 g</td><br />
</tr><br />
<tr><br />
<td>MgSO4 1 M</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>MnCl2 10 mM</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>H2O (bidest)</td><br />
<td>ad to 1.000 ml</td><br />
</tr><br />
<tr><br />
<td colspan ="2"> after autoclave add</td><br />
</tr><br />
<tr><br />
<td>CaCl2 1 M</td><br />
<td>0,5 ml</td><br />
</tr><br />
<tr><br />
<td>FeSO4 1 mM</td><br />
<td>1 ml</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
</html>|Difco-Sporulation-Medium}}<br />
<br />
<h2>Miscellaneous</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Parts extraction and transformation (NEB10&beta;).|<html><br />
<ol><br />
<li>Label the empty eppendorfs that will contain the parts, including antibiotic resistance, part denomination and position (and on which kit).</li><br />
<li>Spot the correct well and label it with a pen.</li><br />
<li>Push a hole with the pin of a micropipette and resuspend the content with 10ul water.</li><br />
<li>When the color is dark red, wait 1 minute.</li><br />
<li>Move the re-suspended part into the correct empty eppendorf.</li><br />
</ol><br />
</html>|parts-registry-extraction}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; Plus SV Minipreps DNA Purification System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/0/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (180kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (72kb)<br />
</html>|miniprep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Biobrick cloning|<html><br />
<!--biobrick cloning protocol --><br />
<p><br />
Prepare the digestion mix as follow: <br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
DNA <br />
</td><br />
<td><br />
500 ng<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X NEB Buffer<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X BSA<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E1<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E2<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<td><br />
Up to 25 ul <br />
</td><br />
</tr><br />
</table><br />
<br />
<p><br />
Incubate the reaction mix at 37 &deg;C for 30 min. Disactivate then the enzymes incubating the mix at 80 &deg;C for 20 min.<br />
The next step will be the ligation of the digestion products. The raction mix is prepared as follow:<br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
Insert<br />
</td><br />
<td><br />
3 fold excess<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Vector<br />
</td><br />
<td><br />
40 ng<br />
</td> <br />
</tr><br />
<tr><br />
<td><br />
10X T4 Ligase Buffer<br />
</td><br />
<td><br />
2 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
T4 Ligase<br />
</td><br />
<td><br />
1 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
Up to 20 ul<br />
</TD><br />
</tr><br />
</table><br />
<p><br />
Gently mix the reaction and incubate for 30 min at room temperature. Disactivate the enzymes at 80 &deg;C for 20 min. Transorm 10 ul of the reaction in competent cells.<br />
</p><br />
</html>|biobrick-cloning}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ligation|<html><br />
<br />
Prepare the reaction mix, you can use the automatic calculator.<br/><br />
</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Automatic Calculator|<html><br />
<script type="text/javascript"><br />
/**<br />
*<br />
*/<br />
function ligateCalc() {<br />
//Calculate needed plasmid<br />
insert_need = parseFloat($("input[name=plasmid_need]").val()*$("input[name=insert_length]").val()/$("input[name=plasmid_length]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_need]").text(insert_need);<br />
<br />
//Calculate buffer<br />
buffer = parseFloat($("input[name=total_volume]").val()/$("input[name=buffer_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=buffer]").text(buffer);<br />
<br />
//Calculate plasmid<br />
plasmid = parseFloat($("input[name=plasmid_need]").val()/$("input[name=plasmid_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=plasmid]").text(plasmid);<br />
<br />
//Calculate insert<br />
insert = parseFloat($("td[data-pseudoid=insert_need]").text()/$("input[name=insert_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_one]").text(insert);<br />
$("td[data-pseudoid=insert_two]").text(insert*2);<br />
$("td[data-pseudoid=insert_three]").text(insert*3);<br />
$("td[data-pseudoid=insert_four]").text(insert*4);<br />
<br />
//Calculate water<br />
total_volume = parseFloat($("input[name=total_volume]").val()).toFixed(2);<br />
$("td[data-pseudoid=water_ctrl]").text(parseFloat(total_volume-buffer-plasmid-1).toFixed(2));<br />
$("td[data-pseudoid=water_one]").text(parseFloat(total_volume-buffer-plasmid-1-insert).toFixed(2));<br />
$("td[data-pseudoid=water_two]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*2)).toFixed(2));<br />
$("td[data-pseudoid=water_three]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*3)).toFixed(2));<br />
$("td[data-pseudoid=water_four]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*4)).toFixed(2));<br />
<br />
}<br />
<br />
$(document).ready(function() {<br />
$("#tn-ligation-calc input:text").each(function() {<br />
$(this).change(function(e) {<br />
e.preventDefault();<br />
ligateCalc();<br />
});<br />
});<br />
ligateCalc();<br />
});<br />
</script><br />
<form id="tn-ligation-calc"><table><br />
<tr><br />
<th>Plasmid concentration (ng/&micro;l)</th><br />
<td><input type="text" name="plasmid_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Plasmid length (bp)</th><br />
<td><input type="text" name="plasmid_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert concentration (ng/&micro;l)</th><br />
<td><input type="text" name="insert_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert length (bp)</th><br />
<td><input type="text" name="insert_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Amount of plasmid you want to use (ng)</th><br />
<td><input type="text" name="plasmid_need" value="200" /></td><br />
</tr><br />
<tr><br />
<th>Volume of reaction (&micro;l)</th><br />
<td><input type="text" name="total_volume" value="20" /></td><br />
</tr><br />
<tr><br />
<th>Buffer concentration (X)</th><br />
<td><input type="text" name="buffer_conc" value="10" /></td><br />
</tr><br />
<tr><br />
<th>Amount of insert needed for 1:1 (ng)</th><br />
<td data-pseudoid="insert_need">-</td><br />
</tr><br />
</table><br />
<br/><br />
<center><b>Results</b></center><br />
<table class="results"><br />
<tr><br />
<td style="border: none;">&nbsp;</td><br />
<th>ctrl</th><br />
<th>1:1</th><br />
<th>1:2</th><br />
<th>1:3</th><br />
<th>1:4</th><br />
</tr><br />
<tr><br />
<th>Buffer (&micro;l to have 1X)</th><br />
<td data-pseudoid="buffer" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Plasmid (&micro;l)</th><br />
<td data-pseudoid="plasmid" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Insert (&micro;l)</th><br />
<td>0</td><br />
<td data-pseudoid="insert_one"></td><br />
<td data-pseudoid="insert_two"></td><br />
<td data-pseudoid="insert_three"></td><br />
<td data-pseudoid="insert_four"></td><br />
</tr><br />
<tr><br />
<th>Ligase (&micro;l)</th><br />
<td colspan="5">1</td><br />
</tr><br />
<tr><br />
<th>Water (&micro;l)</th><br />
<td data-pseudoid="water_ctrl"></td><br />
<td data-pseudoid="water_one"></td><br />
<td data-pseudoid="water_two"></td><br />
<td data-pseudoid="water_three"></td><br />
<td data-pseudoid="water_four"></td><br />
</tr><br />
</table></form><br />
</html>}}<html><br />
Prepare your reaction and incubate at RT for 2 hours. Transform half of the reaction into 200μL of “homemade” competent cells (DH5&alpha;, NEB10&beta;, Novablue or other appropriate strains) following a standard transformation protocol. Plate all the cells.<br />
</html>|Ligation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Digestion|<html><br />
Assemble the digestion mix as follow (check the correct buffer with the <a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a>).<br />
<br />
<table><br />
<tr><br />
<td style="border: none;" rowspan="2"></td><br />
<th colspan="2">Classic Cloning</th><br />
<th rowspan="2">Screening</th><br />
</tr><br />
<tr><br />
<th>PCR products</th><br />
<th>Plasmids</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>&#126;3-4&micro;g</td><br />
<td>&#126;2-3&micro;g</td><br />
<td>&#126;1.0&micro;g</td><br />
</tr><br />
<tr><br />
<th>Enzyme 1</th><br />
<td rowspan="2">2.5&micro;l</td><br />
<td rowspan="2">1.5&micro;l</td><br />
<td rowspan="2">1.0&micro;l</td><br />
</tr><br />
<tr><br />
<th>Enzyme 2</th><br />
</tr><br />
<tr><br />
<th>Buffer (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>BSA (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>Up to 100&micro;l</td><br />
<td>Up to 50&micro;l</td><br />
<td>Up to 20&micro;l</td><br />
</tr><br />
</table><br />
<br />
<h4>Classic Cloning - for PCR products</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;l of DpnI and incubate at 37&deg;C for 2 hours. <i>Please note that PCR product must be purified before digestion.</i><br />
<h4>Classic Cloning - for plasmids</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;L of phosphatase (CIP or SAP) to the vector and incubate for 2 hours at 37&deg;C.<br />
<h4>Biobricks Cloning</h4><br />
Incubate at 37&deg;C for 30 minutes. Then disactivate the enzymes at 80&deg;C for 20 minutes.<br />
<h4>Screening</h4><br />
Incubate for 1.5h at 37&deg;C. Run all the digested product on an agarose gel to screen colonies. <br />
<br/><br/><hr/><br/><br />
<a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a><br />
</html>|Digestion}}<br />
<br />
<h2>Details</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|SAMsynthetase extraction from <i>E. coli</i> (strain MG1655) genome|<html><br />
<table><br />
<tr><br />
<th colspan="4">PRIMERS SEQUENCES</th><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>GCCGCTTCTAGAGA AGGAGG AACTACT <b>ATG</b>GCAAAACACCTTTTT</td><br />
<td>prefix(only Xba1) + RBS + spacer + ATG...</td><br />
<td>Tm = 66&deg;C</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>CTGCCGGTCTGAAG TAATAA TACTAGTAGCGGCCGCTGCAG</td><br />
<td>sequence + stop codon + suffix</td><br />
<td>Tm = 67.5&deg;C</td><br />
</tr><br />
</table><br />
<br />
SAMsynthethase gene length = 1155 bp<br><br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><!--riga--><br />
<th><!--colonna-->Solutes</th><br />
<th>Quantities or Concentration</th><br />
</tr><br />
<tr><br />
<td>Template(genome)</td><br />
<td>1ng/ &micro;l</td><br />
</tr><br />
<tr><br />
<td>dNTPs</td><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Buffer RBC</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>Phusion polimerase</td><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<td>RBC Taq polimerase</td><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Water</td><br />
<td>up to 50 &micro;l</td><br />
</tr><br />
</table><br />
<br />
We have chosen to use RBC for its amplification power and Phusion for its proofreading activity<br><br />
<br />
The program set on the PCR is the following:<br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="4">PCR Settings</th><br />
</tr><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>2 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>94&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>62.5&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>1 min 9 s</td><br />
<td>Go to Step 2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>7 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>pause</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
</html>|SAM-extraction-genome-coli}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|pSB1C3 linearization by PCR|<html><br />
This protocol is a Phusion PCR using <b>Suffix Forward</b> and <b>Prefix Reverse</b> primers: in this way it is possible to linearize pSB1C3 removing any insert (like RFP,...). <i>Note: it is advisable to perform the PCR at least in triplicates.</i><br/><br />
<br/><br />
<table><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>50ng (at least 0.50&micro;l)</td><br />
</tr><br />
<tr><br />
<th>HF Buffer</th><br />
<td>10&micro;l</td><br />
</tr><br />
<tr><br />
<th>dNTPs</th><br />
<td>1&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Fw (suff)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Rv (pref)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>up to 50&micro;l</td><br />
</tr><br />
</table><br />
<br/><br />
Given that pSB1C3 is 2070bp long and that the annealing temperature of the primers used is 58&deg;C, the PCR program to be used is the following:<br />
<table><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Type</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>98&deg;C</td><br />
<td>30sec</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>98&deg;C</td><br />
<td>10sec</td><br />
<td>Denaturation</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>58&deg;C</td><br />
<td>20sec</td><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>35sec</td><br />
<td>Extend</td><br />
<td>Go to step #2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>10min</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>&infinit;</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
Then run the PCR samples on a 1% agarose gel to verify the success of the reactions (each sample is prepared with 8&micro;l of PCR reaction and 2&micro;l of 6X loading die; 1kb ladder is good).<br />
</html>|pSB1C3-linearization-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ethylene detection through Micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, the culture was induced with 5 mM arabinose and placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was kept for about 4 hours at 37 &deg;C in thermoshaker. After that the sample was connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measure was then taken.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|ethylene-detection-assay}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Kinetic assay for ethylene production through micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, 3<br />
ml of culture induced with 5 mM arabinose was placed with a stirrer in a sealed vial (V =<br />
15 ml) with a pierceable septum. The sample was then connected to the Micro Gas<br />
Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measurment was taken every 45 min / 1 h in order to get an overview of the time course<br />
of ethylene production.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|kinetic-ethylene-production}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Application of B. fruity on fruit|<html><br />
To test if our system was able to accelerate or to slow down fruit ripening, we designed an ermetically closed jam jar with a rubber hose connector. These jars contained our test-fruit and each one was connected to a flask. The flasks contained 300 ml of induced (or not) culture when its O.D.600 reached 0.8. The flasks contained also a stirrer. The cultures were maintained at 37 &deg;C using a laboratory heating plate connected to a digital thermometer immersed in the culture.<br/><br />
For some days, every morning the culture in the flasks was substituted with a new induced (or not) colture .<br/><br />
Furthermore, canonical jam jars (i.e.: with no connector) were adopted to contain the negative control fruit samples. All the apparatus was put under the chemical hood. <br/><br />
<br/><br />
<center><br />
<i>The apparatus.</i><br/><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/10/Tn-2013_ripenator_apparatus.JPG" width="450px" /><br />
</center><br />
</html>|Bfruity-application}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MeSA Detection|<html><br />
<br />
<B>Sample preparation</B><br />
<p><br />
To detect if <I>E. coli</I> actually produced Methyl salicilate (MeSA), we tried both qualitative (SNIFF Test) and quantitative (GC-MS) tests.<br />
</p><br />
<p><br />
All the measurement have to start by inocula in the correct antibiotics (CM) of MeSA producing cells and of normal Neb10&beta; in LB without antibiotic as control. The inocula need to be growth O/N at 37&deg;C in agitation. The following day, dilutions 1:100 were done in falcons with fresh LB and the same antibiotic; the cells were growth at 37&deg;C in agitation until O.D.600&asymp;0.6 was reached.<br />
</p><br />
<p><br />
Then the cells were induced by adding Arabinose 5mM by a solution 1 M prepared by dissolving 0,150 g in 1 mL of dH2O. After two hours in some of the samples was added Salicylic Acid 2mM by a solution 1 M obtained by dissolving 0,138 g in 1 mL ethanol 70%. Then the culture were put for other 2 hours at 37&deg;C in agitation waiting for the 4 hours of induction to pass.<br />
</p><br />
<p><br />
The tests could also been in M9 medium because it smells less than LB. To do this, when cells in LB reached an O.D. of 400 they were centrifuged at 4100 rpm for 10 minutes to form a pellet. The supernatant was discarded and they were resuspended in fresh M9 medium with the correct antibiotic. This was done because E.coli cells growth in M9 in much more time than in LB. The cells were therefore induced with Arabinose and after two hours SA was added where needed.<br />
</p><br />
At this point the samples were ready for different test.<br />
<br><br />
<br><br />
<B> GC-FID </B><br />
<p><br />
To have a quantitative analysis we used the <i> Finnigan Trace GC ULTRA </i> with a flame ionization detector (FID). To achieve the final results and finally measure the quantity presents in our samples many tries were done with different conditions and methods. For what concerns the results presented in our wiki the column exploited was a DB5-MS capillary with a total length of 30 m (loops), an internal diameter of 0.25 mm and a film of 0.25 μm. </p><br />
<p><br />
The temperature program set for all the analyses was taken from literature <span class="tn-ref"> (Deng, C, et al. Investigation of Tomato Plant Defence Response to Tobacco Mosaic Virus by Determination of Methyl Salicylate with SPME-Capillary GC-MS. Chromatographia. 2004, Vol. 59, 3/4, pp. 263-268) </span> and adapted to our experiment in order to decrease the time of each measurement. In particular the program was set to start with the column at 80°C for 2’, to increase the temperature at the rate of 30°C/min until reaching the temperature of 280°C and maintaining it for 10’. The temperatures of the injector and of the FID were set 280°C. The carrier in the column was He 1.4 mL/min and the flow of the FID was set to be 40 mL/min of H2, 450 mL/min of air and to make up 30 mL/min of N2. The modality of the introduction of the samples in the detector was set to splitless, in particular 70 mL/min. With these setting the retention index of MeSA was between 10.20-10.27 min. </p><br />
<p> <br />
The measuraments were done on liquid (the tries done on the headspace of a standard sample by injection of 1 ul of air were not positive). In particular each bacteria sample was before centrifuged and 1 mL of supernatant was filtrated with a 0.22 μm filter and then 1 μL of each sample was injected in gas chromatography to not damage the instrument. Before and after each injection the syringe was washed with acetone or ethanol for 3 times to eliminate any residual.<br />
</p><br />
<br />
<br />
</html>|MeSA-detection}}<br />
<br />
<html></div></div></html><br />
<br />
|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/ProtocolsTeam:UNITN-Trento/Protocols2013-10-01T21:29:09Z<p>TULIO007: </p>
<hr />
<div>__NOTOC__<br />
<br />
{{:Team:UNITN-Trento/Templates/Default|<html><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/CSS/Protocols&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/JS/Protocols&action=raw&ctype=text/javascript"></script><br />
<br />
<!--Protocol page--><br />
<div class="container"><div class="sheet"></html><br />
<br />
<h2>PCRs</h2><br />
<br />
<html><a href="https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator">Tm Calculator (1)</a><br/><br />
<a href="http://eu.idtdna.com/analyzer/applications/oligoanalyzer/">Tm Calculator (2)</a></html><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|RBC Taq DNA Polymerase Protocol V2.0|<html><br />
The optimal conditions for the concentration of RBC Taq DNA Polymerase, MgCl2, primers and template DNA will depend on the system being utilized. It may be necessary to determine the optimal conditions for each individual component.<br/><br />
<br/><br />
1) Add the following components to a sterile microtube on ice:<br/><br />
<table><br />
<tr><br />
<th>Components</th><br />
<th>Volume</th><br />
<th>Final Concentration</th><br />
</tr><br />
<tr><br />
<td>10X Reaction buffer</td><br />
<td>5&micro;l</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>10mM dNTP mix</td><br />
<td>0.5&micro;l</td><br />
<td>0.1&micro;m</td><br />
</tr><br />
<tr><br />
<td>Primer mix (10&micro;M each)</td><br />
<td>1&micro;l</td><br />
<td>0.2&micro;m</td><br />
</tr><br />
<tr><br />
<td>Template DNA</td><br />
<td>0.5&#8275;10&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
<tr><br />
<td>RBC Taq DNA polymerase (5U/&micro;l)</td><br />
<td>0.25&micro;l</td><br />
<td>1.25units</td><br />
</tr><br />
<tr><br />
<td>ddH2O</td><br />
<td>to 50&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
</table><br />
<br/><br />
2) Suggested Reaction Parameters for RBC Taq DNA Polymerase<br/><br />
<table><br />
<tr><br />
<th>Segment</th><br />
<th>Number of cycles</th><br />
<th>Temperature</th><br />
<th>Duration</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>1&#8275;3 minutes</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>25&#8275;35</td><br />
<td><br />
94&deg;C (<i>denature</i>)<br/><br />
5 degree lower than Tm of Primer<br/><br />
72&deg;C (<i>extend</i>)<br />
</td><br />
<td><br />
30 seconds&#8275;1 30<br/><br />
seconds&#8275;1 minute<br/><br />
1minute/Kbp<br />
</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>1</td><br />
<td><br />
72&deg;C<br/><br />
4&deg;C<br />
</td><br />
<td>7 minutes</td><br />
</tr><br />
</table><br />
<br/><br />
3) Analyze the amplification products by agarose gel electrophoresis and visualize by ethidium bromide staining.<br/><br />
<br/><br />
<a href="http://webdownload.rbcbioscience.com/RBC%20Polymerases/DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase%20Protocol%20V2.0.pdf" target="_blank">External link</a><br/><br />
</html>|RBC-Taq-DNA-pol-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Phusion PCR Protocol|<html><br />
<table><br />
<tr><br />
<th><br />
Component<br />
</th><br />
<th><br />
50 &micro;l Reaction<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Nuclease-free water<br />
</td><br />
<td><br />
to 50 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
5X Phusion HF or GC Buffer<br />
</td><br />
<td><br />
10 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 mM dNTPs<br />
</td><br />
<td><br />
1 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Forward Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Reverse Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Template DNA<br />
</td><br />
<td><br />
Variable<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
DMSO (optional)<br />
</td><br />
<td><br />
(1.5 &micro;l)<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Phusion DNA Polymerase<br />
</td><br />
<td><br />
0.5 &micro;l <br />
</td><br />
</tr><br />
</table><br/><br />
<br />
For the template DNA, use 1 &micro;l (50 ng/ &micro;l) of E.coli genomic DNA.<br/><br />
<br/><br />
Set the PCR with the following parameters:<br/><br />
<br/><br />
<br />
<table><br />
<tr><br />
<th>Cycle step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Initial denaturation</td><br />
<td>1</td><br />
<td>98</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>98</td><br />
<td>5-10</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30</td><br />
</tr><br />
<tr><br />
<td>Extention</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30*kb</td><br />
</tr><br />
<tr><br />
<td>Final extention</td><br />
<td>1</td><br />
<td>72</td><br />
<td>5-10 [min]</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&infin;</td><br />
</tr><br />
</table><br />
</html>|Phusion-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|OneTaq + Phu PCR|<html><br />
1) Add the following components in a sterile microtube on ice:<br />
<table><br />
<tr><br />
<th colspan="2"><br />
Reaction Mix<br />
</th><br />
</tr><br />
<tr><br />
<th>5x One Taq Buffer</th><br />
<td>10 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Fwd Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Rev Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>10 mM dNTP's</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>One Taq</th><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Template DNA</th><br />
<td>50-100 ng</td><br />
</tr><br />
<tr><br />
<th>H20</th><br />
<td>up to 50 &micro;l</td><br />
</tr> <br />
</table><br />
<br />
2) Suggested reaction parameters:<br />
<table><br />
<tr><br />
<th>Cycle Step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Inital denaturation</td><br />
<td>1</td><br />
<td>94</td><br />
<td>120</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>94</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td></td><br />
<td>60 *</td><br />
<td>60</td><br />
</tr><br />
<tr><br />
<td>Extension</td><br />
<td></td><br />
<td>68</td><br />
<td>60 s/Kbase</td><br />
</tr><br />
<tr><br />
<td>Final Extension</td><br />
<td>1</td><br />
<td>68</td><br />
<td>300</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&#8734;</td><br />
</tr><br />
</table><br />
</html>|OneTaq-Phu-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Illustra GFX PCR DNA and Gel Band Purification Kit|<html><br />
<ol><br />
<li><br />
Sample Capture:<br />
<ul><br />
<li>Add 250 &micro;l of <i>Capture buffer</i> type 3 to the sample.</li><br />
<li>Mix and control that the color is yellow or pale orange.</li><br />
</ul><br />
</li><br />
<li><br />
Sample Binding:<br />
<ul><br />
<li>Transfer the mix in the assembled <i>GFX MicroSpin column</i> and Collection tube.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Replace <i>GFX MicroSpin column</i> in the same Collection tube.</li><br />
</ul><br />
</li><br />
<li><br />
Wash and Dry:<br />
<ul><br />
<li>Add 500 &micro;l of <i>Wash buffer</i> type 1.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Transfer the <i>GFX MicroSpin column</i> in a clean tube.</li><br />
</ul><br />
</li><br />
<li><br />
Eluition:<br />
<ul><br />
<li>Add 50 &micro;l of distilled water.</li><br />
<li>Incubate for 1 minute at room temperature.</li><br />
<li>Spin for 1 minute at 13000rpm.</li><br />
<li>Retain flowthrough.</li><br />
<li>Quantify the sample at <i>Nanodrop</i> and label it with its concentration.</li><br />
</ul><br />
</li><br />
</ol><br />
<br/><br />
<a href="https://www.gelifesciences.com/gehcls_images/GELS/Related%20Content/Files/1314774443672/litdoc28951562AA_20110831111511.pdf" target="_blank">External protocol</a><br/><br />
<a href="http://www.gelifesciences.com/webapp/wcs/stores/servlet/catalog/en/GELifeSciences/products/AlternativeProductStructure_17513/28903470" target="_blank">External site</a><br/><br />
</html>|Illustra-GFX-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; SV Gel and PCR Clean-Up System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/101/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (136kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (75kb)<br />
</html>|Promega-PCR-Gel}}<br />
<br />
<h2>Cells</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells preparation|<html><br />
<ul><br />
<li>Transformation Buffer: sterile 10 mM Tris-HCl, pH 7.0, 50 mM CaCl2</li><br />
<li>Grow a 50 mL culture in LB at 37 deg C from 1 colony.</li><br />
<li>When OD ~ 0.5, collect the cells in a sterile Falcon tube and chill on ice for 10min.</li><br />
<li>Centrifuge at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 15 mL of transformation buffer.</li><br />
<li>Chill on ice for 15 min. Spin at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 4 mL of transformation buffer.</li><br />
</ul><br />
<br/><br />
The cells are now ready to be transformed. They can be stored in this state at 4 deg C for under a week.<br/><br />
Alternatively, the competent cells can be aliquoted (200&micro;L), adding glycerol to a final conc of 15% (v/v), and the cells stored at –80 deg C.<br/><br />
Every time you make new competent cells you should check for possible contaminations. Plate an aliquot of the new cells in LB plates + antibiotic (i.e. ampicillin, chloramphenicol, kanamycin). Strains such as DH5a, NEB10b, Novablue, should not grow in the presence of antibiotics.<br/><br />
</html>|Competent-cells-prep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation|<html><br />
<b>Competent cells must always stay in ice</b><br />
<ul><br />
<li>Thaw home made CaCl2 competent cells on ice.</li><br />
<li>Add 1&micro;L of DNA to 200&micro;L of competent cells (concentration of DNA stock should be between 50–150 ng/&micro;L).</li><br />
<li>Incubate on ice for 30 min.</li><br />
<li>Heat shock at 42&deg;C for exactly 2 min.</li><br />
<li>Incubate on ice 1 min.</li><br />
<li>Add 500-700&micro;L of LB (or SOC) and shake at 37&deg;C for 1 h.</li><br />
<li>Plate the cells (use plates with the appropriate antibiotic according to your plasmid).</li><br />
</ul><br />
<br/><br />
You can either plate a small amount (200&micro;L) of the cells or more.<br/><br />
You should try a few conditions the first time and then choose the one that gives 30–300 separate colonies.<br/><br />
If few cells are expected: spin down the cells at 2500 rpm, discard supernatant and resuspend in 150–200&micro;L of LB and plate all the cells.<br/><br />
<br/><br />
Plates must be labeled as follow:<br/><br />
strain – [resistance] – part – “(plasmid)” – YOUR_NAME – date<br/><br />
<br/><br />
For ligation you should increase the amount of DNA to be transformed (see cloning protocol).<br/><br />
<ul><li>Incubate the plates O/N upside down at 37&deg;C.</li></ul><br />
<b>!!!Don't plate before four o'clock!!!</b><br/><br />
</html>|Competent-cells-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|B. subtilis transformation (from Groeningen iGEM2013 team)|<html><br />
<span>Prepare the competence medium as follow:</span><br />
<table class="tn-sp-table"><br />
<tr colspan="2"><br />
<th>Competence medium (MC completed)</th><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
1.8 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
10x MC<br />
</td><br />
<TD><br />
200 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
MgSO4 1M<br />
</td><br />
<TD><br />
6.7 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
trp 1% (for trp - strains)<br />
</td><br />
<TD><br />
10 ul<br />
</TD><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2"><br />
MC 10x<br />
</th><br />
</tr><br />
<tr><br />
<td colspan="2"><br />
for 100 ml<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
K2HPO4 3H2O<br />
</td><br />
<TD><br />
14.036 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
KH2PO4<br />
</td><br />
<TD><br />
5.239 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Glucose<br />
</td><br />
<TD><br />
20 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Tri-Na Citrate 300 mM<br />
</td><br />
<TD><br />
10 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Ferric NH4 Citrate<br />
</td><br />
<TD><br />
1 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Casein Hydrolysate<br />
</td><br />
<TD><br />
1 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
K glutamate<br />
</td><br />
<TD><br />
2 g<br />
</TD><br />
</tr><br />
<tr><br />
<td colspan="2">Mix everything in 40-50 ml H2O, then adjust to 100 ml, filter sterilize, freeze at -20 C</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th><br />
Tri-Na Citrate 300mM<br />
</th><br />
<td><br />
8.823 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
Ferric NH4 citrate<br />
</th><br />
<td><br />
2.2 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<td colspan="3"><br />
--> wrap in aluminium foil!!<br />
</td><br />
</tr><br />
</table><br />
<br/><br />
<ol><br />
<li><br />
Pick up a nice big colony and drop it in 2 ml of completed MC (1x) (see below);<br />
</li><br />
<li><br />
Grow at 37 &deg;C for 5 hours (or more if culture is not really turbid);<br />
</li><br />
<li><br />
Mix 400 ul of culture with DNA (usually 1 ug) in fresh tube (i.e. 15 ml tubes losely closed);<br />
</li><br />
<li><br />
Grow for additional 2 h at 37 &deg;C;<br />
</li><br />
<li><br />
Plate all on selective antibiotic plates, and incubate at 37 &deg;C O/N<br />
</li><br />
</ol><br />
</html>|subtilis-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation efficiency kit (registry)|<html><br />
<a href="http://parts.igem.org/Help:Transformation_Efficiency_Kit" target="_blank">External link (registry)</a><br />
</html>|Competent-cells-transformation-efficiency}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Gram Staining Protocol|<html><br />
<ol><br />
<li><br />
Transfer 100 ul of sterile distilled water in an eppendorf;<br />
</li><br />
<li><br />
Pick up a colony using a tip and resuspend it in the sterile water;<br />
</li><br />
<li><br />
Verify that the glass slide is cleaned and degreased or clean it with 70% alcohol;<br />
</li><br />
<li><br />
Transfer 20 ul of bacterial suspension on the slide;<br />
</li><br />
<li><br />
Swipe gently bacterial suspension with the aid of a sterile loop to occupy 1-2 cm at the center of the slide;<br />
</li><br />
<li><br />
Let dry the slide by evaporation;<br />
</li><br />
<li><br />
Cover the central part of the slide with methanol, remove the excess and let it evaporate;<br />
</li><br />
<li><br />
Sock the slide in the crystal violet solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Sock the slide in the lugol solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Pour Gram bleach solution on the product for 20-30 s, wash then with sterile water;<br />
</li><br />
<li><br />
Sock the slide in the safranin solution for 1 min, wash then with sterile water;<br />
</li><br />
<li><br />
Finally let dry the slide and observe it with the microscope.<br />
</li><br />
</ol><br />
</html>|gram-staining}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MNGE medium|<html><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MNGE medium 40 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>10xMN-Medium</td><br />
<td>3,68ml</td><br />
</tr><br />
<tr><br />
<td>Sterile water</td><br />
<td>33,12ml</td><br />
</tr><br />
<tr><br />
<td>Glucose (20%)</td><br />
<td>4ml</td><br />
</tr><br />
<tr><br />
<td>K-Glutamat (40%)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Fe[III]-ammonium-citrate (2,2 mg/ml)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Tryptophan (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
<tr><br />
<td>MgSO4 (1M)</td><br />
<td>120&micro;l</td><br />
</tr><br />
<tr><br />
<td>threonine (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
</table><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MN medium 10X 50 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>K2HPO4 (x3 H2O)</td><br />
<td>6,8 g</td><br />
</tr><br />
<tr><br />
<td>KH2PO4</td><br />
<td>3 g</td><br />
</tr><br />
<tr><br />
<td> Na-citrate (x 2 H2O)</td><br />
<td>0.5 g</td><br />
</tr><br />
</table><br />
<br />
</html>|mnge-medium}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Difco Sporulation Medium (from LMU - Munich iGEM team)|<html><br />
<table><br />
<tr><br />
<td>Nutrienti Broth</td><br />
<td>8 g</td><br />
</tr><br />
<tr><br />
<td>KCl</td><br />
<td>1 g</td><br />
</tr><br />
<tr><br />
<td>MgSO4 1 M</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>MnCl2 10 mM</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>H2O (bidest)</td><br />
<td>ad to 1.000 ml</td><br />
</tr><br />
<tr><br />
<td colspan ="2"> after autoclave add</td><br />
</tr><br />
<tr><br />
<td>CaCl2 1 M</td><br />
<td>0,5 ml</td><br />
</tr><br />
<tr><br />
<td>FeSO4 1 mM</td><br />
<td>1 ml</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
</html>|Difco-Sporulation-Medium}}<br />
<br />
<h2>Miscellaneous</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Parts extraction and transformation (NEB10&beta;).|<html><br />
<ol><br />
<li>Label the empty eppendorfs that will contain the parts, including antibiotic resistance, part denomination and position (and on which kit).</li><br />
<li>Spot the correct well and label it with a pen.</li><br />
<li>Push a hole with the pin of a micropipette and resuspend the content with 10ul water.</li><br />
<li>When the color is dark red, wait 1 minute.</li><br />
<li>Move the re-suspended part into the correct empty eppendorf.</li><br />
</ol><br />
</html>|parts-registry-extraction}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; Plus SV Minipreps DNA Purification System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/0/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (180kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (72kb)<br />
</html>|miniprep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Biobrick cloning|<html><br />
<!--biobrick cloning protocol --><br />
<p><br />
Prepare the digestion mix as follow: <br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
DNA <br />
</td><br />
<td><br />
500 ng<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X NEB Buffer<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X BSA<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E1<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E2<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<td><br />
Up to 25 ul <br />
</td><br />
</tr><br />
</table><br />
<br />
<p><br />
Incubate the reaction mix at 37 &deg;C for 30 min. Disactivate then the enzymes incubating the mix at 80 &deg;C for 20 min.<br />
The next step will be the ligation of the digestion products. The raction mix is prepared as follow:<br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
Insert<br />
</td><br />
<td><br />
3 fold excess<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Vector<br />
</td><br />
<td><br />
40 ng<br />
</td> <br />
</tr><br />
<tr><br />
<td><br />
10X T4 Ligase Buffer<br />
</td><br />
<td><br />
2 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
T4 Ligase<br />
</td><br />
<td><br />
1 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
Up to 20 ul<br />
</TD><br />
</tr><br />
</table><br />
<p><br />
Gently mix the reaction and incubate for 30 min at room temperature. Disactivate the enzymes at 80 &deg;C for 20 min. Transorm 10 ul of the reaction in competent cells.<br />
</p><br />
</html>|biobrick-cloning}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ligation|<html><br />
<br />
Prepare the reaction mix, you can use the automatic calculator.<br/><br />
</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Automatic Calculator|<html><br />
<script type="text/javascript"><br />
/**<br />
*<br />
*/<br />
function ligateCalc() {<br />
//Calculate needed plasmid<br />
insert_need = parseFloat($("input[name=plasmid_need]").val()*$("input[name=insert_length]").val()/$("input[name=plasmid_length]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_need]").text(insert_need);<br />
<br />
//Calculate buffer<br />
buffer = parseFloat($("input[name=total_volume]").val()/$("input[name=buffer_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=buffer]").text(buffer);<br />
<br />
//Calculate plasmid<br />
plasmid = parseFloat($("input[name=plasmid_need]").val()/$("input[name=plasmid_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=plasmid]").text(plasmid);<br />
<br />
//Calculate insert<br />
insert = parseFloat($("td[data-pseudoid=insert_need]").text()/$("input[name=insert_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_one]").text(insert);<br />
$("td[data-pseudoid=insert_two]").text(insert*2);<br />
$("td[data-pseudoid=insert_three]").text(insert*3);<br />
$("td[data-pseudoid=insert_four]").text(insert*4);<br />
<br />
//Calculate water<br />
total_volume = parseFloat($("input[name=total_volume]").val()).toFixed(2);<br />
$("td[data-pseudoid=water_ctrl]").text(parseFloat(total_volume-buffer-plasmid-1).toFixed(2));<br />
$("td[data-pseudoid=water_one]").text(parseFloat(total_volume-buffer-plasmid-1-insert).toFixed(2));<br />
$("td[data-pseudoid=water_two]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*2)).toFixed(2));<br />
$("td[data-pseudoid=water_three]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*3)).toFixed(2));<br />
$("td[data-pseudoid=water_four]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*4)).toFixed(2));<br />
<br />
}<br />
<br />
$(document).ready(function() {<br />
$("#tn-ligation-calc input:text").each(function() {<br />
$(this).change(function(e) {<br />
e.preventDefault();<br />
ligateCalc();<br />
});<br />
});<br />
ligateCalc();<br />
});<br />
</script><br />
<form id="tn-ligation-calc"><table><br />
<tr><br />
<th>Plasmid concentration (ng/&micro;l)</th><br />
<td><input type="text" name="plasmid_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Plasmid length (bp)</th><br />
<td><input type="text" name="plasmid_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert concentration (ng/&micro;l)</th><br />
<td><input type="text" name="insert_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert length (bp)</th><br />
<td><input type="text" name="insert_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Amount of plasmid you want to use (ng)</th><br />
<td><input type="text" name="plasmid_need" value="200" /></td><br />
</tr><br />
<tr><br />
<th>Volume of reaction (&micro;l)</th><br />
<td><input type="text" name="total_volume" value="20" /></td><br />
</tr><br />
<tr><br />
<th>Buffer concentration (X)</th><br />
<td><input type="text" name="buffer_conc" value="10" /></td><br />
</tr><br />
<tr><br />
<th>Amount of insert needed for 1:1 (ng)</th><br />
<td data-pseudoid="insert_need">-</td><br />
</tr><br />
</table><br />
<br/><br />
<center><b>Results</b></center><br />
<table class="results"><br />
<tr><br />
<td style="border: none;">&nbsp;</td><br />
<th>ctrl</th><br />
<th>1:1</th><br />
<th>1:2</th><br />
<th>1:3</th><br />
<th>1:4</th><br />
</tr><br />
<tr><br />
<th>Buffer (&micro;l to have 1X)</th><br />
<td data-pseudoid="buffer" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Plasmid (&micro;l)</th><br />
<td data-pseudoid="plasmid" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Insert (&micro;l)</th><br />
<td>0</td><br />
<td data-pseudoid="insert_one"></td><br />
<td data-pseudoid="insert_two"></td><br />
<td data-pseudoid="insert_three"></td><br />
<td data-pseudoid="insert_four"></td><br />
</tr><br />
<tr><br />
<th>Ligase (&micro;l)</th><br />
<td colspan="5">1</td><br />
</tr><br />
<tr><br />
<th>Water (&micro;l)</th><br />
<td data-pseudoid="water_ctrl"></td><br />
<td data-pseudoid="water_one"></td><br />
<td data-pseudoid="water_two"></td><br />
<td data-pseudoid="water_three"></td><br />
<td data-pseudoid="water_four"></td><br />
</tr><br />
</table></form><br />
</html>}}<html><br />
Prepare your reaction and incubate at RT for 2 hours. Transform half of the reaction into 200μL of “homemade” competent cells (DH5&alpha;, NEB10&beta;, Novablue or other appropriate strains) following a standard transformation protocol. Plate all the cells.<br />
</html>|Ligation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Digestion|<html><br />
Assemble the digestion mix as follow (check the correct buffer with the <a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a>).<br />
<br />
<table><br />
<tr><br />
<td style="border: none;" rowspan="2"></td><br />
<th colspan="2">Classic Cloning</th><br />
<th rowspan="2">Screening</th><br />
</tr><br />
<tr><br />
<th>PCR products</th><br />
<th>Plasmids</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>&#126;3-4&micro;g</td><br />
<td>&#126;2-3&micro;g</td><br />
<td>&#126;1.0&micro;g</td><br />
</tr><br />
<tr><br />
<th>Enzyme 1</th><br />
<td rowspan="2">2.5&micro;l</td><br />
<td rowspan="2">1.5&micro;l</td><br />
<td rowspan="2">1.0&micro;l</td><br />
</tr><br />
<tr><br />
<th>Enzyme 2</th><br />
</tr><br />
<tr><br />
<th>Buffer (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>BSA (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>Up to 100&micro;l</td><br />
<td>Up to 50&micro;l</td><br />
<td>Up to 20&micro;l</td><br />
</tr><br />
</table><br />
<br />
<h4>Classic Cloning - for PCR products</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;l of DpnI and incubate at 37&deg;C for 2 hours. <i>Please note that PCR product must be purified before digestion.</i><br />
<h4>Classic Cloning - for plasmids</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;L of phosphatase (CIP or SAP) to the vector and incubate for 2 hours at 37&deg;C.<br />
<h4>Biobricks Cloning</h4><br />
Incubate at 37&deg;C for 30 minutes. Then disactivate the enzymes at 80&deg;C for 20 minutes.<br />
<h4>Screening</h4><br />
Incubate for 1.5h at 37&deg;C. Run all the digested product on an agarose gel to screen colonies. <br />
<br/><br/><hr/><br/><br />
<a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a><br />
</html>|Digestion}}<br />
<br />
<h2>Details</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|SAMsynthetase extraction from <i>E. coli</i> (strain MG1655) genome|<html><br />
<table><br />
<tr><br />
<th colspan="4">PRIMERS SEQUENCES</th><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>GCCGCTTCTAGAGA AGGAGG AACTACT <b>ATG</b>GCAAAACACCTTTTT</td><br />
<td>prefix(only Xba1) + RBS + spacer + ATG...</td><br />
<td>Tm = 66&deg;C</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>CTGCCGGTCTGAAG TAATAA TACTAGTAGCGGCCGCTGCAG</td><br />
<td>sequence + stop codon + suffix</td><br />
<td>Tm = 67.5&deg;C</td><br />
</tr><br />
</table><br />
<br />
SAMsynthethase gene length = 1155 bp<br><br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><!--riga--><br />
<th><!--colonna-->Solutes</th><br />
<th>Quantities or Concentration</th><br />
</tr><br />
<tr><br />
<td>Template(genome)</td><br />
<td>1ng/ &micro;l</td><br />
</tr><br />
<tr><br />
<td>dNTPs</td><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Buffer RBC</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>Phusion polimerase</td><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<td>RBC Taq polimerase</td><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Water</td><br />
<td>up to 50 &micro;l</td><br />
</tr><br />
</table><br />
<br />
We have chosen to use RBC for its amplification power and Phusion for its proofreading activity<br><br />
<br />
The program set on the PCR is the following:<br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="4">PCR Settings</th><br />
</tr><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>2 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>94&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>62.5&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>1 min 9 s</td><br />
<td>Go to Step 2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>7 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>pause</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
</html>|SAM-extraction-genome-coli}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|pSB1C3 linearization by PCR|<html><br />
This protocol is a Phusion PCR using <b>Suffix Forward</b> and <b>Prefix Reverse</b> primers: in this way it is possible to linearize pSB1C3 removing any insert (like RFP,...). <i>Note: it is advisable to perform the PCR at least in triplicates.</i><br/><br />
<br/><br />
<table><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>50ng (at least 0.50&micro;l)</td><br />
</tr><br />
<tr><br />
<th>HF Buffer</th><br />
<td>10&micro;l</td><br />
</tr><br />
<tr><br />
<th>dNTPs</th><br />
<td>1&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Fw (suff)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Rv (pref)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>up to 50&micro;l</td><br />
</tr><br />
</table><br />
<br/><br />
Given that pSB1C3 is 2070bp long and that the annealing temperature of the primers used is 58&deg;C, the PCR program to be used is the following:<br />
<table><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Type</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>98&deg;C</td><br />
<td>30sec</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>98&deg;C</td><br />
<td>10sec</td><br />
<td>Denaturation</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>58&deg;C</td><br />
<td>20sec</td><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>35sec</td><br />
<td>Extend</td><br />
<td>Go to step #2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>10min</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>&infinit;</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
Then run the PCR samples on a 1% agarose gel to verify the success of the reactions (each sample is prepared with 8&micro;l of PCR reaction and 2&micro;l of 6X loading die; 1kb ladder is good).<br />
</html>|pSB1C3-linearization-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ethylene detection through Micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, the culture was induced with 5 mM arabinose and placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was kept for about 4 hours at 37 &deg;C in thermoshaker. After that the sample was connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measure was then taken.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|ethylene-detection-assay}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Kinetic assay for ethylene production through micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, 3<br />
ml of culture induced with 5 mM arabinose was placed with a stirrer in a sealed vial (V =<br />
15 ml) with a pierceable septum. The sample was then connected to the Micro Gas<br />
Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measurment was taken every 45 min / 1 h in order to get an overview of the time course<br />
of ethylene production.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|kinetic-ethylene-production}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Application of B. fruity on fruit|<html><br />
To test if our system was able to accelerate or to slow down fruit ripening, we designed an ermetically closed jam jar with a rubber hose connector. These jars contained our test-fruit and each one was connected to a flask. The flasks contained 300 ml of induced (or not) culture when its O.D.600 reached 0.8. The flasks contained also a stirrer. The cultures were maintained at 37 &deg;C using a laboratory heating plate connected to a digital thermometer immersed in the culture.<br/><br />
For some days, every morning the culture in the flasks was substituted with a new induced (or not) colture .<br/><br />
Furthermore, canonical jam jars (i.e.: with no connector) were adopted to contain the negative control fruit samples. All the apparatus was put under the chemical hood. <br/><br />
<br/><br />
<center><br />
<i>The apparatus.</i><br/><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/10/Tn-2013_ripenator_apparatus.JPG" width="450px" /><br />
</center><br />
</html>|Bfruity-application}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MeSA Detection|<html><br />
<br />
<B>Sample preparation</B><br />
<p><br />
To detect if <I>E. coli</I> actually produced Methyl salicilate (MeSA), we tried both qualitative (SNIFF Test) and quantitative (GC-MS) tests.<br />
</p><br />
<p><br />
All the measurement have to start by inocula in the correct antibiotics (CM) of MeSA producing cells and of normal Neb10&beta; in LB without antibiotic as control. The inocula need to be growth O/N at 37&deg;C in agitation. The following day, dilutions 1:100 were done in falcons with fresh LB and the same antibiotic; the cells were growth at 37&deg;C in agitation until O.D.600&asymp;0.6 was reached.<br />
</p><br />
<p><br />
Then the cells were induced by adding Arabinose 5mM by a solution 1 M prepared by dissolving 0,150 g in 1 mL of dH2O. After two hours in some of the samples was added Salicylic Acid 2mM by a solution 1 M obtained by dissolving 0,138 g in 1 mL ethanol 70%. Then the culture were put for other 2 hours at 37&deg;C in agitation waiting for the 4 hours of induction to pass.<br />
</p><br />
<p><br />
The tests could also been in M9 medium because it smells less than LB. To do this, when cells in LB reached an O.D. of 400 they were centrifuged at 4100 rpm for 10 minutes to form a pellet. The supernatant was discarded and they were resuspended in fresh M9 medium with the correct antibiotic. This was done because E.coli cells growth in M9 in much more time than in LB. The cells were therefore induced with Arabinose and after two hours SA was added where needed.<br />
</p><br />
At this point the samples were ready for different test.<br />
<br><br />
<B> GC-FID </B><br />
<p><br />
To have a quantitative analysis we used the <i> Finnigan Trace GC ULTRA </i> with a flame ionization detector (FID). To achieve the final results and finally measure the quantity presents in our samples many tries were done with different conditions and methods. For what concerns the results presented in our wiki the column exploited was a DB5-MS capillary with a total length of 30 m (loops), an internal diameter of 0.25 mm and a film of 0.25 μm. </p><br />
<p><br />
The temperature program set for all the analyses was taken from literature <span class="tn-ref"> (Deng, C, et al. Investigation of Tomato Plant Defence Response to Tobacco Mosaic Virus by Determination of Methyl Salicylate with SPME-Capillary GC-MS. Chromatographia. 2004, Vol. 59, 3/4, pp. 263-268) </span> and adapted to our experiment in order to decrease the time of each measurement. In particular the program was set to start with the column at 80°C for 2’, to increase the temperature at the rate of 30°C/min until reaching the temperature of 280°C and maintaining it for 10’. The temperatures of the injector and of the FID were set 280°C. The carrier in the column was He 1.4 mL/min and the flow of the FID was set to be 40 mL/min of H2, 450 mL/min of air and to make up 30 mL/min of N2. The modality of the introduction of the samples in the detector was set to splitless, in particular 70 mL/min. With these setting the retention index of MeSA was between 10.20-10.27 min. </p><br />
<p> <br />
The measuraments were done on liquid (the tries done on the headspace of a standard sample by injection of 1 ul of air were not positive). In particular each bacteria sample was before centrifuged and 1 mL of supernatant was filtrated with a 0.22 μm filter and then 1 μL of each sample was injected in gas chromatography to not damage the instrument. Before and after each injection the syringe was washed with acetone or ethanol for 3 times to eliminate any residual.<br />
</p><br />
<br />
<br />
</html>|MeSA-detection}}<br />
<br />
<html></div></div></html><br />
<br />
|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/ProtocolsTeam:UNITN-Trento/Protocols2013-10-01T21:26:46Z<p>TULIO007: </p>
<hr />
<div>__NOTOC__<br />
<br />
{{:Team:UNITN-Trento/Templates/Default|<html><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/CSS/Protocols&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/JS/Protocols&action=raw&ctype=text/javascript"></script><br />
<br />
<!--Protocol page--><br />
<div class="container"><div class="sheet"></html><br />
<br />
<h2>PCRs</h2><br />
<br />
<html><a href="https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator">Tm Calculator (1)</a><br/><br />
<a href="http://eu.idtdna.com/analyzer/applications/oligoanalyzer/">Tm Calculator (2)</a></html><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|RBC Taq DNA Polymerase Protocol V2.0|<html><br />
The optimal conditions for the concentration of RBC Taq DNA Polymerase, MgCl2, primers and template DNA will depend on the system being utilized. It may be necessary to determine the optimal conditions for each individual component.<br/><br />
<br/><br />
1) Add the following components to a sterile microtube on ice:<br/><br />
<table><br />
<tr><br />
<th>Components</th><br />
<th>Volume</th><br />
<th>Final Concentration</th><br />
</tr><br />
<tr><br />
<td>10X Reaction buffer</td><br />
<td>5&micro;l</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>10mM dNTP mix</td><br />
<td>0.5&micro;l</td><br />
<td>0.1&micro;m</td><br />
</tr><br />
<tr><br />
<td>Primer mix (10&micro;M each)</td><br />
<td>1&micro;l</td><br />
<td>0.2&micro;m</td><br />
</tr><br />
<tr><br />
<td>Template DNA</td><br />
<td>0.5&#8275;10&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
<tr><br />
<td>RBC Taq DNA polymerase (5U/&micro;l)</td><br />
<td>0.25&micro;l</td><br />
<td>1.25units</td><br />
</tr><br />
<tr><br />
<td>ddH2O</td><br />
<td>to 50&micro;l</td><br />
<td>n/a</td><br />
</tr><br />
</table><br />
<br/><br />
2) Suggested Reaction Parameters for RBC Taq DNA Polymerase<br/><br />
<table><br />
<tr><br />
<th>Segment</th><br />
<th>Number of cycles</th><br />
<th>Temperature</th><br />
<th>Duration</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>1&#8275;3 minutes</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>25&#8275;35</td><br />
<td><br />
94&deg;C (<i>denature</i>)<br/><br />
5 degree lower than Tm of Primer<br/><br />
72&deg;C (<i>extend</i>)<br />
</td><br />
<td><br />
30 seconds&#8275;1 30<br/><br />
seconds&#8275;1 minute<br/><br />
1minute/Kbp<br />
</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>1</td><br />
<td><br />
72&deg;C<br/><br />
4&deg;C<br />
</td><br />
<td>7 minutes</td><br />
</tr><br />
</table><br />
<br/><br />
3) Analyze the amplification products by agarose gel electrophoresis and visualize by ethidium bromide staining.<br/><br />
<br/><br />
<a href="http://webdownload.rbcbioscience.com/RBC%20Polymerases/DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase%20Protocol%20V2.0.pdf" target="_blank">External link</a><br/><br />
</html>|RBC-Taq-DNA-pol-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Phusion PCR Protocol|<html><br />
<table><br />
<tr><br />
<th><br />
Component<br />
</th><br />
<th><br />
50 &micro;l Reaction<br />
</th><br />
</tr><br />
<tr><br />
<td><br />
Nuclease-free water<br />
</td><br />
<td><br />
to 50 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
5X Phusion HF or GC Buffer<br />
</td><br />
<td><br />
10 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 mM dNTPs<br />
</td><br />
<td><br />
1 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Forward Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10 &micro;M Reverse Primer<br />
</td><br />
<td><br />
2.5 &micro;l<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Template DNA<br />
</td><br />
<td><br />
Variable<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
DMSO (optional)<br />
</td><br />
<td><br />
(1.5 &micro;l)<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Phusion DNA Polymerase<br />
</td><br />
<td><br />
0.5 &micro;l <br />
</td><br />
</tr><br />
</table><br/><br />
<br />
For the template DNA, use 1 &micro;l (50 ng/ &micro;l) of E.coli genomic DNA.<br/><br />
<br/><br />
Set the PCR with the following parameters:<br/><br />
<br/><br />
<br />
<table><br />
<tr><br />
<th>Cycle step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Initial denaturation</td><br />
<td>1</td><br />
<td>98</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>98</td><br />
<td>5-10</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30</td><br />
</tr><br />
<tr><br />
<td>Extention</td><br />
<td>&nbsp;</td><br />
<td>72</td><br />
<td>10-30*kb</td><br />
</tr><br />
<tr><br />
<td>Final extention</td><br />
<td>1</td><br />
<td>72</td><br />
<td>5-10 [min]</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&infin;</td><br />
</tr><br />
</table><br />
</html>|Phusion-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|OneTaq + Phu PCR|<html><br />
1) Add the following components in a sterile microtube on ice:<br />
<table><br />
<tr><br />
<th colspan="2"><br />
Reaction Mix<br />
</th><br />
</tr><br />
<tr><br />
<th>5x One Taq Buffer</th><br />
<td>10 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Fwd Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Rev Primer</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>10 mM dNTP's</th><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<th>One Taq</th><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<th>Template DNA</th><br />
<td>50-100 ng</td><br />
</tr><br />
<tr><br />
<th>H20</th><br />
<td>up to 50 &micro;l</td><br />
</tr> <br />
</table><br />
<br />
2) Suggested reaction parameters:<br />
<table><br />
<tr><br />
<th>Cycle Step</th><br />
<th>Cycles</th><br />
<th>Temp [&deg;C]</th><br />
<th>Time [s]</th><br />
</tr><br />
<tr><br />
<td>Inital denaturation</td><br />
<td>1</td><br />
<td>94</td><br />
<td>120</td><br />
</tr><br />
<tr><br />
<td>Denaturation</td><br />
<td>30</td><br />
<td>94</td><br />
<td>30</td><br />
</tr><br />
<tr><br />
<td>Annealing</td><br />
<td></td><br />
<td>60 *</td><br />
<td>60</td><br />
</tr><br />
<tr><br />
<td>Extension</td><br />
<td></td><br />
<td>68</td><br />
<td>60 s/Kbase</td><br />
</tr><br />
<tr><br />
<td>Final Extension</td><br />
<td>1</td><br />
<td>68</td><br />
<td>300</td><br />
</tr><br />
<tr><br />
<td>Hold</td><br />
<td>1</td><br />
<td>4</td><br />
<td>&#8734;</td><br />
</tr><br />
</table><br />
</html>|OneTaq-Phu-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Illustra GFX PCR DNA and Gel Band Purification Kit|<html><br />
<ol><br />
<li><br />
Sample Capture:<br />
<ul><br />
<li>Add 250 &micro;l of <i>Capture buffer</i> type 3 to the sample.</li><br />
<li>Mix and control that the color is yellow or pale orange.</li><br />
</ul><br />
</li><br />
<li><br />
Sample Binding:<br />
<ul><br />
<li>Transfer the mix in the assembled <i>GFX MicroSpin column</i> and Collection tube.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Replace <i>GFX MicroSpin column</i> in the same Collection tube.</li><br />
</ul><br />
</li><br />
<li><br />
Wash and Dry:<br />
<ul><br />
<li>Add 500 &micro;l of <i>Wash buffer</i> type 1.</li><br />
<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li><br />
<li>Transfer the <i>GFX MicroSpin column</i> in a clean tube.</li><br />
</ul><br />
</li><br />
<li><br />
Eluition:<br />
<ul><br />
<li>Add 50 &micro;l of distilled water.</li><br />
<li>Incubate for 1 minute at room temperature.</li><br />
<li>Spin for 1 minute at 13000rpm.</li><br />
<li>Retain flowthrough.</li><br />
<li>Quantify the sample at <i>Nanodrop</i> and label it with its concentration.</li><br />
</ul><br />
</li><br />
</ol><br />
<br/><br />
<a href="https://www.gelifesciences.com/gehcls_images/GELS/Related%20Content/Files/1314774443672/litdoc28951562AA_20110831111511.pdf" target="_blank">External protocol</a><br/><br />
<a href="http://www.gelifesciences.com/webapp/wcs/stores/servlet/catalog/en/GELifeSciences/products/AlternativeProductStructure_17513/28903470" target="_blank">External site</a><br/><br />
</html>|Illustra-GFX-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; SV Gel and PCR Clean-Up System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/101/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (136kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (75kb)<br />
</html>|Promega-PCR-Gel}}<br />
<br />
<h2>Cells</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells preparation|<html><br />
<ul><br />
<li>Transformation Buffer: sterile 10 mM Tris-HCl, pH 7.0, 50 mM CaCl2</li><br />
<li>Grow a 50 mL culture in LB at 37 deg C from 1 colony.</li><br />
<li>When OD ~ 0.5, collect the cells in a sterile Falcon tube and chill on ice for 10min.</li><br />
<li>Centrifuge at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 15 mL of transformation buffer.</li><br />
<li>Chill on ice for 15 min. Spin at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li><br />
<li>Resuspend cells in 4 mL of transformation buffer.</li><br />
</ul><br />
<br/><br />
The cells are now ready to be transformed. They can be stored in this state at 4 deg C for under a week.<br/><br />
Alternatively, the competent cells can be aliquoted (200&micro;L), adding glycerol to a final conc of 15% (v/v), and the cells stored at –80 deg C.<br/><br />
Every time you make new competent cells you should check for possible contaminations. Plate an aliquot of the new cells in LB plates + antibiotic (i.e. ampicillin, chloramphenicol, kanamycin). Strains such as DH5a, NEB10b, Novablue, should not grow in the presence of antibiotics.<br/><br />
</html>|Competent-cells-prep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation|<html><br />
<b>Competent cells must always stay in ice</b><br />
<ul><br />
<li>Thaw home made CaCl2 competent cells on ice.</li><br />
<li>Add 1&micro;L of DNA to 200&micro;L of competent cells (concentration of DNA stock should be between 50–150 ng/&micro;L).</li><br />
<li>Incubate on ice for 30 min.</li><br />
<li>Heat shock at 42&deg;C for exactly 2 min.</li><br />
<li>Incubate on ice 1 min.</li><br />
<li>Add 500-700&micro;L of LB (or SOC) and shake at 37&deg;C for 1 h.</li><br />
<li>Plate the cells (use plates with the appropriate antibiotic according to your plasmid).</li><br />
</ul><br />
<br/><br />
You can either plate a small amount (200&micro;L) of the cells or more.<br/><br />
You should try a few conditions the first time and then choose the one that gives 30–300 separate colonies.<br/><br />
If few cells are expected: spin down the cells at 2500 rpm, discard supernatant and resuspend in 150–200&micro;L of LB and plate all the cells.<br/><br />
<br/><br />
Plates must be labeled as follow:<br/><br />
strain – [resistance] – part – “(plasmid)” – YOUR_NAME – date<br/><br />
<br/><br />
For ligation you should increase the amount of DNA to be transformed (see cloning protocol).<br/><br />
<ul><li>Incubate the plates O/N upside down at 37&deg;C.</li></ul><br />
<b>!!!Don't plate before four o'clock!!!</b><br/><br />
</html>|Competent-cells-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|B. subtilis transformation (from Groeningen iGEM2013 team)|<html><br />
<span>Prepare the competence medium as follow:</span><br />
<table class="tn-sp-table"><br />
<tr colspan="2"><br />
<th>Competence medium (MC completed)</th><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
1.8 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
10x MC<br />
</td><br />
<TD><br />
200 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
MgSO4 1M<br />
</td><br />
<TD><br />
6.7 ul<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
trp 1% (for trp - strains)<br />
</td><br />
<TD><br />
10 ul<br />
</TD><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2"><br />
MC 10x<br />
</th><br />
</tr><br />
<tr><br />
<td colspan="2"><br />
for 100 ml<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
K2HPO4 3H2O<br />
</td><br />
<TD><br />
14.036 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
KH2PO4<br />
</td><br />
<TD><br />
5.239 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Glucose<br />
</td><br />
<TD><br />
20 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Tri-Na Citrate 300 mM<br />
</td><br />
<TD><br />
10 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Ferric NH4 Citrate<br />
</td><br />
<TD><br />
1 ml<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
Casein Hydrolysate<br />
</td><br />
<TD><br />
1 g<br />
</TD><br />
</tr><br />
<tr><br />
<td><br />
K glutamate<br />
</td><br />
<TD><br />
2 g<br />
</TD><br />
</tr><br />
<tr><br />
<td colspan="2">Mix everything in 40-50 ml H2O, then adjust to 100 ml, filter sterilize, freeze at -20 C</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th><br />
Tri-Na Citrate 300mM<br />
</th><br />
<td><br />
8.823 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
Ferric NH4 citrate<br />
</th><br />
<td><br />
2.2 g<br />
</td><br />
<td><br />
in 100 ml H2O<br />
</td><br />
</tr><br />
<tr><br />
<td colspan="3"><br />
--> wrap in aluminium foil!!<br />
</td><br />
</tr><br />
</table><br />
<br/><br />
<ol><br />
<li><br />
Pick up a nice big colony and drop it in 2 ml of completed MC (1x) (see below);<br />
</li><br />
<li><br />
Grow at 37 &deg;C for 5 hours (or more if culture is not really turbid);<br />
</li><br />
<li><br />
Mix 400 ul of culture with DNA (usually 1 ug) in fresh tube (i.e. 15 ml tubes losely closed);<br />
</li><br />
<li><br />
Grow for additional 2 h at 37 &deg;C;<br />
</li><br />
<li><br />
Plate all on selective antibiotic plates, and incubate at 37 &deg;C O/N<br />
</li><br />
</ol><br />
</html>|subtilis-transformation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation efficiency kit (registry)|<html><br />
<a href="http://parts.igem.org/Help:Transformation_Efficiency_Kit" target="_blank">External link (registry)</a><br />
</html>|Competent-cells-transformation-efficiency}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Gram Staining Protocol|<html><br />
<ol><br />
<li><br />
Transfer 100 ul of sterile distilled water in an eppendorf;<br />
</li><br />
<li><br />
Pick up a colony using a tip and resuspend it in the sterile water;<br />
</li><br />
<li><br />
Verify that the glass slide is cleaned and degreased or clean it with 70% alcohol;<br />
</li><br />
<li><br />
Transfer 20 ul of bacterial suspension on the slide;<br />
</li><br />
<li><br />
Swipe gently bacterial suspension with the aid of a sterile loop to occupy 1-2 cm at the center of the slide;<br />
</li><br />
<li><br />
Let dry the slide by evaporation;<br />
</li><br />
<li><br />
Cover the central part of the slide with methanol, remove the excess and let it evaporate;<br />
</li><br />
<li><br />
Sock the slide in the crystal violet solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Sock the slide in the lugol solution for 1 min, wash then with sterile water; <br />
</li><br />
<li><br />
Pour Gram bleach solution on the product for 20-30 s, wash then with sterile water;<br />
</li><br />
<li><br />
Sock the slide in the safranin solution for 1 min, wash then with sterile water;<br />
</li><br />
<li><br />
Finally let dry the slide and observe it with the microscope.<br />
</li><br />
</ol><br />
</html>|gram-staining}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MNGE medium|<html><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MNGE medium 40 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>10xMN-Medium</td><br />
<td>3,68ml</td><br />
</tr><br />
<tr><br />
<td>Sterile water</td><br />
<td>33,12ml</td><br />
</tr><br />
<tr><br />
<td>Glucose (20%)</td><br />
<td>4ml</td><br />
</tr><br />
<tr><br />
<td>K-Glutamat (40%)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Fe[III]-ammonium-citrate (2,2 mg/ml)</td><br />
<td>200&micro;l</td><br />
</tr><br />
<tr><br />
<td>Tryptophan (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
<tr><br />
<td>MgSO4 (1M)</td><br />
<td>120&micro;l</td><br />
</tr><br />
<tr><br />
<td>threonine (5 mg/ml)</td><br />
<td>400&micro;l</td><br />
</tr><br />
</table><br />
<br />
<table><br />
<tr><br />
<th colspan="2">MN medium 10X 50 ml</th><br />
</tr><br />
<tr><br />
<th>Compound</th><br />
<th>Amount</th><br />
</tr><br />
<tr><br />
<td>K2HPO4 (x3 H2O)</td><br />
<td>6,8 g</td><br />
</tr><br />
<tr><br />
<td>KH2PO4</td><br />
<td>3 g</td><br />
</tr><br />
<tr><br />
<td> Na-citrate (x 2 H2O)</td><br />
<td>0.5 g</td><br />
</tr><br />
</table><br />
<br />
</html>|mnge-medium}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Difco Sporulation Medium (from LMU - Munich iGEM team)|<html><br />
<table><br />
<tr><br />
<td>Nutrienti Broth</td><br />
<td>8 g</td><br />
</tr><br />
<tr><br />
<td>KCl</td><br />
<td>1 g</td><br />
</tr><br />
<tr><br />
<td>MgSO4 1 M</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>MnCl2 10 mM</td><br />
<td>1 ml</td><br />
</tr><br />
<tr><br />
<td>H2O (bidest)</td><br />
<td>ad to 1.000 ml</td><br />
</tr><br />
<tr><br />
<td colspan ="2"> after autoclave add</td><br />
</tr><br />
<tr><br />
<td>CaCl2 1 M</td><br />
<td>0,5 ml</td><br />
</tr><br />
<tr><br />
<td>FeSO4 1 mM</td><br />
<td>1 ml</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
</html>|Difco-Sporulation-Medium}}<br />
<br />
<h2>Miscellaneous</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Parts extraction and transformation (NEB10&beta;).|<html><br />
<ol><br />
<li>Label the empty eppendorfs that will contain the parts, including antibiotic resistance, part denomination and position (and on which kit).</li><br />
<li>Spot the correct well and label it with a pen.</li><br />
<li>Push a hole with the pin of a micropipette and resuspend the content with 10ul water.</li><br />
<li>When the color is dark red, wait 1 minute.</li><br />
<li>Move the re-suspended part into the correct empty eppendorf.</li><br />
</ol><br />
</html>|parts-registry-extraction}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; Plus SV Minipreps DNA Purification System Technical Bulletin|<html><br />
<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/0/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (180kb)<br/><br />
<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (72kb)<br />
</html>|miniprep}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Biobrick cloning|<html><br />
<!--biobrick cloning protocol --><br />
<p><br />
Prepare the digestion mix as follow: <br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
DNA <br />
</td><br />
<td><br />
500 ng<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X NEB Buffer<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
10X BSA<br />
</td><br />
<td><br />
2.5 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E1<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
E2<br />
</td><br />
<td><br />
1 ul <br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<td><br />
Up to 25 ul <br />
</td><br />
</tr><br />
</table><br />
<br />
<p><br />
Incubate the reaction mix at 37 &deg;C for 30 min. Disactivate then the enzymes incubating the mix at 80 &deg;C for 20 min.<br />
The next step will be the ligation of the digestion products. The raction mix is prepared as follow:<br />
</p><br />
<table class="tn-sp-table"><br />
<tr><br />
<td><br />
Insert<br />
</td><br />
<td><br />
3 fold excess<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Vector<br />
</td><br />
<td><br />
40 ng<br />
</td> <br />
</tr><br />
<tr><br />
<td><br />
10X T4 Ligase Buffer<br />
</td><br />
<td><br />
2 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
T4 Ligase<br />
</td><br />
<td><br />
1 ul<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
H2O<br />
</td><br />
<TD><br />
Up to 20 ul<br />
</TD><br />
</tr><br />
</table><br />
<p><br />
Gently mix the reaction and incubate for 30 min at room temperature. Disactivate the enzymes at 80 &deg;C for 20 min. Transorm 10 ul of the reaction in competent cells.<br />
</p><br />
</html>|biobrick-cloning}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ligation|<html><br />
<br />
Prepare the reaction mix, you can use the automatic calculator.<br/><br />
</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Automatic Calculator|<html><br />
<script type="text/javascript"><br />
/**<br />
*<br />
*/<br />
function ligateCalc() {<br />
//Calculate needed plasmid<br />
insert_need = parseFloat($("input[name=plasmid_need]").val()*$("input[name=insert_length]").val()/$("input[name=plasmid_length]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_need]").text(insert_need);<br />
<br />
//Calculate buffer<br />
buffer = parseFloat($("input[name=total_volume]").val()/$("input[name=buffer_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=buffer]").text(buffer);<br />
<br />
//Calculate plasmid<br />
plasmid = parseFloat($("input[name=plasmid_need]").val()/$("input[name=plasmid_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=plasmid]").text(plasmid);<br />
<br />
//Calculate insert<br />
insert = parseFloat($("td[data-pseudoid=insert_need]").text()/$("input[name=insert_conc]").val()).toFixed(2);<br />
$("td[data-pseudoid=insert_one]").text(insert);<br />
$("td[data-pseudoid=insert_two]").text(insert*2);<br />
$("td[data-pseudoid=insert_three]").text(insert*3);<br />
$("td[data-pseudoid=insert_four]").text(insert*4);<br />
<br />
//Calculate water<br />
total_volume = parseFloat($("input[name=total_volume]").val()).toFixed(2);<br />
$("td[data-pseudoid=water_ctrl]").text(parseFloat(total_volume-buffer-plasmid-1).toFixed(2));<br />
$("td[data-pseudoid=water_one]").text(parseFloat(total_volume-buffer-plasmid-1-insert).toFixed(2));<br />
$("td[data-pseudoid=water_two]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*2)).toFixed(2));<br />
$("td[data-pseudoid=water_three]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*3)).toFixed(2));<br />
$("td[data-pseudoid=water_four]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*4)).toFixed(2));<br />
<br />
}<br />
<br />
$(document).ready(function() {<br />
$("#tn-ligation-calc input:text").each(function() {<br />
$(this).change(function(e) {<br />
e.preventDefault();<br />
ligateCalc();<br />
});<br />
});<br />
ligateCalc();<br />
});<br />
</script><br />
<form id="tn-ligation-calc"><table><br />
<tr><br />
<th>Plasmid concentration (ng/&micro;l)</th><br />
<td><input type="text" name="plasmid_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Plasmid length (bp)</th><br />
<td><input type="text" name="plasmid_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert concentration (ng/&micro;l)</th><br />
<td><input type="text" name="insert_conc" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Insert length (bp)</th><br />
<td><input type="text" name="insert_length" value="1" /></td><br />
</tr><br />
<tr><br />
<th>Amount of plasmid you want to use (ng)</th><br />
<td><input type="text" name="plasmid_need" value="200" /></td><br />
</tr><br />
<tr><br />
<th>Volume of reaction (&micro;l)</th><br />
<td><input type="text" name="total_volume" value="20" /></td><br />
</tr><br />
<tr><br />
<th>Buffer concentration (X)</th><br />
<td><input type="text" name="buffer_conc" value="10" /></td><br />
</tr><br />
<tr><br />
<th>Amount of insert needed for 1:1 (ng)</th><br />
<td data-pseudoid="insert_need">-</td><br />
</tr><br />
</table><br />
<br/><br />
<center><b>Results</b></center><br />
<table class="results"><br />
<tr><br />
<td style="border: none;">&nbsp;</td><br />
<th>ctrl</th><br />
<th>1:1</th><br />
<th>1:2</th><br />
<th>1:3</th><br />
<th>1:4</th><br />
</tr><br />
<tr><br />
<th>Buffer (&micro;l to have 1X)</th><br />
<td data-pseudoid="buffer" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Plasmid (&micro;l)</th><br />
<td data-pseudoid="plasmid" colspan="5"></td><br />
</tr><br />
<tr><br />
<th>Insert (&micro;l)</th><br />
<td>0</td><br />
<td data-pseudoid="insert_one"></td><br />
<td data-pseudoid="insert_two"></td><br />
<td data-pseudoid="insert_three"></td><br />
<td data-pseudoid="insert_four"></td><br />
</tr><br />
<tr><br />
<th>Ligase (&micro;l)</th><br />
<td colspan="5">1</td><br />
</tr><br />
<tr><br />
<th>Water (&micro;l)</th><br />
<td data-pseudoid="water_ctrl"></td><br />
<td data-pseudoid="water_one"></td><br />
<td data-pseudoid="water_two"></td><br />
<td data-pseudoid="water_three"></td><br />
<td data-pseudoid="water_four"></td><br />
</tr><br />
</table></form><br />
</html>}}<html><br />
Prepare your reaction and incubate at RT for 2 hours. Transform half of the reaction into 200μL of “homemade” competent cells (DH5&alpha;, NEB10&beta;, Novablue or other appropriate strains) following a standard transformation protocol. Plate all the cells.<br />
</html>|Ligation}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Digestion|<html><br />
Assemble the digestion mix as follow (check the correct buffer with the <a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a>).<br />
<br />
<table><br />
<tr><br />
<td style="border: none;" rowspan="2"></td><br />
<th colspan="2">Classic Cloning</th><br />
<th rowspan="2">Screening</th><br />
</tr><br />
<tr><br />
<th>PCR products</th><br />
<th>Plasmids</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>&#126;3-4&micro;g</td><br />
<td>&#126;2-3&micro;g</td><br />
<td>&#126;1.0&micro;g</td><br />
</tr><br />
<tr><br />
<th>Enzyme 1</th><br />
<td rowspan="2">2.5&micro;l</td><br />
<td rowspan="2">1.5&micro;l</td><br />
<td rowspan="2">1.0&micro;l</td><br />
</tr><br />
<tr><br />
<th>Enzyme 2</th><br />
</tr><br />
<tr><br />
<th>Buffer (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>BSA (stock 10X)</th><br />
<td>10&micro;l</td><br />
<td>5&micro;l</td><br />
<td>2&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>Up to 100&micro;l</td><br />
<td>Up to 50&micro;l</td><br />
<td>Up to 20&micro;l</td><br />
</tr><br />
</table><br />
<br />
<h4>Classic Cloning - for PCR products</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;l of DpnI and incubate at 37&deg;C for 2 hours. <i>Please note that PCR product must be purified before digestion.</i><br />
<h4>Classic Cloning - for plasmids</h4><br />
Incubate at 37&deg;C overnight. The day after add 1&micro;L of phosphatase (CIP or SAP) to the vector and incubate for 2 hours at 37&deg;C.<br />
<h4>Biobricks Cloning</h4><br />
Incubate at 37&deg;C for 30 minutes. Then disactivate the enzymes at 80&deg;C for 20 minutes.<br />
<h4>Screening</h4><br />
Incubate for 1.5h at 37&deg;C. Run all the digested product on an agarose gel to screen colonies. <br />
<br/><br/><hr/><br/><br />
<a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a><br />
</html>|Digestion}}<br />
<br />
<h2>Details</h2><br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|SAMsynthetase extraction from <i>E. coli</i> (strain MG1655) genome|<html><br />
<table><br />
<tr><br />
<th colspan="4">PRIMERS SEQUENCES</th><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>GCCGCTTCTAGAGA AGGAGG AACTACT <b>ATG</b>GCAAAACACCTTTTT</td><br />
<td>prefix(only Xba1) + RBS + spacer + ATG...</td><br />
<td>Tm = 66&deg;C</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>CTGCCGGTCTGAAG TAATAA TACTAGTAGCGGCCGCTGCAG</td><br />
<td>sequence + stop codon + suffix</td><br />
<td>Tm = 67.5&deg;C</td><br />
</tr><br />
</table><br />
<br />
SAMsynthethase gene length = 1155 bp<br><br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><!--riga--><br />
<th><!--colonna-->Solutes</th><br />
<th>Quantities or Concentration</th><br />
</tr><br />
<tr><br />
<td>Template(genome)</td><br />
<td>1ng/ &micro;l</td><br />
</tr><br />
<tr><br />
<td>dNTPs</td><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Forward</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Primer Reverse</td><br />
<td>1 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Buffer RBC</td><br />
<td>1X</td><br />
</tr><br />
<tr><br />
<td>Phusion polimerase</td><br />
<td>0.3 &micro;l</td><br />
</tr><br />
<tr><br />
<td>RBC Taq polimerase</td><br />
<td>0.25 &micro;l</td><br />
</tr><br />
<tr><br />
<td>Water</td><br />
<td>up to 50 &micro;l</td><br />
</tr><br />
</table><br />
<br />
We have chosen to use RBC for its amplification power and Phusion for its proofreading activity<br><br />
<br />
The program set on the PCR is the following:<br />
<br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan="4">PCR Settings</th><br />
</tr><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>94&deg;C</td><br />
<td>2 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>94&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>62.5&deg;C</td><br />
<td>1 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>1 min 9 s</td><br />
<td>Go to Step 2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>7 min</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>pause</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
</html>|SAM-extraction-genome-coli}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|pSB1C3 linearization by PCR|<html><br />
This protocol is a Phusion PCR using <b>Suffix Forward</b> and <b>Prefix Reverse</b> primers: in this way it is possible to linearize pSB1C3 removing any insert (like RFP,...). <i>Note: it is advisable to perform the PCR at least in triplicates.</i><br/><br />
<br/><br />
<table><br />
<tr><br />
<th colspan="2">PCR mix</th><br />
</tr><br />
<tr><br />
<th>Template</th><br />
<td>50ng (at least 0.50&micro;l)</td><br />
</tr><br />
<tr><br />
<th>HF Buffer</th><br />
<td>10&micro;l</td><br />
</tr><br />
<tr><br />
<th>dNTPs</th><br />
<td>1&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Fw (suff)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Primer Rv (pref)</th><br />
<td>2.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Phusion</th><br />
<td>0.5&micro;l</td><br />
</tr><br />
<tr><br />
<th>Water</th><br />
<td>up to 50&micro;l</td><br />
</tr><br />
</table><br />
<br/><br />
Given that pSB1C3 is 2070bp long and that the annealing temperature of the primers used is 58&deg;C, the PCR program to be used is the following:<br />
<table><br />
<tr><br />
<th>Step</th><br />
<th>Temperature</th><br />
<th>Time</th><br />
<th>Type</th><br />
<th>Go to</th><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>98&deg;C</td><br />
<td>30sec</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>98&deg;C</td><br />
<td>10sec</td><br />
<td>Denaturation</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>58&deg;C</td><br />
<td>20sec</td><br />
<td>Annealing</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>72&deg;C</td><br />
<td>35sec</td><br />
<td>Extend</td><br />
<td>Go to step #2 for 30 times</td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>72&deg;C</td><br />
<td>10min</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>4&deg;C</td><br />
<td>&infinit;</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
Then run the PCR samples on a 1% agarose gel to verify the success of the reactions (each sample is prepared with 8&micro;l of PCR reaction and 2&micro;l of 6X loading die; 1kb ladder is good).<br />
</html>|pSB1C3-linearization-PCR}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ethylene detection through Micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, the culture was induced with 5 mM arabinose and placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was kept for about 4 hours at 37 &deg;C in thermoshaker. After that the sample was connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measure was then taken.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|ethylene-detection-assay}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Kinetic assay for ethylene production through micro GC|<html><br />
<p><br />
An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, 3<br />
ml of culture induced with 5 mM arabinose was placed with a stirrer in a sealed vial (V =<br />
15 ml) with a pierceable septum. The sample was then connected to the Micro Gas<br />
Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U<br />
column (see the tables for colums and method specifications).<br />
</p><br />
<table class="tn-sp-table"><br />
<TR><br />
<th><br />
Column<br />
</th><br />
<th><br />
Lenght<br />
</th><br />
<th><br />
Diameter<br />
</th><br />
</TR><br />
<tr><br />
<td><br />
Mol Sieve 5A Plot<br />
</td><br />
<td><br />
10 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
<tr><br />
<td><br />
Plot U<br />
</td><br />
<td><br />
8 m<br />
</td><br />
<td><br />
0.32 mm<br />
</td><br />
</tr><br />
</table><br />
<table class="tn-sp-table"><br />
<tr><br />
<th colspan = '2'><br />
Method used<br />
</th><br />
</tr><br />
<tr><br />
<th><br />
t sample<br />
</th><br />
<td><br />
50 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injector<br />
</th><br />
<td><br />
55 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
110 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t column Plot U <br />
</th><br />
<td><br />
70 &deg;C<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Mol Sieve 5A Plot<br />
</th><br />
<td><br />
39.16 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
p column Plot U<br />
</th><br />
<td><br />
21.76 psi<br />
</td><br />
</tr><br />
<tr><br />
<th><br />
t injection<br />
</th><br />
<td><br />
40 us<br />
</td><br />
</tr> <br />
<tr><br />
<th><br />
t analysis<br />
</th><br />
<td><br />
95 s <br />
</td><br />
</tr><br />
</table><br />
A measurment was taken every 45 min / 1 h in order to get an overview of the time course<br />
of ethylene production.<br/><br />
In order to estimate how much gas was taken for each measurement using the settings<br />
described above, a mass flow meter was connected to the micro GC.<br />
During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a<br />
measurment lasts 10 s, the withdrawn volume was 0.5 ml.<br />
</html>|kinetic-ethylene-production}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Application of B. fruity on fruit|<html><br />
To test if our system was able to accelerate or to slow down fruit ripening, we designed an ermetically closed jam jar with a rubber hose connector. These jars contained our test-fruit and each one was connected to a flask. The flasks contained 300 ml of induced (or not) culture when its O.D.600 reached 0.8. The flasks contained also a stirrer. The cultures were maintained at 37 &deg;C using a laboratory heating plate connected to a digital thermometer immersed in the culture.<br/><br />
For some days, every morning the culture in the flasks was substituted with a new induced (or not) colture .<br/><br />
Furthermore, canonical jam jars (i.e.: with no connector) were adopted to contain the negative control fruit samples. All the apparatus was put under the chemical hood. <br/><br />
<br/><br />
<center><br />
<i>The apparatus.</i><br/><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2013/1/10/Tn-2013_ripenator_apparatus.JPG" width="450px" /><br />
</center><br />
</html>|Bfruity-application}}<br />
<br />
{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MeSA Detection|<html><br />
<br />
<B>Sample preparation</B><br />
<p><br />
To detect if <I>E. coli</I> actually produced Methyl salicilate (MeSA), we tried both qualitative (SNIFF Test) and quantitative (GC-MS) tests.<br />
</p><br />
<p><br />
All the measurement have to start by inocula in the correct antibiotics (CM) of MeSA producing cells and of normal Neb10&beta; in LB without antibiotic as control. The inocula need to be growth O/N at 37&deg;C in agitation. The following day, dilutions 1:100 were done in falcons with fresh LB and the same antibiotic; the cells were growth at 37&deg;C in agitation until O.D.600&asymp;0.6 was reached.<br />
</p><br />
<p><br />
Then the cells were induced by adding Arabinose 5mM by a solution 1 M prepared by dissolving 0,150 g in 1 mL of dH2O. After two hours in some of the samples was added Salicylic Acid 2mM by a solution 1 M obtained by dissolving 0,138 g in 1 mL ethanol 70%. Then the culture were put for other 2 hours at 37&deg;C in agitation waiting for the 4 hours of induction to pass.<br />
</p><br />
<p><br />
The tests could also been in M9 medium because it smells less than LB. To do this, when cells in LB reached an O.D. of 400 they were centrifuged at 4100 rpm for 10 minutes to form a pellet. The supernatant was discarded and they were resuspended in fresh M9 medium with the correct antibiotic. This was done because E.coli cells growth in M9 in much more time than in LB. The cells were therefore induced with Arabinose and after two hours SA was added where needed.<br />
</p><br />
At this point the samples were ready for different test.<br />
<B> GC-FID </B><br />
<p><br />
To have a quantitative analysis we used the <i> Finnigan Trace GC ULTRA </i> with a flame ionization detector (FID). To achieve the final results and finally measure the quantity presents in our samples many tries were done with different conditions and methods. For what concerns the results presented in our wiki the column exploited was a DB5-MS capillary with a total length of 30 m (loops), an internal diameter of 0.25 mm and a film of 0.25 μm. The temperature program set for all the analyses was taken from literature <span class="tn-ref"> (Deng, C, et al. Investigation of Tomato Plant Defence Response to Tobacco Mosaic Virus by Determination of Methyl Salicylate with SPME-Capillary GC-MS. Chromatographia. 2004, Vol. 59, 3/4, pp. 263-268) </span> and adapted to our experiment in order to decrease the time of each measurement. In particular the program was set to start with the column at 80°C for 2’, to increase the temperature at the rate of 30°C/min until reaching the temperature of 280°C and maintaining it for 10’. The temperatures of the injector and of the FID were set 280°C. The carrier in the column was He 1.4 mL/min and the flow of the FID was set to be 40 mL/min of H2, 450 mL/min of air and to make up 30 mL/min of N2. The modality of the introduction of the samples in the detector was set to splitless, in particular 70 mL/min. With these setting the retention index of MeSA was between 10.20-10.27 min.<br />
The measuraments were done on liquid (the tries done on the headspace of a standard sample by injection of 1 ul of air were not positive). In particular each bacteria sample was before centrifuged and 1 mL of supernatant was filtrated with a 0.22 μm filter and then 1 μL of each sample was injected in gas chromatography to not damage the instrument. Before and after each injection the syringe was washed with acetone or ethanol for 3 times to eliminate any residual.<br />
</p><br />
<br />
<br />
</html>|MeSA-detection}}<br />
<br />
<html></div></div></html><br />
<br />
|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-10-01T21:09:30Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needed also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also proofed to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we found methyl salicylate (MeSA). Previous work suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts to produce MeSA were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BSMT1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example, we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct minty fragrance. We exploited the physical properties of MeSA to quantify its production by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM). For more details about the protocol that we used for the instrument see here (link) <br />
</p><br />
<br />
NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> were grown both in LB and M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 3:</b> induced sample produces MeSA. A culture of cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
</div> <br />
<span style="text-align:justify;" class="tn-caption center"><b>Figure 4:</b> Left panel: calibration curve obtained with different concentrations of pure MeSA in ethanol. Right panel: Quantification of MeSA by GC-FID. NEB10&beta; cells transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> supplemented with salycilic acid produce around 0.4 mM of MeSA. Non transformed cells and non induced cells did not produce any MeSA. Cells induced with arabinose and not supplemented with salycilic acid did not show any significant MeSA concentration (data not shown).</span><br />
<br />
<br />
Our MeSA device <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was able to produce a significant concentration of MeSA only in the presence of salycilic acid. This finding was also previously observed by the MIT team in 2006 with their device (<a href="http://parts.igem.org/Part:BBa_J45700">BBa_J45700</a>). This result was initially imputed to the lack of SAM synthetase. However, after we received the DNA sequencing results of the MIT part (<a href="http://parts.igem.org/Part:BBa_J45300">BBa_J45300</a>) and of our complete device (built with MIT parts) we realised that the pLAC promoter was missing the -35 box, thus generating a less strong promoter. We believe that this problem can significantly affect the correct functioning of the device. We are now in the process of improving this part by mutagenesis to rebuild a full functional pLAC promoter.<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-30T15:18:59Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
<i>B. fruity</i> needs also a fruit ripening ihnibitor. It was difficult to find a volatile molecule that could be enzymatically produced by a bacteria and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA inhibits the ripening of kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">(Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596)</span>. <br />
</p><br />
<p><br />
We were happy to find out that many of the needed parts were already available in the registry. These parts were initally built by the MIT 2006 iGEM team for the project <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb"><i>Eau de coli</i></a>.</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BMST1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry. For example we substituted the pTet promoter controlling the BSMT1 enzyme with an araC-pBAD promoter. Additionally the MIT team did not include in their MeSA generator device the enzyme SAM synthetase, that we hope will boost MeSA production. We also have re-submitted in pSB1C3 the single enzymes of the pathway.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
MeSA is an highly volatile liquid with a distinct smell similar to mint. We exploited this physical property to quantify the production of MeSA by gas chromatography using a Finnigan Trace GC ULTRA connected to a <b>flame ionization detector</b> (FID). This kind of instrument, is able to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
<br />
NEB10&beta; cells transformed with <a href="">BBa_K1065102</a> were grown in M9 medium, induced with 5 mM arabinose and in some cases supplemented with salicylic acid. All the gas chromatography measures here reported were done in liquid phase, by injecting 1 ul of pre-filtered culture in the instrument.<br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 3:</b> induced sample produces MeSA. A culture transformed with <a href="http://parts.igem.org/Part:BBa_K1065102">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to these samples. After about 4 h the samples were connected to the Gas Chromatograph. The induced sample (blue trace) shows the characteristic peak of methyl salicylate, as opposed to non induced cells (red trace).</span><br />
<div class= "tn-doublephoto-wrap"><br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"/> <br />
<img class="plot" src="https://static.igem.org/mediawiki/2013/3/3f/Tn-2013_Istogramma_mesa.jpg"/><br />
</div> <br />
<span class="tn-caption center"><b>Figure 4:</b> quantification of MeSA by GC-FID. </span><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-29T17:44:23Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">) (Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596.)</span>) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BMST1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/4/4f/Tn-2013_Taratura_MeSA.jpg"> <br />
<br />
Then many measuraments were done with the instruments on different samples. <br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 2:</b> induced sample produces MeSA. A culture transformed with <a href="">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to both samples. After 4 h the samples were connected to the Gas Chromatograph and a measure was taken. The chromatogram clearly shows how induced sample has a characteristic peak corresponding to methyl-salycilate.</span><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/File:Tn-2013_Taratura_MeSA.jpgFile:Tn-2013 Taratura MeSA.jpg2013-09-29T17:42:27Z<p>TULIO007: </p>
<hr />
<div></div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-29T17:32:05Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit <span class="tn-ref"> (Aghdam M. et al., Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156)</span> and tomatoes, at a concentration of 0.5 mM <span class="tn-ref">) (Ding, C. and Wang, Plant Science 2003, Y. 164 pp. 589-596.)</span>) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption" style="text-align:justify;"> <b> Figure 1: </b> In this picture is shown the pathway that was exploited to produce Methyl Salicyalte. The precursor is the chorismate, a metabolic intermediate of the Shikimate pathway which many plants and bacteria (like <i> E.coli </i> and <i> B.subtilis </i>) have. The chorismate undergoes firstly a reaction of isomerization by the isochorismate synthase, PchA and then the salicylate is obtained by the action of PchB an isochorismate pyruvate lyase. Both enzymes are from the micro-organism <i>Pseudomonas aeruginosa </i>. In the final part of the reaction, BMST1, a methyltransferase, transfer a methyl group from the S-adenosyl-L-methionine synthesized by the SAM synthetase. </span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2013/d/d4/Induced_sample_produce_MeSA.png"><br />
<span class="tn-caption center" style="text-align:justify;"><b>Figure 2:</b> induced sample produces MeSA. A culture transformed with <a href="">BBa_K1065102</a> was grown until O.D. 0.6 was reached. The culture was then splitted in 2 samples and one was induced with 5 mM arabinose. 2 mM salycilic acid was added to both samples. After 4 h the samples were connected to the Gas Chromatograph and a measure was taken. The chromatogram clearly shows how induced sample has a characteristic peak corresponding to methyl-salycilate.</span><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:46:21Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:45:54Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom:1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<img id="mesapath" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg"/><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:45:01Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom:1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<img id="no-border" style= "margin-bottom: 1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" alt="Ethylene pathway" /><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:43:41Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: "1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<img class="no-border" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" alt="Ethylene pathway" /><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:42:25Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: "1em"; src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:37:53Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:36:58Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
</html><br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<html><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:35:32Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:33:34Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:32:19Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) and kiwifruit (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:31:10Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either kiwifruit <span class="tn-ref"> (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span) and tomatoes, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) </span) <br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:27:35Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. There were not many candidates to choose from and after a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of either tomatos, at a concentration of 0.5 mM <span class="tn-ref"> (The dual effects of methyl salicylate on ripening and expression of ethylene biosynthetic genes in tomato fruit. Ding, C. and Wang, Y. 164, 2003, Plant Science, pp. 589-596.) </span) and kiwifruit <span class="tn-ref"> (Aghdam, M., et al. Methyl Salicylate Affects the Quality of Hayward Kiwifruits during. Journal of Agricultural Science. June 2011, Vol. 3, 2, pp. 149-156.) </span)<br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
< img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-28T21:15:53Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:UNITN-Trento/CSS/Project/Methyl_Salicylate?action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<span class="tn-title">Results - Methyl Salicylate </span><br />
<p> <br />
There were not many candidates to choose from. It was difficult to find a volatile molecule that could be enzymatically produced by a bacterium and also demonstrated to be an efficient ripening inhbitor. After a long search we chose methyl salicylate (MeSA). Previous publications suggested that MeSA could inhibit the ripening of kiwifruit and tomato at a concentration of XX mM. (REF)<br />
</p><br />
<p><br />
Fortunately many of the needed parts were already available because of the work of the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">MIT iGEM 2006 team (<i>Eau de Coli</i>)</a>.<br />
</p><br />
<br />
<img class= "no-border" img id="mesapath" style=" margin-bottom: 1em;" src="https://static.igem.org/mediawiki/2013/d/dd/Tn-2013_MeSA_path.jpg" /><br />
<span class="tn-caption "></span><br />
<br />
<p><br />
We modified and improved these parts and resubmitted them to the registry, as they were not available in pSB1C3.<br />
</p><br />
<br />
<img id="parts" src="https://static.igem.org/mediawiki/2013/4/41/Tn-2013_Mesa_main_parts.jpg" /><br />
<br />
<span class="tn-subtitle">MeSA detection</span> <br />
<p><br />
To have a quantitative analysis we used a Finnigan Trace GC ULTRA with a <b>flame ionization detector</b> (FID) that allowed us to detect ions formed during MeSA combustion in a hydrogen flame. The generation of this ions is proportional to MeSA concentration in the sample stream. A calibration curve was initially created using samples with a well known pure MeSA concentration (0 mM, 0.2 mM, 0.5 mM, 1.0 mM, 2 mM).<br />
</p><br />
</div><br />
<br />
<div class="sheet-2"><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Ethylene"><br />
<img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/f/f0/Tn-2013-arr-MeSA_prev.png" /><br />
</a><br />
<a href="javascript:toTop('#tn-main-wrap-wrap');"><br />
<img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" /><br />
</a><br />
<a href="https://2013.igem.org/Team:UNITN-Trento/Project/Blue%20light"><br />
<img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-arr-MeSA_next.png" /><br />
</a><br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T21:00:50Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work <i> Eau De Coli </i> done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
<img style="box-shadow:none; margin-bottom:-1em; img src="https://2013.igem.org/File:Tn-2013_MeSA_path.jpg" alt="MeSA pathway" /><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:58:15Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<html><br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work <i> Eau De Coli </i> done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
<html> <img style="box-shadow:none; margin-bottom:-1em; img src="https://2013.igem.org/File:Tn-2013_MeSA_path.jpg" alt="MeSA pathway" /><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:56:02Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work <i> Eau De Coli </i> done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
</html> <img style="box-shadow:none; margin-bottom:-1em; img src="https://2013.igem.org/File:Tn-2013_MeSA_path.jpg" alt="MeSA pathway" /><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:53:00Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work Eau De Coli done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
<img style="box-shadow:none; margin-bottom:-1em; src="https://2013.igem.org/File:Tn-2013_MeSA_path.jpg" alt="MeSA pathway" /><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:51:30Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work Eau De Coli done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
<img style="box-shadow:none; margin-bottom:-1em;"src="https://2013.igem.org/File:Tn-2013_MeSA_path.jpg" alt="MeSA pathway" /><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/File:Tn-2013_MeSA_path.jpgFile:Tn-2013 MeSA path.jpg2013-09-19T20:50:22Z<p>TULIO007: </p>
<hr />
<div></div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:49:02Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work Eau De Coli done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. </p><br />
<br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-19T20:47:47Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Project/Ethylene&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<div class="container"><br />
<div class="sheet"><br />
<h1>Results - Methyl Salicylate </h1><br />
<p> <br />
While the choice for the molecule to induce the ripening process was quiet easy because the quantities and the effects of ethylene on plants and on both climacteric and nonclimateric fruits are largely described in literature, was harder to find a synthesizable substance able to block the fruits’ ripening. This is due to the fact that most of the molecule reported to inhibit the maturation are toxic or they have a terrible smell (this is the case of putrescine and cadaverin). Moreover we were searching for a volatile molecule in order to reach the fruit from the bacteria without contact of these two. <br />
After long discussions and researches we finally ran into some papers that present the effects of Methyl Salicylate (MeSA) in inhibit fruit maturation. So, the choice to produce this organic ester was made. <br />
To produce it we have decided to exploit the work Eau De Coli done by the MIT IGEM Team 2006 (<a> http://openwetware.org/wiki/IGEM:MIT/2006/Blurb </a>) that exploited the pathway shown in the picture that starts from chorismate, a metabolic intermediate of the Shikimate pathway. <br />
</div><br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:39:46Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" https://2013.igem.org/File:Tn-2013-pedro_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:38:40Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" width="328" height=" 382" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:34:54Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" width="100" height=" 75" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:34:03Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" width="500" height=" 375" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:33:19Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" width="1000" height=" 750" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:31:00Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" width="50%" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/Team:UNITN-Trento/TeamTeam:UNITN-Trento/Team2013-09-15T21:27:18Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
<!--CSS--><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/About_pages&action=raw&ctype=text/css" type="text/css" /><br />
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/CSS/Team&action=raw&ctype=text/css" type="text/css" /><br />
<br />
<!--JS--><br />
<script src="https://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/JS/Team&action=raw&ctype=text/javascript"></script><br />
<br />
<div class="container"><br />
<!--Person1--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-bruno_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Bruno Aor</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Brunoide<br />
</p><br />
<p><br />
<b>Description:</b> A swimmer and tango dancer with a passion for the worst "tunz tunz" music. He is a die hard fan of Star Wars and the only woman that he truly loves is his motorcycle "Alice".<br />
</p><br />
<p><br />
<b>Skills:</b> The MacGyver of biology, he built the Ripenator with only an hairpin and some chewing gum.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Allergic to all fruit.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He used 5 &micro;l of Phusion DNApol for each PCR (the most expensive protocol ever...)<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/2/26/Tn-2013-Ba_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5a/Tn-2013-bruno_face_2.jpg" /><br />
</div><br />
<br />
<!--Person2--><br />
<div class="sheet left"><br />
<span class="title">Fabio Digiacomo</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Fd_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/20/Tn-2013-Fd_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Fabius<br />
</p><br />
<p><br />
<b>Description:</b> The american guy nostalgic for the 90's stars like Britney Spears. He is trying to create a blue light LED disco in the Lab.<br />
</p><br />
<p><br />
<b>Skills:</b> He could sell a comb to Vin Diesel! Our Vending Machine and designer, with a Master in Paint Programmation!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Strawberry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He put the transformed cells at 0&deg;C instead of 37&deg;C.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/55/Tn-2013-fabio_photo.jpg" /><br />
<br />
<!--person3--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/a/a5/Tn-2013-gire_photo.jpg" /><br />
<div class="sheet right"><br />
<span class="title">Gabriele Girelli</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Gire<br />
</p><br />
<p><br />
<b>Description:</b> The king of the notebook (he changes this page at least 3 times a day)!<br />
</p><br />
<p><br />
<b>Skills:</b> Computer programming have no more secrets for him and for his lovely cat (it is called Dylan, Dylan Cat, by the way…). He is the chief of the wiki and the father of SAM synthetase.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Melon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Prepared the Petri plates with very little LB-agar and all the cells starved to death ( sooo sad D: ).<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/e/e0/Tn-2013-Gg_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/5/5e/Tn-2013-Gg_face_b.jpg" /><br />
</div><br />
<br />
<!--Person4--><br />
<div class="sheet left"><br />
<span class="title">Caterina Marchioretti</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/59/Tn-2013-Cm_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/b/b4/Tn-2013-Cm_face_b.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Katekillah<br />
</p><br />
<p><br />
<b>Description:</b> Loves working with pipettes and listening to every kind of bad music. She is passionate for politics as for science.<br />
</p><br />
<p><br />
<b>Skills:</b> The guardian angel of the team. She is always present for advice and to comfort everyone who has failed. We are not able to list all the things that she has done in the lab because from the early beginning she was working as a crazy monkey!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Peach.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She prepared one litre of LB-agar instead of LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/5/56/Tn-2013-cate_photo.JPG" /><br />
<br />
<!--person5--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/7/79/Tn-2013_Pedro_GC.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Michele Pedrotti</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Pedro<br />
</p><br />
<p><br />
<b>Description:</b> The philosopher and animal party guy with many energies and existential problems! In every dread of him you can find many cool ideas and some <i>B. fruity</i>.<br />
</p><br />
<p><br />
<b>Skills:</b> He gladdens the lab with reggae music and pearls of wisdom during the most difficult days. He can stay awake for many days to make experiments and characterisations.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Watermelon.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Tried to elute a few grams of salicylic acid in a very small volume of water.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/b/b0/Tn-2013-Mp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/9/9a/Tn-2013-Mp_face_2.jpg" /><br />
</div><br />
<br />
<!--Person6--><br />
<div class="sheet left"><br />
<span class="title">Thomas Perli</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/6/66/Tn-2013-Tp_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/0/00/Tn-2013-Tp_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Xli<br />
</p><br />
<p><br />
<b>Description:</b> The sporty man able to run faster than DNA during the electrophoresis. He had a great disappointment when we abandoned our project E. Trippy but with his onnipresence he saved the team more than once!<br />
</p><br />
<p><br />
<b>Skills:</b> With his decrepit Mac he is still able to design primers! Our electrical engineering, snowboarder, and ethylene expert!<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Tomato.<br />
</p><br />
<p><br />
<b>Epic fail:</b> Added the wrong sequencing primer.<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" src="https://static.igem.org/mediawiki/2013/0/02/Tn-2013-thomas_photo.jpg" /><br />
<br />
<!--person7--><br />
<img class="lab left" src="https://static.igem.org/mediawiki/2013/d/d5/Tn-2013-emil_photo.JPG" /><br />
<div class="sheet right"><br />
<span class="title">Emil Tonon</span><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> ET<br />
</p><br />
<p><br />
<b>Description:</b> A guy with many skills among them SINGING! A little bit hypochondriac so: don’t drink ethidium bromide in his presence! Just kidding, of course.<br />
</p><br />
<p><br />
<b>Skills:</b> 10Tb of memory: Emil is the big boss of the knowledge! He passes many hours in lab with his baby Bacillus and tells them stories about dinosaurs and the origins of life.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> "Stark delicious" apple.<br />
</p><br />
<p><br />
<b>Epic fail:</b> He induced with IPTG the xilose-inducible promoter.<br />
</p><br />
</div><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/5/50/Tn-2013-Et_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/2/27/Tn-2013-emil_face_2.jpg" /><br />
</div><br />
<br />
<!--person8--><br />
<div class="sheet left"><br />
<span class="title">Viola Valentini</span><br />
<img class="profile" src="https://static.igem.org/mediawiki/2013/1/1d/Tn-2013-Vv_face.jpg" /><img class="profile foto-2" style="display: none;" src="https://static.igem.org/mediawiki/2013/7/7b/Tn-2013-Vv_face_2.jpg" /><br />
<div class="data"><br />
<p><br />
<b>Nickname:</b> Birubiru<br />
</p><br />
<p><br />
<b>Description:</b> The flower of the team, she became a superstar after her first video on youtube “Zozzoni”.<br />
</p><br />
<p><br />
<b>Skills:</b> She is always cheerful and positive and she surely will become a loving mother, as we have seen in these few months with her baby bacillus.<br />
</p><br />
<p><br />
<b>Favourite fruite:</b> Cherry.<br />
</p><br />
<p><br />
<b>Epic fail:</b> She put the transformed cells with the only copy of the plasmid for Bacillus that we have in the shaker, without LB...<br />
</p><br />
</div><br />
</div><br />
<img class="lab right" style="margin-left:1em!important;" src="https://static.igem.org/mediawiki/2013/0/0b/Tn-2013-viola_photo.jpg" /><br />
<br />
</div><br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/3/3d/Tn-2013-headerbg-Sfondowm.jpg</html>|<html>https://static.igem.org/mediawiki/2013/1/10/Tn-2013-headerbgSfondowm_or.jpg</html>}}</div>TULIO007http://2013.igem.org/File:Tn-2013_Pedro_GC.JPGFile:Tn-2013 Pedro GC.JPG2013-09-15T21:26:20Z<p>TULIO007: </p>
<hr />
<div></div>TULIO007http://2013.igem.org/Team:UNITN-Trento/Project/Methyl_SalicylateTeam:UNITN-Trento/Project/Methyl Salicylate2013-09-10T14:34:53Z<p>TULIO007: </p>
<hr />
<div><!--NEW PAGE--><br />
{{:Team:UNITN-Trento/Templates/Default|<html><!--start content--><br />
<br />
:D MeSA PAGE :D <br />
<br />
<!--end content--></html>|<html>https://static.igem.org/mediawiki/2013/1/1f/Tn-2013-headerbg-Sfondoch.jpg</html>|<html>https://static.igem.org/mediawiki/2013/c/c1/Tn-2013-headerbg-Sfondoch_or.jpg</html>}}</div>TULIO007