http://2013.igem.org/wiki/index.php?title=Special:Contributions/Kcrk&feed=atom&limit=50&target=Kcrk&year=&month=2013.igem.org - User contributions [en]2024-03-29T01:51:39ZFrom 2013.igem.orgMediaWiki 1.16.5http://2013.igem.org/Team:Westminster/AttributionsTeam:Westminster/Attributions2014-09-28T18:03:07Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<br />
<div class="container"><br />
<div class="well"><br />
<h1 dir="ltr"><u>Attributions</u></h1><br />
<br />
<h2><u>Supervisor</u></h2><br />
<br />
<p dir="ltr">Dr Mark Clements, Department of Molecular and Applied Biosciences. Supervisor.</p><br />
<br />
<p dir="ltr">Louise Usher: PhD student in molecular biology. Role: Lab Supervisor, research and helped&nbsp;with sponsorship.</p><br />
<br />
<p dir="ltr">Silvia Berciano: Research </p><br />
<br />
<p>Armaghan Azizi: Helped with the training in the lab.</p><br />
<br />
<h2><u>Sponsors:</u></h2><br />
<br />
<p>Mantis: Sponsored &pound;175 as well as supplying the bed bugs.</p><br />
<br />
<p>UCL: Modelling, helped with the Synthetic Biology speed debate.</p><br />
<br />
<p>Frank Sargeant: Supplied the chitanase gene from the bacteria <em>Serratia marcescens.</em></p><br />
<br />
<h2 dir="ltr"><strong>Team Member Roles:</strong></h2><br />
<br />
<p dir="ltr">Tom Bridge: Research, Lab work, Public Relations, Obtaining sponsorship.</p><br />
<br />
<p>Hira Khan: Research, Public Relations, Managing Log Book</p><br />
<br />
<p>Chris Kortschak: Created the wiki, lab work.</p><br />
<br />
<p>Mohit Santi: Research, Lab work, Modelling</p><br />
<br />
<p>Caroline Champion: Research, Managing social network (Twitter)</p><br />
<br />
<p>Krunal Polra: Creating the parts, lab work, obtaining sponsorship.</p><br />
<br />
<p>Aishwarya Saxena: Research on the background of bed bugs.</p><br />
<br />
<p>Zeljka Kalinic: Public Relations, Human Practice, lab work.</p><br />
<br />
<p>Yusuf Demir: Research</p><br />
</div><br />
</div><br />
</html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Europe/During-Jamboree/Practice-SessionsEurope/During-Jamboree/Practice-Sessions2013-10-10T16:11:00Z<p>Kcrk: </p>
<hr />
<div>{{Regional Europe 2013 mainmenubar}}<br />
<br />
<html><br />
<b>Friday Night Practice Sessions</b><br />
<p><br />
Please use this sign-up sheet to book a 30-minute time slot to practice your presentation. Pick up your favorite bacterium genus and appropriate time slot, log in with your user account and edit this wiki page. <br />
<br><br><br />
Ten practice rooms will be available from 5pm to 8pm on Friday with 30-minute time slots. Every team should be able to fit in, but if you really don't have a choice and need to practice your presentation after 8pm or during a time slot that's already completed, we'll try to come up with something. Please <a href ="https://2013.igem.org/Europe/Contact">contact us</a> in case of need.<br />
<br><br><br />
Every practice room will be equipped with a standard video projector. Please make sure to bring your own computer and appropriate cables to set things up.<br />
<br><br><br />
And last but not least, we are pretty sure that you would not enjoy losing time when you get to the practice room and find out that you have to wait because the previous team is late on schedule, so be sure arrive and leave on time. Thank you.<br />
</p><br />
</html><br />
<br />
{| class="wikitable"<br />
|- style="height:25px;"<br />
! |<br />
! colspan="10" style="font-style:normal;"| Practice Rooms <br />
|- style="height:25px;"<br />
! | !! | Agrobacterium !! Bacillus !! | Collimonas !! | Dickeya !! | Escherichia !! | Fusobacter !! | Gemmobacter !! | Helicobacter !! | Ignicoccus !! | Jannaschia<br />
|-<br />
! scope="row"| 5:00-5:30pm<br />
| Braunschweig || Newcastle || SDU-Denmark || TU-Munich || METU || Bielefeld-Germany || TU-Delft || Leeds || DTU-Denmark || INSA Toulouse<br />
|-<br />
! scope="row"| 5:30-6:00pm<br />
| A2 || Göttingen || ITU_MOBGAM_turkey || KU_Leuven || UGent || F2 || Paris_Saclay || UniSalento Lecce || I2 || York_UK<br />
|-<br />
! scope="row"| 6:00-6:30pm<br />
| Uppsala || Edinburgh || Warsaw || Valencia_Biocampus || Exeter || TU Eindhoven || G3 || NRP-UEA-Norwich || Imperial College London || Baskent_Meds<br />
|-<br />
! scope="row"| 6:30-7:00pm<br />
| A4 || B4 || Kent || D4 || BGU_Israel || ATOMS-Turkiye || Valencia-CIPF|| H4 || I4 || UCL post-grad<br />
|-<br />
! scope="row"| 7:00-7:30pm<br />
| Westminster || Bonn || C5 || Grenoble-EMSE-LSU || ETH Zurich || Wageningen UR || G5 || Evry || EPF_Lausanne || Freiburg<br />
|-<br />
! scope="row"| 7:30-8:00pm<br />
| UNIK_Copenhagen || UNITN-Trento || Poznan-BioInf || Paris_Bettencourt || Manchester || Groningen || Leicester || Heidelberg || Dundee || UCL undergrad<br />
|-<br />
|}</div>Kcrkhttp://2013.igem.org/Europe/During-Jamboree/Practice-SessionsEurope/During-Jamboree/Practice-Sessions2013-10-10T16:10:38Z<p>Kcrk: Undo revision 317985 by Kcrk (talk)</p>
<hr />
<div>{{Regional Europe 2013 mainmenubar}}<br />
<br />
<html><br />
<b>Friday Night Practice Sessions</b><br />
<p><br />
Please use this sign-up sheet to book a 30-minute time slot to practice your presentation. Pick up your favorite bacterium genus and appropriate time slot, log in with your user account and edit this wiki page. <br />
<br><br><br />
Ten practice rooms will be available from 5pm to 8pm on Friday with 30-minute time slots. Every team should be able to fit in, but if you really don't have a choice and need to practice your presentation after 8pm or during a time slot that's already completed, we'll try to come up with something. Please <a href ="https://2013.igem.org/Europe/Contact">contact us</a> in case of need.<br />
<br><br><br />
Every practice room will be equipped with a standard video projector. Please make sure to bring your own computer and appropriate cables to set things up.<br />
<br><br><br />
And last but not least, we are pretty sure that you would not enjoy losing time when you get to the practice room and find out that you have to wait because the previous team is late on schedule, so be sure arrive and leave on time. Thank you.<br />
</p><br />
</html><br />
<br />
{| class="wikitable"<br />
|- style="height:25px;"<br />
! |<br />
! colspan="10" style="font-style:normal;"| Practice Rooms <br />
|- style="height:25px;"<br />
! | !! | Agrobacterium !! Bacillus !! | Collimonas !! | Dickeya !! | Escherichia !! | Fusobacter !! | Gemmobacter !! | Helicobacter !! | Ignicoccus !! | Jannaschia<br />
|-<br />
! scope="row"| 5:00-5:30pm<br />
| Braunschweig || Newcastle || SDU-Denmark || TU-Munich || METU || Bielefeld-Germany || TU-Delft || Leeds || DTU-Denmark || INSA Toulouse<br />
|-<br />
! scope="row"| 5:30-6:00pm<br />
| A2 || Göttingen || ITU_MOBGAM_turkey || KU_Leuven || UGent || F2 || Paris_Saclay || UniSalento Lecce || I2 || York_UK<br />
|-<br />
! scope="row"| 6:00-6:30pm<br />
| Uppsala || Edinburgh || Warsaw || Valencia_Biocampus || Exeter || TU Eindhoven || G3 || NRP-UEA-Norwich || Imperial College London || Baskent_Meds<br />
|-<br />
! scope="row"| 6:30-7:00pm<br />
| A4 || B4 || Kent || D4 || BGU_Israel || ATOMS-Turkiye || Valencia-CIPF|| H4 || I4 || UCL post-grad<br />
|-<br />
! scope="row"| 7:00-7:30pm<br />
| A5 || Bonn || C5 || Grenoble-EMSE-LSU || ETH Zurich || Wageningen UR || G5 || Evry || EPF_Lausanne || Freiburg<br />
|-<br />
! scope="row"| 7:30-8:00pm<br />
| UNIK_Copenhagen || UNITN-Trento || Poznan-BioInf || Paris_Bettencourt || Manchester || Groningen || Leicester || Heidelberg || Dundee || UCL undergrad<br />
|-<br />
|}</div>Kcrkhttp://2013.igem.org/Europe/During-Jamboree/Practice-SessionsEurope/During-Jamboree/Practice-Sessions2013-10-10T16:09:43Z<p>Kcrk: </p>
<hr />
<div>{{Regional Europe 2013 mainmenubar}}<br />
<br />
<html><br />
<b>Friday Night Practice Sessions</b><br />
<p><br />
Please use this sign-up sheet to book a 30-minute time slot to practice your presentation. Pick up your favorite bacterium genus and appropriate time slot, log in with your user account and edit this wiki page. <br />
<br><br><br />
Ten practice rooms will be available from 5pm to 8pm on Friday with 30-minute time slots. Every team should be able to fit in, but if you really don't have a choice and need to practice your presentation after 8pm or during a time slot that's already completed, we'll try to come up with something. Please <a href ="https://2013.igem.org/Europe/Contact">contact us</a> in case of need.<br />
<br><br><br />
Every practice room will be equipped with a standard video projector. Please make sure to bring your own computer and appropriate cables to set things up.<br />
<br><br><br />
And last but not least, we are pretty sure that you would not enjoy losing time when you get to the practice room and find out that you have to wait because the previous team is late on schedule, so be sure arrive and leave on time. Thank you.<br />
</p><br />
</html><br />
<br />
{| class="wikitable"<br />
|- style="height:25px;"<br />
! |<br />
! colspan="10" style="font-style:normal;"| Practice Rooms <br />
|- style="height:25px;"<br />
! | !! | Agrobacterium !! Bacillus !! | Collimonas !! | Dickeya !! | Escherichia !! | Fusobacter !! | Gemmobacter !! | Helicobacter !! | Ignicoccus !! | Jannaschia<br />
|-<br />
! scope="row"| 5:00-5:30pm<br />
| Braunschweig || Newcastle || SDU-Denmark || TU-Munich || METU || Bielefeld-Germany || TU-Delft || Leeds || DTU-Denmark || INSA Toulouse<br />
|-<br />
! scope="row"| 5:30-6:00pm<br />
| A2 || Göttingen || ITU_MOBGAM_turkey || KU_Leuven || UGent || F2 || Paris_Saclay || UniSalento Lecce || I2 || York_UK<br />
|-<br />
! scope="row"| 6:00-6:30pm<br />
| Uppsala || Edinburgh || Warsaw || Valencia_Biocampus || Exeter || TU Eindhoven || G3 || NRP-UEA-Norwich || Imperial College London || Baskent_Meds<br />
|-<br />
! scope="row"| 6:30-7:00pm<br />
| Westminster || B4 || Kent || D4 || BGU_Israel || ATOMS-Turkiye || Valencia-CIPF|| H4 || I4 || UCL post-grad<br />
|-<br />
! scope="row"| 7:00-7:30pm<br />
| A5 || Bonn || C5 || Grenoble-EMSE-LSU || ETH Zurich || Wageningen UR || G5 || Evry || EPF_Lausanne || Freiburg<br />
|-<br />
! scope="row"| 7:30-8:00pm<br />
| UNIK_Copenhagen || UNITN-Trento || Poznan-BioInf || Paris_Bettencourt || Manchester || Groningen || Leicester || Heidelberg || Dundee || UCL undergrad<br />
|-<br />
|}</div>Kcrkhttp://2013.igem.org/Team:WestminsterTeam:Westminster2013-10-05T03:59:54Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
<div id="myCarousel" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Hitbug</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide3.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1></h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide2.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1></h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<a href="https://2013.igem.org/Team:Westminster/Team"><br />
<img src="http://www.westminsterigem.org/2013/img/team-hitbug-wide.png" alt="" style="margin-left: auto; margin-right: auto"><br />
<br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Meet the Team</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel" data-slide="prev">‹</a><br />
<a class="right carousel-control" href="#myCarousel" data-slide="next">›</a><br />
</div><br />
</div><br />
<br />
<br />
<div class="container"><br />
<div class="row"><br />
<div class="well"><br />
<p>We are a group of 1st, 2nd and final year undergraduates studying Molecular Biology and Genetics, Biochemical Engineering and Biotechnology. A growing trend in increased insecticide resistance has been observed in both agriculture and the public health sector. Many chemicals currently in use are ineffective and are in fact exacerbating the situation. Thus, novel strategies that reduce the pressure for development of chemical resistance are required, and syn-bio may offer a feasible, target specific solution. After researching some possible project ideas, this year we have decided to focus on developing a syn-bio solution to the worlds’ bed bug problem. </p><br />
<p>This year the Westminster iGEM team are tackling the growing bed bug problem. Serratia marcescens has been identified as an efficient chitin degrader, however as it is a pathogenic organism it can not be used as a biocontrol agent. Our idea is to use the chitin genes from this bacterium and create a chitin degrading E.coli. We will test the efficiency of the activity of chitinase which is expressed by our engineered E.coli compared to that of S. marcescens by using a chitin azure assay. </p><br />
<p><br />
<a class="btn btn-default" href="https://2013.igem.org/Team:Westminster/Description">More »</a><br />
</p><br />
</div><br />
</div><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:WestminsterTeam:Westminster2013-10-05T03:59:28Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
<div id="myCarousel" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Hitbug</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide2.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1></h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<a href="https://2013.igem.org/Team:Westminster/Team"><br />
<img src="http://www.westminsterigem.org/2013/img/team-hitbug-wide.png" alt="" style="margin-left: auto; margin-right: auto"><br />
<br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Meet the Team</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel" data-slide="prev">‹</a><br />
<a class="right carousel-control" href="#myCarousel" data-slide="next">›</a><br />
</div><br />
</div><br />
<br />
<br />
<div class="container"><br />
<div class="row"><br />
<div class="well"><br />
<p>We are a group of 1st, 2nd and final year undergraduates studying Molecular Biology and Genetics, Biochemical Engineering and Biotechnology. A growing trend in increased insecticide resistance has been observed in both agriculture and the public health sector. Many chemicals currently in use are ineffective and are in fact exacerbating the situation. Thus, novel strategies that reduce the pressure for development of chemical resistance are required, and syn-bio may offer a feasible, target specific solution. After researching some possible project ideas, this year we have decided to focus on developing a syn-bio solution to the worlds’ bed bug problem. </p><br />
<p>This year the Westminster iGEM team are tackling the growing bed bug problem. Serratia marcescens has been identified as an efficient chitin degrader, however as it is a pathogenic organism it can not be used as a biocontrol agent. Our idea is to use the chitin genes from this bacterium and create a chitin degrading E.coli. We will test the efficiency of the activity of chitinase which is expressed by our engineered E.coli compared to that of S. marcescens by using a chitin azure assay. </p><br />
<p><br />
<a class="btn btn-default" href="https://2013.igem.org/Team:Westminster/Description">More »</a><br />
</p><br />
</div><br />
</div><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-05T03:58:30Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/table.js"></script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="http://www.westminsterigem.org/2013/diary.html">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="http://www.westminsterigem.org/2013/notebook.html">Notebook</a></li><br />
<br />
<li><a href="http://www.westminsterigem.org/2013/protocols.html">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="http://www.westminsterigem.org/2013/outreach.html">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-05T03:53:08Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/table.js"></script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Diary">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="http://www.westminsterigem.org/2013/notebook.html">Notebook</a></li><br />
<br />
<li><a href="https://2013.igem.org/Team:Westminster/Protocols">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Outreach">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/DescriptionTeam:Westminster/Description2013-10-05T03:52:00Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<p><strong>Bed Bugs</strong></p><br />
<br />
<p>Bed bugs have had a long intertwined history with the human world causing a lot of nuisance and disturbance at our homes. Historically it is believed that during the 1940s they were eradicated in the developed world, but in 1995 there has been an increase in their prevalence.</p><br />
<br />
<p>Bed bugs are scientifically called <em>Cimex lectularius </em>and are parasitic on human beings. In general the entire organisms from the Cimicidae family are generally parasitic and specialize to various other organisms. They feed on the blood of warm blooded animals also termed as hematophagy. <em>Cimex lectularius </em>are one such parasitic organism. These are attracted to their host by warmth and CO2 and are very well adapted to the human environment, mostly found in temperate climates.</p><br />
<br />
<p><em>C. lectularius</em> are small wingless insects that have an oval flattened appearance. They reproduce through traumatic insemination also called hypodermic insemination, where insemination takes place through the body wall, into the body cavity by physical breaching of the epidermis. Males have a hypodermic genitalia that pierces on the abdomen of the female and ejaculates sperm into the body cavity. As these sperm diffuses inside the cavity they reach the ovaries and results in fertilisation. The females can lay 5 eggs in a day and 500 eggs during her lifetime. Eggs are about 1mm long with a milky white tinge and can take 2 weeks to hatch. There are 5 molting stages before they reach maturity.&nbsp; New-borns are called hatchlings or nymphs and are about the size of poppy seeds. The nymphs start feeding as soon as they hatch and they require one feed in each molting stage. They take about 5 weeks to reach maturity at room temperature environment. Both nymphs and adults are visible from naked eye and there colour might vary from white, light tan to a deep tan or burnt orange. Adults grow about &frac14; of an inch long. Female lays 5 eggs in one day and about 500 during her lifetime. Bed bugs can cause adverse health effects to human beings like skin rashes, psychological effects and allergic symptoms.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>What is chitin?</strong></p><br />
<br />
<p>Chitin(C8H13O5N)n is a modified polysaccharide which contains nitrogen. It is an abundant polymer found ubiquitously in nature and consists of long chains of N-acetylglucosamine, a derivative of glucose and is similar to cellulose in structure. It forms the main cell wall of many fungi, the exoskeleton of insects and crustaceans (such as crab, lobster and shrimps), the beak and internal shell of cephalopods and the radulas of molluscs. Hydrogen bonding between adjacent polymers gives chitin-polymer matrix increased strength.</p><br />
<br />
<p>In insects, chitin is often modified and embedded in sclerotin (a proteinaceous matrix which forms much of the exoskeleton). This composite material may also be combined with calcium carbonate to produce the much stronger composite of crustacean shells.</p><br />
<br />
<p><strong><em>Serratia marcescens</em></strong></p><br />
<br />
<p>Serratia belong to the family Enterobacteriaceae. They are gram negative rod shaped bacteria and are common of many environments from soil, bathroom showers and as a biofilm on teeth. &nbsp;Isolates are also known to be pathogenic to humans.&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Chitinases from <em>Serratia marcescens</em></strong></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>We were kindly gifted the three chitinase genes isolated from <em>S. marcenscens</em> by Prof. Frank Sargent of the Dundee iGEM 2013 team (<a href="http://www.lifesci.dundee.ac.uk/people/frank-sargent">http://www.lifesci.dundee.ac.uk/people/frank-sargent</a>). In 1969, J.Monreal and E. Reese &nbsp;found that <em>S. marcescens </em>was the most efficient chitin degrader among 100s of other microorganisms. &nbsp;We therefore decided to design a chitinase expressing<em> E.coli which would attach out bed bugs.</em></p><br />
<br />
<p><img src="http://www.westminsterigem.org/2013/img/hitbug-1.png" style="height:367px; width:523px" /></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Mechanism of chitinase activity </strong></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>There are three main enzymes involved in Chitin degradation in <em>S. marcescens</em>. These have been designated as Chitinase A (ChiA), Chitinase B (ChiB) and Chitinase C (ChiC) Another molecule, CBP21, is also involved in chitin degradation.</p><br />
<br />
<p>ChiA and ChiB primarily bind to chain ends (exo-action). The protein structure of ChiA and ChiB reveals that carbohydrate binding domains are opposite in the 2 enzymes suggesting the two enzymes degrade the polymer from different ends, ChiA from the reducing end and ChiB from the non-reducing end.&nbsp;&nbsp; Chi C on the other hand is an endo-acting non progressive chitinase which attacks the chitin polymer by making random cuts in the more amorphous regions of the substrate opening these regions for attacks from ChiA and ChiB. ChiA and ChiB are progressive chitinase&rsquo;s which degrade chitin from opposite ends.</p><br />
<br />
<p>The chitinases cleave the substrate (insoluble polysaccharide) at the &alpha; and&nbsp; &beta;-1,4 bonds in chitin and chito-oligosaccharides producing chitobiose.</p><br />
<br />
<p><img src="http://www.westminsterigem.org/2013/img/hitbug-2.png" style="height:296px; width:618px" /></p><br />
<br />
<p>REFERENCE</p><br />
<br />
<p>Vaaje-Kolstad, G., Horn, S.J., S&oslash;rlie, M., Eijsink, V.G.H., (2013). The chitinolytic machinery of Serratia marcescens--a model system for enzymatic degradation of recalcitrant polysaccharides.&nbsp;<em>The FEBS Journal.&nbsp;</em><strong>280&nbsp;</strong>(13), 3028. <a href="http://onlinelibrary.wiley.com/doi/10.1111/febs.12181/pdf">http://onlinelibrary.wiley.com/doi/10.1111/febs.12181/pdf</a></p><br />
<br />
<p>Site-directed Mutagenisis</p><br />
<br />
<p>One of the most common methods for removing restrinction sites withing gene sequences is to use site-directed mutagenisis &ndash; such as the Stratagen method. The Stratagene method uses a forward primer which is 25-45 bases in length and contains the mutation in the centr of the primer sequence. The reverse primer is the complement of this primer. Primers have a minimum GC content of 40% and end in one or more C&rsquo;s or G&rsquo;s.</p><br />
<br />
<p>A high-fidelity long range polymerase is required as the whole plasmid is copied in the reaction. The reaction can be visualised as below.</p><br />
<br />
<p>Site-directed Mutagenisis</p><br />
<br />
<p>One of the most common methods for removing restrinction sites withing gene sequences is to use site-directed mutagenisis &ndash; such as the Stratagen method. The Stratagene method uses a forward primer which is 25-45 bases in length and contains the mutation in the centr of the primer sequence. The reverse primer is the complement of this primer. Primers have a minimum GC content of 40% and end in one or more C&rsquo;s or G&rsquo;s.</p><br />
<br />
<p>A high-fidelity long range polymerase is required as the whole plasmid is copied in the reaction. The reaction can be visualised as below.</p><br />
<br />
<p><img alt="Text Box: 1. Plasmid template DNA is denatured allowing for annealing of the mutagenic primers to their respective strand. Extension and incorporation of the mutagenic primer occurs.2. Results in mutated and non-mutated (template containing) plasmids. 3. Template plasmid is degraded using DpnI.4. Remaining mutated plasmid is transformed. " src="http://www.westminsterigem.org/2013/img/hitbug-3.png" style="height:253px; width:415px" /><img alt="http://www.genomics.agilent.com/files/Media/Pid24_P2.jpg" src="http://www.westminsterigem.org/2013/img/2_1.jpg" style="height:262px; width:164px" /></p><br />
<br />
<p>Site-directed mutagenisis using overlapping primers</p><br />
<br />
<p>This protocol consists of a tw-step PCR reaction. Mutagenic primers were designed as for the stratagene method. Additionally, forward and reverse primers contining the biobrick prefix and suffix were designed.</p><br />
<br />
<p>PCR reactions using Pfupolymerase was set up. For PCR- A, primers consisted on the forward/prifix primer and the reverse/mutagenic primer. PCR-B consisted of forward/mutagenic primer and reverse/suffix primer. Thus, PCR-A amplified the part upstreamof the mutation site and PCR-B the downstream part of the mutation site f the gene.</p><br />
<br />
<p>The PCR reaction was then run on a gel and the DNA gel extracted. For the second PCR, 2&micro;l of each PCR was added to a mastermix without primers and PCR amplified for 10 cycles. The DNA templates contain overlapping regions which self-prime allowing for extension of the full length of the gene, creating tempate DNA.</p><br />
<br />
<p>After the 10 cycles, primers for the outer regions are added. This ensures amplification of the full gene.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><img src="http://www.westminsterigem.org/2013/img/2_3.png" style="height:438px; width:645px" /></p><br />
<br />
<p>Mutagenic primers are designed as for the stratagene method, using Primer X <a href="http://bioinformatics.org/primerx/">http://bioinformatics.org/primerx/</a>.</p><br />
<br />
<table border="1" cellpadding="0" cellspacing="0" style="width:631px"><br />
<tbody><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiA-Fwd-Main gtttcttcgaattcgcggccgcttctagatgcgcaaatttaataaaccgctgttgg</strong></p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiA&nbsp;-Rev-Main&nbsp; gtttcttcctgcagcggccgctactagtattgaacgccggcgctattgcc&nbsp;&nbsp;</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiB-Fwd-Main&nbsp;&nbsp; gtttcttcgaattcgcggccgcttctagatgtccacacgtaaagcggttattgg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiB-Rev-Main gtttcttcctgcagcggccgctactagtacgccacgcggcccacc</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiC-Fwd-Main gtttcttcgaattcgcggccgcttctagatgagcacaaataacattattaatgccgtcg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiC-Rev-Main gtttcttcctgcagcggccgctactagtaggcgatgagctgccagagg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td colspan="2" style="width:631px"><br />
<p><strong>NOTE: The reverse primers have had the stop codon removed. </strong></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<p>&nbsp;</p><br />
<br />
<table border="1" cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiA-Fwd-Muta&nbsp; GTAAAAGAGTTCCTGCAAACCTGGAAGTTCTTCG</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiA-Rev-Muta&nbsp; CGAAGAACTTCCAGGTTTGCAGGAACTCTTTTAC</strong></p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiB-Fwd-Muta&nbsp; GTTTCATCGCCGCGCTCCAGGAGATCCGCACC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiB-Rev-Muta&nbsp;&nbsp;&nbsp; GGTGCGGATCTCCTGGAGCGCGGCGATGAAAC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiC-Fwd-Muta&nbsp;&nbsp; CAGCATGGCGCCGGAGTTCCCGTATTTGCGC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiC-Rev-Muta GCGCAAATACGGGAACTCCGGCGCCATGCTG</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td colspan="2" style="height:36px; width:616px"><br />
<p><strong>NOTE: Mutagenic primers have been designed to retain the intended amino acid but remove the restriction site</strong></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>REFERENCE:</p><br />
<br />
<p>Kanoksilapatham, W., Gonzalez, J.M., Robb, F.T., (2007). Directed- Mutagenesis and Deletion Generated through an Improved Overlapping- Extension PCR Based Procedure. <em>Silpakorn University Science and Technology Journal. </em><strong>1 </strong>(2), 7. <a href="http://www.journal.su.ac.th/index.php/sustj/article/viewFile/105/112">http://www.journal.su.ac.th/index.php/sustj/article/viewFile/105/112</a></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
</html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/DescriptionTeam:Westminster/Description2013-10-05T03:49:07Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<p><strong>Bed Bugs</strong></p><br />
<br />
<p>Bed bugs have had a long intertwined history with the human world causing a lot of nuisance and disturbance at our homes. Historically it is believed that during the 1940s they were eradicated in the developed world, but in 1995 there has been an increase in their prevalence.</p><br />
<br />
<p>Bed bugs are scientifically called <em>Cimex lectularius </em>and are parasitic on human beings. In general the entire organisms from the Cimicidae family are generally parasitic and specialize to various other organisms. They feed on the blood of warm blooded animals also termed as hematophagy. <em>Cimex lectularius </em>are one such parasitic organism. These are attracted to their host by warmth and CO2 and are very well adapted to the human environment, mostly found in temperate climates.</p><br />
<br />
<p><em>C. lectularius</em> are small wingless insects that have an oval flattened appearance. They reproduce through traumatic insemination also called hypodermic insemination, where insemination takes place through the body wall, into the body cavity by physical breaching of the epidermis. Males have a hypodermic genitalia that pierces on the abdomen of the female and ejaculates sperm into the body cavity. As these sperm diffuses inside the cavity they reach the ovaries and results in fertilisation. The females can lay 5 eggs in a day and 500 eggs during her lifetime. Eggs are about 1mm long with a milky white tinge and can take 2 weeks to hatch. There are 5 molting stages before they reach maturity.&nbsp; New-borns are called hatchlings or nymphs and are about the size of poppy seeds. The nymphs start feeding as soon as they hatch and they require one feed in each molting stage. They take about 5 weeks to reach maturity at room temperature environment. Both nymphs and adults are visible from naked eye and there colour might vary from white, light tan to a deep tan or burnt orange. Adults grow about &frac14; of an inch long. Female lays 5 eggs in one day and about 500 during her lifetime. Bed bugs can cause adverse health effects to human beings like skin rashes, psychological effects and allergic symptoms.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>What is chitin?</strong></p><br />
<br />
<p>Chitin(C8H13O5N)n is a modified polysaccharide which contains nitrogen. It is an abundant polymer found ubiquitously in nature and consists of long chains of N-acetylglucosamine, a derivative of glucose and is similar to cellulose in structure. It forms the main cell wall of many fungi, the exoskeleton of insects and crustaceans (such as crab, lobster and shrimps), the beak and internal shell of cephalopods and the radulas of molluscs. Hydrogen bonding between adjacent polymers gives chitin-polymer matrix increased strength.</p><br />
<br />
<p>In insects, chitin is often modified and embedded in sclerotin (a proteinaceous matrix which forms much of the exoskeleton). This composite material may also be combined with calcium carbonate to produce the much stronger composite of crustacean shells.</p><br />
<br />
<p><strong><em>Serratia marcescens</em></strong></p><br />
<br />
<p>Serratia belong to the family Enterobacteriaceae. They are gram negative rod shaped bacteria and are common of many environments from soil, bathroom showers and as a biofilm on teeth. &nbsp;Isolates are also known to be pathogenic to humans.&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Chitinases from <em>Serratia marcescens</em></strong></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>We were kindly gifted the three chitinase genes isolated from <em>S. marcenscens</em> by Prof. Frank Sargent of the Dundee iGEM 2013 team (<a href="http://www.lifesci.dundee.ac.uk/people/frank-sargent">http://www.lifesci.dundee.ac.uk/people/frank-sargent</a>). In 1969, J.Monreal and E. Reese &nbsp;found that <em>S. marcescens </em>was the most efficient chitin degrader among 100s of other microorganisms. &nbsp;We therefore decided to design a chitinase expressing<em> E.coli which would attach out bed bugs.</em></p><br />
<br />
<p><img src="/userfiles/images/Public Folder/1_1(1).png" style="height:367px; width:523px" /></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Mechanism of chitinase activity </strong></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>There are three main enzymes involved in Chitin degradation in <em>S. marcescens</em>. These have been designated as Chitinase A (ChiA), Chitinase B (ChiB) and Chitinase C (ChiC) Another molecule, CBP21, is also involved in chitin degradation.</p><br />
<br />
<p>ChiA and ChiB primarily bind to chain ends (exo-action). The protein structure of ChiA and ChiB reveals that carbohydrate binding domains are opposite in the 2 enzymes suggesting the two enzymes degrade the polymer from different ends, ChiA from the reducing end and ChiB from the non-reducing end.&nbsp;&nbsp; Chi C on the other hand is an endo-acting non progressive chitinase which attacks the chitin polymer by making random cuts in the more amorphous regions of the substrate opening these regions for attacks from ChiA and ChiB. ChiA and ChiB are progressive chitinase&rsquo;s which degrade chitin from opposite ends.</p><br />
<br />
<p>The chitinases cleave the substrate (insoluble polysaccharide) at the &alpha; and&nbsp; &beta;-1,4 bonds in chitin and chito-oligosaccharides producing chitobiose.</p><br />
<br />
<p><img src="/userfiles/images/Public Folder/1_2.png" style="height:296px; width:618px" /></p><br />
<br />
<p>REFERENCE</p><br />
<br />
<p>Vaaje-Kolstad, G., Horn, S.J., S&oslash;rlie, M., Eijsink, V.G.H., (2013). The chitinolytic machinery of Serratia marcescens--a model system for enzymatic degradation of recalcitrant polysaccharides.&nbsp;<em>The FEBS Journal.&nbsp;</em><strong>280&nbsp;</strong>(13), 3028. <a href="http://onlinelibrary.wiley.com/doi/10.1111/febs.12181/pdf">http://onlinelibrary.wiley.com/doi/10.1111/febs.12181/pdf</a></p><br />
<br />
<p>Site-directed Mutagenisis</p><br />
<br />
<p>One of the most common methods for removing restrinction sites withing gene sequences is to use site-directed mutagenisis &ndash; such as the Stratagen method. The Stratagene method uses a forward primer which is 25-45 bases in length and contains the mutation in the centr of the primer sequence. The reverse primer is the complement of this primer. Primers have a minimum GC content of 40% and end in one or more C&rsquo;s or G&rsquo;s.</p><br />
<br />
<p>A high-fidelity long range polymerase is required as the whole plasmid is copied in the reaction. The reaction can be visualised as below.</p><br />
<br />
<p>Site-directed Mutagenisis</p><br />
<br />
<p>One of the most common methods for removing restrinction sites withing gene sequences is to use site-directed mutagenisis &ndash; such as the Stratagen method. The Stratagene method uses a forward primer which is 25-45 bases in length and contains the mutation in the centr of the primer sequence. The reverse primer is the complement of this primer. Primers have a minimum GC content of 40% and end in one or more C&rsquo;s or G&rsquo;s.</p><br />
<br />
<p>A high-fidelity long range polymerase is required as the whole plasmid is copied in the reaction. The reaction can be visualised as below.</p><br />
<br />
<p><img alt="Text Box: 1. Plasmid template DNA is denatured allowing for annealing of the mutagenic primers to their respective strand. Extension and incorporation of the mutagenic primer occurs.2. Results in mutated and non-mutated (template containing) plasmids. 3. Template plasmid is degraded using DpnI.4. Remaining mutated plasmid is transformed. " src="/userfiles/images/Public Folder/2_2.png" style="height:253px; width:415px" /><img alt="http://www.genomics.agilent.com/files/Media/Pid24_P2.jpg" src="/userfiles/images/Public Folder/2_1.jpg" style="height:262px; width:164px" /></p><br />
<br />
<p>Site-directed mutagenisis using overlapping primers</p><br />
<br />
<p>This protocol consists of a tw-step PCR reaction. Mutagenic primers were designed as for the stratagene method. Additionally, forward and reverse primers contining the biobrick prefix and suffix were designed.</p><br />
<br />
<p>PCR reactions using Pfupolymerase was set up. For PCR- A, primers consisted on the forward/prifix primer and the reverse/mutagenic primer. PCR-B consisted of forward/mutagenic primer and reverse/suffix primer. Thus, PCR-A amplified the part upstreamof the mutation site and PCR-B the downstream part of the mutation site f the gene.</p><br />
<br />
<p>The PCR reaction was then run on a gel and the DNA gel extracted. For the second PCR, 2&micro;l of each PCR was added to a mastermix without primers and PCR amplified for 10 cycles. The DNA templates contain overlapping regions which self-prime allowing for extension of the full length of the gene, creating tempate DNA.</p><br />
<br />
<p>After the 10 cycles, primers for the outer regions are added. This ensures amplification of the full gene.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><img src="/userfiles/images/Public Folder/2_3.png" style="height:438px; width:645px" /></p><br />
<br />
<p>Mutagenic primers are designed as for the stratagene method, using Primer X <a href="http://bioinformatics.org/primerx/">http://bioinformatics.org/primerx/</a>.</p><br />
<br />
<table border="1" cellpadding="0" cellspacing="0" style="width:631px"><br />
<tbody><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiA-Fwd-Main gtttcttcgaattcgcggccgcttctagatgcgcaaatttaataaaccgctgttgg</strong></p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiA&nbsp;-Rev-Main&nbsp; gtttcttcctgcagcggccgctactagtattgaacgccggcgctattgcc&nbsp;&nbsp;</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiB-Fwd-Main&nbsp;&nbsp; gtttcttcgaattcgcggccgcttctagatgtccacacgtaaagcggttattgg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiB-Rev-Main gtttcttcctgcagcggccgctactagtacgccacgcggcccacc</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:329px"><br />
<p><strong>ChiC-Fwd-Main gtttcttcgaattcgcggccgcttctagatgagcacaaataacattattaatgccgtcg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:302px"><br />
<p><strong>ChiC-Rev-Main gtttcttcctgcagcggccgctactagtaggcgatgagctgccagagg</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td colspan="2" style="width:631px"><br />
<p><strong>NOTE: The reverse primers have had the stop codon removed. </strong></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<p>&nbsp;</p><br />
<br />
<table border="1" cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiA-Fwd-Muta&nbsp; GTAAAAGAGTTCCTGCAAACCTGGAAGTTCTTCG</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiA-Rev-Muta&nbsp; CGAAGAACTTCCAGGTTTGCAGGAACTCTTTTAC</strong></p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiB-Fwd-Muta&nbsp; GTTTCATCGCCGCGCTCCAGGAGATCCGCACC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiB-Rev-Muta&nbsp;&nbsp;&nbsp; GGTGCGGATCTCCTGGAGCGCGGCGATGAAAC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td style="width:308px"><br />
<p><strong>ChiC-Fwd-Muta&nbsp;&nbsp; CAGCATGGCGCCGGAGTTCCCGTATTTGCGC</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
<td style="width:308px"><br />
<p><strong>ChiC-Rev-Muta GCGCAAATACGGGAACTCCGGCGCCATGCTG</strong></p><br />
<br />
<p>&nbsp;</p><br />
</td><br />
</tr><br />
<tr><br />
<td colspan="2" style="height:36px; width:616px"><br />
<p><strong>NOTE: Mutagenic primers have been designed to retain the intended amino acid but remove the restriction site</strong></p><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>REFERENCE:</p><br />
<br />
<p>Kanoksilapatham, W., Gonzalez, J.M., Robb, F.T., (2007). Directed- Mutagenesis and Deletion Generated through an Improved Overlapping- Extension PCR Based Procedure. <em>Silpakorn University Science and Technology Journal. </em><strong>1 </strong>(2), 7. <a href="http://www.journal.su.ac.th/index.php/sustj/article/viewFile/105/112">http://www.journal.su.ac.th/index.php/sustj/article/viewFile/105/112</a></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
</html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2013-10-05T03:46:15Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<h1>PROTOCOLS</h1><br />
<br />
<br />
<div class="container"><br />
<h2>Making LB Agar plates</h2><br />
<br />
<ol start="1"><br />
<li>Weigh 7.0g of LB agar.</li><br />
<li>Add 200ml of deionised water into a flask containing the weighed LB agar.</li><br />
<li>Mix well to dissolve the LB agar powder.</li><br />
<li>Autoclave the flask (remember to cover the flask with foil and sponge)</li><br />
<li>After autoclaving, store it in a clean dry space.</li><br />
</ol><br />
<br />
<p>Re-heating agar to prepare plates.</p><br />
<br />
<ol start="1"><br />
<li>&nbsp;Heat the agar in microwave till the LB agar has fully liquidised.</li><br />
<li>Let it cool.</li><br />
<li>&nbsp;Add required antibiotic in a sterile environment and pour the LB on plates.</li><br />
<li>&nbsp;</li><br />
</ol><br />
<br />
<h2>Preparing competent cells &ndash;Top10 stock</h2><br />
<br />
<ol start="1"><br />
<li>Pick single colony of cells from LB agar plate into 10 ml of LB media containing specific antibiotic for the cell type. Grow the culture overnight at 37 ˚C with shaking at 250rpm.</li><br />
<li>Inoculate 200ml of pre-warmed medium (no antibiotic or specific for the cell type) with 10ml of overnight cultures , and grow at 37 ˚C for 60 min, with vigorous shaking at 250rpm or until OD600 is 0.4-0.5</li><br />
<li>Put the flask on ice for 30min. At the same time chill sterile falcon tubes.</li><br />
<li>Aliquot culture into 50ml each 4 x 50ml chilled falcon tubes.</li><br />
<li>Harvest the cells by centrifugation for 7 minutes at 3500rpm, at 4 ˚C and discard the supernatant.</li><br />
<li>Re-suspend cells in each tube in 12.5ml of 0.1M MgCl2&nbsp;</li><br />
<li>Centrifuge for 7 min at 3500rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 25ml of 0.1M CaCl2</li><br />
<li>Incubate cells on ice for 30 min.</li><br />
<li>Centrifuge for 7 min rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 700&micro;l of 0.1M CaCl2&nbsp;and 300&micro;l of 50% glycerol to give a final volume of 1ml in each tube.</li><br />
<li>Aliquot 50&micro;l into 1.5ml sterile micro centrifuge tubes on ice and store at -80˚C.</li><br />
</ol><br />
<br />
<h2>Glycerol stock preparation</h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-sterile 50% glycerol stock</p><br />
<br />
<p>300&micro;l of 50% glycerol is added to 700&micro;l overnight culture in an eppendorf.</p><br />
<br />
<p>Contents were mixed by inverting and immediately stored at -80˚C.</p><br />
<br />
<h2>50% Agarose gel preparation</h2><br />
<br />
<h2>Materials</h2><br />
<br />
<p>-0.5g of agarose weighed and added to 50ml of TAE buffer</p><br />
<br />
<p>&bull; Add a few ml more of the 1X TAE since the buffer will evaporate in the microwave.</p><br />
<br />
<p>Dissolve the agarose in the TAE buffer in the microwave. Ensure all the agarose is completely dissolved. Allow to cool slightly (approx. 60C) and add 1&micro;l of ethidium bromide. Pour gel into gel tray and place comb into position. Ensure there are no bubbles in the gel. Bubbles may be moved to the bottom of the gel using a sterile tip. &nbsp;Allow gel to set completely. Run gel for approx. 1hour at 100volts.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Nanodrop procedure</h1><br />
<br />
<p>Add 1&micro;l of RNAse free water as Blank</p><br />
<br />
<p>Add 1&micro;l of sample to the stage and read.</p><br />
<br />
<p>Ideally want a concentration &gt;100ng/&micro;l and purity (260/289nm) reading close to 1.0</p><br />
<br />
<h2>Preparation of Carbenicillin stock</h2><br />
<br />
<p>50mg/ml stock was prepared as follows:</p><br />
<br />
<p>1g of carbenicillin powder (Sigma product 50mg/ml) was weighed out and dissolved in 10 ml of sterile water. 1ml volumes were aliquotted to eppendorfs and marked with a red stripe and c.</p><br />
<br />
<h2>Preparation of carbenicillin Plates (100&nbsp;&micro;g&nbsp;/ml<span style="font-size:11px">)</span></h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-petri dishes</p><br />
<br />
<p>-200ml autoclaved LB agar</p><br />
<br />
<p>50mg/ml<span style="font-size:11px">&nbsp;</span>carbenicillin stock</p><br />
<br />
<p>Melt LB agar in microwave until completely molten. Allow to cool to approx 60C.</p><br />
<br />
<p>400&micro;l of carbenicillin is added to the 200ml LB agar and approx 20ml poured into each plate.</p><br />
<br />
<p>Allow plates to cool and label the plates with red stripe on side to indicate the type of antibiotic.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Transformation</h1><br />
<br />
<h2>Materials</h2><br />
<br />
<p>- competent cells (1 vial per transformation and 1 for the control)</p><br />
<br />
<p>- antibiotic plates (2 per transformation)</p><br />
<br />
<p>- control plate without antibiotic</p><br />
<br />
<p>- control plasmid (PUC19)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>1. Remove plates from fridge and allow to warm and dry in 37C incubator.</p><br />
<br />
<p>2. Re-suspend plasmid DNA from iGEM plate by: (1) Pierce identified location on plate. (2) Add 10&micro;l of sterile water and pipette up and down a few times. (3) Allow to stand for 5 mins.</p><br />
<br />
<p>3. Remove competent cells from -80C and leave on ice for 5 mins. &nbsp;</p><br />
<br />
<p>4. Add 1&micro;l of part DNA to competent cells and mix very gently.</p><br />
<br />
<p>5. Incubate preparation on ice for 5-20 mins.</p><br />
<br />
<p>6. Heat shock at 42C in a heat block (or water bath) for 45 seconds and immediately transfer to ice.</p><br />
<br />
<p>7. Incubate on ice for 5 mins - for chloramphenicol parts, incubate on ice for 20 mins.</p><br />
<br />
<p>8. Add 200&micro;l of SOC or sterile LB broth and incubate at 37C in a shaking incubator for at least 1 hour.</p><br />
<br />
<p>9. Plate out 20&micro;l and 230&micro;l volumes to each LB antibiotic plate and spread using sterile beads.</p><br />
<br />
<p>10. Discard used beads into used beads waste, (beads are later cleaned and autoclaved).</p><br />
<br />
<p>11. Plate out control cells onto non-antibiotic plate to check viability of competent cells.</p><br />
<br />
<p>12. Incubate overnight at 37C and check for individual colonies</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>PCR Protocols</h1><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>Mutagenisis of the Chitinase genes</h2><br />
<br />
<p>In two separate tubes make up 50&micro;l PCR reaction with DNA (plasmid prep of chiA), MgCl2&nbsp;and dNTP and Pfu polymerase.</p><br />
<br />
<p>Tube A &ndash; ChiA-Fwd-Main and Chi-Rev-Muta</p><br />
<br />
<p>Tube B -- &nbsp;ChiA-Fwd-Muta and ChiA-Rev-Main</p><br />
<br />
<h3>Thermal cycling conditions</h3><br />
<br />
<p>95&deg;C for 3 minutes followed by</p><br />
<br />
<p>30 cycles of</p><br />
<br />
<p>95&deg;C for 30 seconds, 55 &deg;C for 40 seconds, and 72 &deg;C for</p><br />
<br />
<p>60 seconds (or 1min/kb), and a final step at 72 &deg;C for 10 minutes.</p><br />
<br />
<p>After PCR &ndash; can run of gel to clean up &ndash; but may not be necessary. Set up a second PCR without any primers, but containing all other PCR components. Add 5&micro;l from each reaction as DNA template and add 15&micro;l of PCR mix (total volume of PCR =25&micro;l.</p><br />
<br />
<p>Run PCR cycle as above for 10 cycles&nbsp;to generate mutated template.</p><br />
<br />
<p>After the 10 cycles &ndash;add a further 25&micro;l of PCR mix &ndash; but this mix will contain the outer (flanking) primers to allow for amplification of the entire mutated sequence.</p><br />
<br />
<p>Run PCR as before for 30 cycles.</p><br />
<br />
<p>Do restriction digest &ndash; then run on gel and then gel purify.</p><br />
<br />
<p>Ligate to pSB1C3 &nbsp;backbone and transform.</p><br />
<br />
<p>Pick colonies and colony PCR and inoculate LB broth.</p><br />
<br />
<p>Select cloned colonies (from colony PCR) and grow those samples overnight in shaker.</p><br />
<br />
<p>Mini-prep and analyse by restriction analysis and send for sequencing</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>PCR MasterMix</h2><br />
<br />
<p>Make a master mix&nbsp; &nbsp;X6 (6 reactions in total)</p><br />
<br />
<ol start="1"><br />
<li>5x Q5 reaction 30&micro;l</li><br />
<li>10mM dNTPs 3&micro;l</li><br />
<li>DNA pol &nbsp;1.5&micro;l</li><br />
<li>dH2O 94.2&micro;L.</li><br />
</ol><br />
<br />
<p>For each reaction add:- &nbsp; 21.5&micro;l master mix</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1&micro;l Template plasmid</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l Forward primer</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l reverse primer</p><br />
<br />
<h2>Chitin Azure Assay&nbsp;&ndash; the following was received from Prof. Frank Sargent regarding the chitin azure assay</h2><br />
<br />
<p>2.36g of Sodium Succinate was weighed out and dissolved in 200ml of water. The solution was pH&rsquo;d with HCl to pH 6.09. Then 0.0337g of chitin azure was added to 50ml of Succinate assay buffer.</p><br />
<br />
<h3>Assay</h3><br />
<br />
<p>Grow culture in LB overnight. Samples are then centrifuged for 1 minute at 16000g and the supernatant collected and kept on ice. 200&micro;l of supernatant is added to 400&micro;l of chitin azure assay buffer and incubated at 37 oC for 72 h. The samples were then centrifuged at 16,000 g for 5 min and the A560&nbsp;of the supernatant measured. Chitinolytic activity was measured as ∆A560&nbsp;h-1&nbsp;ml-1&nbsp;per OD600&nbsp;unit with respect to a blank incubated with just LB (not culture supernatant).</p><br />
</div><br />
<br />
<table cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Components</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Quantity 1L</p><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>Chitin Azure</p><br />
<br />
<p>Not sterilised</p><br />
<br />
<p>Buffer</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.2% (w/v) chitin azure (Sigma)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Succinate</p><br />
<br />
<p>Adjusted to pH 6 with NaOH</p><br />
<br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.666 g</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>11.8 g</p><br />
</div><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h3>References</h3><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; Coulthurst, S. J., N. R. Williamson, et al. (2006). &quot;Metabolic and regulatory engineering of Serratia marcescens: mimicking phage-mediated horizontal acquisition of antibiotic biosynthesis and quorum-sensing capacities.&quot; Microbiology&nbsp;152(Pt 7): 1899-1911.</p><br />
<br />
<br />
<div class="c25"><br />
<p>&nbsp;</p><br />
<html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2013-10-05T03:45:14Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container"><br />
<div class="well"><br />
<h1>PROTOCOLS</h1><br />
<br />
<br />
<div class="container"><br />
<h2>Making LB Agar plates</h2><br />
<br />
<ol start="1"><br />
<li>Weigh 7.0g of LB agar.</li><br />
<li>Add 200ml of deionised water into a flask containing the weighed LB agar.</li><br />
<li>Mix well to dissolve the LB agar powder.</li><br />
<li>Autoclave the flask (remember to cover the flask with foil and sponge)</li><br />
<li>After autoclaving, store it in a clean dry space.</li><br />
</ol><br />
<br />
<p>Re-heating agar to prepare plates.</p><br />
<br />
<ol start="1"><br />
<li>&nbsp;Heat the agar in microwave till the LB agar has fully liquidised.</li><br />
<li>Let it cool.</li><br />
<li>&nbsp;Add required antibiotic in a sterile environment and pour the LB on plates.</li><br />
<li>&nbsp;</li><br />
</ol><br />
<br />
<h2>Preparing competent cells &ndash;Top10 stock</h2><br />
<br />
<ol start="1"><br />
<li>Pick single colony of cells from LB agar plate into 10 ml of LB media containing specific antibiotic for the cell type. Grow the culture overnight at 37 ˚C with shaking at 250rpm.</li><br />
<li>Inoculate 200ml of pre-warmed medium (no antibiotic or specific for the cell type) with 10ml of overnight cultures , and grow at 37 ˚C for 60 min, with vigorous shaking at 250rpm or until OD600 is 0.4-0.5</li><br />
<li>Put the flask on ice for 30min. At the same time chill sterile falcon tubes.</li><br />
<li>Aliquot culture into 50ml each 4 x 50ml chilled falcon tubes.</li><br />
<li>Harvest the cells by centrifugation for 7 minutes at 3500rpm, at 4 ˚C and discard the supernatant.</li><br />
<li>Re-suspend cells in each tube in 12.5ml of 0.1M MgCl2&nbsp;</li><br />
<li>Centrifuge for 7 min at 3500rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 25ml of 0.1M CaCl2</li><br />
<li>Incubate cells on ice for 30 min.</li><br />
<li>Centrifuge for 7 min rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 700&micro;l of 0.1M CaCl2&nbsp;and 300&micro;l of 50% glycerol to give a final volume of 1ml in each tube.</li><br />
<li>Aliquot 50&micro;l into 1.5ml sterile micro centrifuge tubes on ice and store at -80˚C.</li><br />
</ol><br />
<br />
<h2>Glycerol stock preparation</h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-sterile 50% glycerol stock</p><br />
<br />
<p>300&micro;l of 50% glycerol is added to 700&micro;l overnight culture in an eppendorf.</p><br />
<br />
<p>Contents were mixed by inverting and immediately stored at -80˚C.</p><br />
<br />
<h2>50% Agarose gel preparation</h2><br />
<br />
<h2>Materials</h2><br />
<br />
<p>-0.5g of agarose weighed and added to 50ml of TAE buffer</p><br />
<br />
<p>&bull; Add a few ml more of the 1X TAE since the buffer will evaporate in the microwave.</p><br />
<br />
<p>Dissolve the agarose in the TAE buffer in the microwave. Ensure all the agarose is completely dissolved. Allow to cool slightly (approx. 60C) and add 1&micro;l of ethidium bromide. Pour gel into gel tray and place comb into position. Ensure there are no bubbles in the gel. Bubbles may be moved to the bottom of the gel using a sterile tip. &nbsp;Allow gel to set completely. Run gel for approx. 1hour at 100volts.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Nanodrop procedure</h1><br />
<br />
<p>Add 1&micro;l of RNAse free water as Blank</p><br />
<br />
<p>Add 1&micro;l of sample to the stage and read.</p><br />
<br />
<p>Ideally want a concentration &gt;100ng/&micro;l and purity (260/289nm) reading close to 1.0</p><br />
<br />
<h2>Preparation of Carbenicillin stock</h2><br />
<br />
<p>50mg/ml stock was prepared as follows:</p><br />
<br />
<p>1g of carbenicillin powder (Sigma product 50mg/ml) was weighed out and dissolved in 10 ml of sterile water. 1ml volumes were aliquotted to eppendorfs and marked with a red stripe and c.</p><br />
<br />
<h2>Preparation of carbenicillin Plates (100&nbsp;&micro;g&nbsp;/ml<span style="font-size:11px">)</span></h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-petri dishes</p><br />
<br />
<p>-200ml autoclaved LB agar</p><br />
<br />
<p>50mg/ml<span style="font-size:11px">&nbsp;</span>carbenicillin stock</p><br />
<br />
<p>Melt LB agar in microwave until completely molten. Allow to cool to approx 60C.</p><br />
<br />
<p>400&micro;l of carbenicillin is added to the 200ml LB agar and approx 20ml poured into each plate.</p><br />
<br />
<p>Allow plates to cool and label the plates with red stripe on side to indicate the type of antibiotic.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Transformation</h1><br />
<br />
<h2>Materials</h2><br />
<br />
<p>- competent cells (1 vial per transformation and 1 for the control)</p><br />
<br />
<p>- antibiotic plates (2 per transformation)</p><br />
<br />
<p>- control plate without antibiotic</p><br />
<br />
<p>- control plasmid (PUC19)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>1. Remove plates from fridge and allow to warm and dry in 37C incubator.</p><br />
<br />
<p>2. Re-suspend plasmid DNA from iGEM plate by: (1) Pierce identified location on plate. (2) Add 10&micro;l of sterile water and pipette up and down a few times. (3) Allow to stand for 5 mins.</p><br />
<br />
<p>3. Remove competent cells from -80C and leave on ice for 5 mins. &nbsp;</p><br />
<br />
<p>4. Add 1&micro;l of part DNA to competent cells and mix very gently.</p><br />
<br />
<p>5. Incubate preparation on ice for 5-20 mins.</p><br />
<br />
<p>6. Heat shock at 42C in a heat block (or water bath) for 45 seconds and immediately transfer to ice.</p><br />
<br />
<p>7. Incubate on ice for 5 mins - for chloramphenicol parts, incubate on ice for 20 mins.</p><br />
<br />
<p>8. Add 200&micro;l of SOC or sterile LB broth and incubate at 37C in a shaking incubator for at least 1 hour.</p><br />
<br />
<p>9. Plate out 20&micro;l and 230&micro;l volumes to each LB antibiotic plate and spread using sterile beads.</p><br />
<br />
<p>10. Discard used beads into used beads waste, (beads are later cleaned and autoclaved).</p><br />
<br />
<p>11. Plate out control cells onto non-antibiotic plate to check viability of competent cells.</p><br />
<br />
<p>12. Incubate overnight at 37C and check for individual colonies</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>PCR Protocols</h1><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>Mutagenisis of the Chitinase genes</h2><br />
<br />
<p>In two separate tubes make up 50&micro;l PCR reaction with DNA (plasmid prep of chiA), MgCl2&nbsp;and dNTP and Pfu polymerase.</p><br />
<br />
<p>Tube A &ndash; ChiA-Fwd-Main and Chi-Rev-Muta</p><br />
<br />
<p>Tube B -- &nbsp;ChiA-Fwd-Muta and ChiA-Rev-Main</p><br />
<br />
<h3>Thermal cycling conditions</h3><br />
<br />
<p>95&deg;C for 3 minutes followed by</p><br />
<br />
<p>30 cycles of</p><br />
<br />
<p>95&deg;C for 30 seconds, 55 &deg;C for 40 seconds, and 72 &deg;C for</p><br />
<br />
<p>60 seconds (or 1min/kb), and a final step at 72 &deg;C for 10 minutes.</p><br />
<br />
<p>After PCR &ndash; can run of gel to clean up &ndash; but may not be necessary. Set up a second PCR without any primers, but containing all other PCR components. Add 5&micro;l from each reaction as DNA template and add 15&micro;l of PCR mix (total volume of PCR =25&micro;l.</p><br />
<br />
<p>Run PCR cycle as above for 10 cycles&nbsp;to generate mutated template.</p><br />
<br />
<p>After the 10 cycles &ndash;add a further 25&micro;l of PCR mix &ndash; but this mix will contain the outer (flanking) primers to allow for amplification of the entire mutated sequence.</p><br />
<br />
<p>Run PCR as before for 30 cycles.</p><br />
<br />
<p>Do restriction digest &ndash; then run on gel and then gel purify.</p><br />
<br />
<p>Ligate to pSB1C3 &nbsp;backbone and transform.</p><br />
<br />
<p>Pick colonies and colony PCR and inoculate LB broth.</p><br />
<br />
<p>Select cloned colonies (from colony PCR) and grow those samples overnight in shaker.</p><br />
<br />
<p>Mini-prep and analyse by restriction analysis and send for sequencing</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>PCR MasterMix</h2><br />
<br />
<p>Make a master mix&nbsp; &nbsp;X6 (6 reactions in total)</p><br />
<br />
<ol start="1"><br />
<li>5x Q5 reaction 30&micro;l</li><br />
<li>10mM dNTPs 3&micro;l</li><br />
<li>DNA pol &nbsp;1.5&micro;l</li><br />
<li>dH2O 94.2&micro;L.</li><br />
</ol><br />
<br />
<p>For each reaction add:- &nbsp; 21.5&micro;l master mix</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1&micro;l Template plasmid</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l Forward primer</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l reverse primer</p><br />
<br />
<h2>Chitin Azure Assay&nbsp;&ndash; the following was received from Prof. Frank Sargent regarding the chitin azure assay</h2><br />
<br />
<p>2.36g of Sodium Succinate was weighed out and dissolved in 200ml of water. The solution was pH&rsquo;d with HCl to pH 6.09. Then 0.0337g of chitin azure was added to 50ml of Succinate assay buffer.</p><br />
<br />
<h3>Assay</h3><br />
<br />
<p>Grow culture in LB overnight. Samples are then centrifuged for 1 minute at 16000g and the supernatant collected and kept on ice. 200&micro;l of supernatant is added to 400&micro;l of chitin azure assay buffer and incubated at 37 oC for 72 h. The samples were then centrifuged at 16,000 g for 5 min and the A560&nbsp;of the supernatant measured. Chitinolytic activity was measured as ∆A560&nbsp;h-1&nbsp;ml-1&nbsp;per OD600&nbsp;unit with respect to a blank incubated with just LB (not culture supernatant).</p><br />
</div><br />
<br />
<table cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Components</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Quantity 1L</p><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>Chitin Azure</p><br />
<br />
<p>Not sterilised</p><br />
<br />
<p>Buffer</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.2% (w/v) chitin azure (Sigma)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Succinate</p><br />
<br />
<p>Adjusted to pH 6 with NaOH</p><br />
<br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.666 g</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>11.8 g</p><br />
</div><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h3>References</h3><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; Coulthurst, S. J., N. R. Williamson, et al. (2006). &quot;Metabolic and regulatory engineering of Serratia marcescens: mimicking phage-mediated horizontal acquisition of antibiotic biosynthesis and quorum-sensing capacities.&quot; Microbiology&nbsp;152(Pt 7): 1899-1911.</p><br />
</div><br />
<br />
<div class="c25"><br />
<p>&nbsp;</p><br />
</div><br />
</div><br />
</div><br />
<html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2013-10-05T03:44:34Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container"><br />
<div class="well"><br />
<h1>PROTOCOLS</h1><br />
</div><br />
</div><br />
<br />
<div class="container"><br />
<h2>Making LB Agar plates</h2><br />
<br />
<ol start="1"><br />
<li>Weigh 7.0g of LB agar.</li><br />
<li>Add 200ml of deionised water into a flask containing the weighed LB agar.</li><br />
<li>Mix well to dissolve the LB agar powder.</li><br />
<li>Autoclave the flask (remember to cover the flask with foil and sponge)</li><br />
<li>After autoclaving, store it in a clean dry space.</li><br />
</ol><br />
<br />
<p>Re-heating agar to prepare plates.</p><br />
<br />
<ol start="1"><br />
<li>&nbsp;Heat the agar in microwave till the LB agar has fully liquidised.</li><br />
<li>Let it cool.</li><br />
<li>&nbsp;Add required antibiotic in a sterile environment and pour the LB on plates.</li><br />
<li>&nbsp;</li><br />
</ol><br />
<br />
<h2>Preparing competent cells &ndash;Top10 stock</h2><br />
<br />
<ol start="1"><br />
<li>Pick single colony of cells from LB agar plate into 10 ml of LB media containing specific antibiotic for the cell type. Grow the culture overnight at 37 ˚C with shaking at 250rpm.</li><br />
<li>Inoculate 200ml of pre-warmed medium (no antibiotic or specific for the cell type) with 10ml of overnight cultures , and grow at 37 ˚C for 60 min, with vigorous shaking at 250rpm or until OD600 is 0.4-0.5</li><br />
<li>Put the flask on ice for 30min. At the same time chill sterile falcon tubes.</li><br />
<li>Aliquot culture into 50ml each 4 x 50ml chilled falcon tubes.</li><br />
<li>Harvest the cells by centrifugation for 7 minutes at 3500rpm, at 4 ˚C and discard the supernatant.</li><br />
<li>Re-suspend cells in each tube in 12.5ml of 0.1M MgCl2&nbsp;</li><br />
<li>Centrifuge for 7 min at 3500rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 25ml of 0.1M CaCl2</li><br />
<li>Incubate cells on ice for 30 min.</li><br />
<li>Centrifuge for 7 min rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 700&micro;l of 0.1M CaCl2&nbsp;and 300&micro;l of 50% glycerol to give a final volume of 1ml in each tube.</li><br />
<li>Aliquot 50&micro;l into 1.5ml sterile micro centrifuge tubes on ice and store at -80˚C.</li><br />
</ol><br />
<br />
<h2>Glycerol stock preparation</h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-sterile 50% glycerol stock</p><br />
<br />
<p>300&micro;l of 50% glycerol is added to 700&micro;l overnight culture in an eppendorf.</p><br />
<br />
<p>Contents were mixed by inverting and immediately stored at -80˚C.</p><br />
<br />
<h2>50% Agarose gel preparation</h2><br />
<br />
<h2>Materials</h2><br />
<br />
<p>-0.5g of agarose weighed and added to 50ml of TAE buffer</p><br />
<br />
<p>&bull; Add a few ml more of the 1X TAE since the buffer will evaporate in the microwave.</p><br />
<br />
<p>Dissolve the agarose in the TAE buffer in the microwave. Ensure all the agarose is completely dissolved. Allow to cool slightly (approx. 60C) and add 1&micro;l of ethidium bromide. Pour gel into gel tray and place comb into position. Ensure there are no bubbles in the gel. Bubbles may be moved to the bottom of the gel using a sterile tip. &nbsp;Allow gel to set completely. Run gel for approx. 1hour at 100volts.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Nanodrop procedure</h1><br />
<br />
<p>Add 1&micro;l of RNAse free water as Blank</p><br />
<br />
<p>Add 1&micro;l of sample to the stage and read.</p><br />
<br />
<p>Ideally want a concentration &gt;100ng/&micro;l and purity (260/289nm) reading close to 1.0</p><br />
<br />
<h2>Preparation of Carbenicillin stock</h2><br />
<br />
<p>50mg/ml stock was prepared as follows:</p><br />
<br />
<p>1g of carbenicillin powder (Sigma product 50mg/ml) was weighed out and dissolved in 10 ml of sterile water. 1ml volumes were aliquotted to eppendorfs and marked with a red stripe and c.</p><br />
<br />
<h2>Preparation of carbenicillin Plates (100&nbsp;&micro;g&nbsp;/ml<span style="font-size:11px">)</span></h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-petri dishes</p><br />
<br />
<p>-200ml autoclaved LB agar</p><br />
<br />
<p>50mg/ml<span style="font-size:11px">&nbsp;</span>carbenicillin stock</p><br />
<br />
<p>Melt LB agar in microwave until completely molten. Allow to cool to approx 60C.</p><br />
<br />
<p>400&micro;l of carbenicillin is added to the 200ml LB agar and approx 20ml poured into each plate.</p><br />
<br />
<p>Allow plates to cool and label the plates with red stripe on side to indicate the type of antibiotic.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Transformation</h1><br />
<br />
<h2>Materials</h2><br />
<br />
<p>- competent cells (1 vial per transformation and 1 for the control)</p><br />
<br />
<p>- antibiotic plates (2 per transformation)</p><br />
<br />
<p>- control plate without antibiotic</p><br />
<br />
<p>- control plasmid (PUC19)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>1. Remove plates from fridge and allow to warm and dry in 37C incubator.</p><br />
<br />
<p>2. Re-suspend plasmid DNA from iGEM plate by: (1) Pierce identified location on plate. (2) Add 10&micro;l of sterile water and pipette up and down a few times. (3) Allow to stand for 5 mins.</p><br />
<br />
<p>3. Remove competent cells from -80C and leave on ice for 5 mins. &nbsp;</p><br />
<br />
<p>4. Add 1&micro;l of part DNA to competent cells and mix very gently.</p><br />
<br />
<p>5. Incubate preparation on ice for 5-20 mins.</p><br />
<br />
<p>6. Heat shock at 42C in a heat block (or water bath) for 45 seconds and immediately transfer to ice.</p><br />
<br />
<p>7. Incubate on ice for 5 mins - for chloramphenicol parts, incubate on ice for 20 mins.</p><br />
<br />
<p>8. Add 200&micro;l of SOC or sterile LB broth and incubate at 37C in a shaking incubator for at least 1 hour.</p><br />
<br />
<p>9. Plate out 20&micro;l and 230&micro;l volumes to each LB antibiotic plate and spread using sterile beads.</p><br />
<br />
<p>10. Discard used beads into used beads waste, (beads are later cleaned and autoclaved).</p><br />
<br />
<p>11. Plate out control cells onto non-antibiotic plate to check viability of competent cells.</p><br />
<br />
<p>12. Incubate overnight at 37C and check for individual colonies</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>PCR Protocols</h1><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>Mutagenisis of the Chitinase genes</h2><br />
<br />
<p>In two separate tubes make up 50&micro;l PCR reaction with DNA (plasmid prep of chiA), MgCl2&nbsp;and dNTP and Pfu polymerase.</p><br />
<br />
<p>Tube A &ndash; ChiA-Fwd-Main and Chi-Rev-Muta</p><br />
<br />
<p>Tube B -- &nbsp;ChiA-Fwd-Muta and ChiA-Rev-Main</p><br />
<br />
<h3>Thermal cycling conditions</h3><br />
<br />
<p>95&deg;C for 3 minutes followed by</p><br />
<br />
<p>30 cycles of</p><br />
<br />
<p>95&deg;C for 30 seconds, 55 &deg;C for 40 seconds, and 72 &deg;C for</p><br />
<br />
<p>60 seconds (or 1min/kb), and a final step at 72 &deg;C for 10 minutes.</p><br />
<br />
<p>After PCR &ndash; can run of gel to clean up &ndash; but may not be necessary. Set up a second PCR without any primers, but containing all other PCR components. Add 5&micro;l from each reaction as DNA template and add 15&micro;l of PCR mix (total volume of PCR =25&micro;l.</p><br />
<br />
<p>Run PCR cycle as above for 10 cycles&nbsp;to generate mutated template.</p><br />
<br />
<p>After the 10 cycles &ndash;add a further 25&micro;l of PCR mix &ndash; but this mix will contain the outer (flanking) primers to allow for amplification of the entire mutated sequence.</p><br />
<br />
<p>Run PCR as before for 30 cycles.</p><br />
<br />
<p>Do restriction digest &ndash; then run on gel and then gel purify.</p><br />
<br />
<p>Ligate to pSB1C3 &nbsp;backbone and transform.</p><br />
<br />
<p>Pick colonies and colony PCR and inoculate LB broth.</p><br />
<br />
<p>Select cloned colonies (from colony PCR) and grow those samples overnight in shaker.</p><br />
<br />
<p>Mini-prep and analyse by restriction analysis and send for sequencing</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>PCR MasterMix</h2><br />
<br />
<p>Make a master mix&nbsp; &nbsp;X6 (6 reactions in total)</p><br />
<br />
<ol start="1"><br />
<li>5x Q5 reaction 30&micro;l</li><br />
<li>10mM dNTPs 3&micro;l</li><br />
<li>DNA pol &nbsp;1.5&micro;l</li><br />
<li>dH2O 94.2&micro;L.</li><br />
</ol><br />
<br />
<p>For each reaction add:- &nbsp; 21.5&micro;l master mix</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1&micro;l Template plasmid</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l Forward primer</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l reverse primer</p><br />
<br />
<h2>Chitin Azure Assay&nbsp;&ndash; the following was received from Prof. Frank Sargent regarding the chitin azure assay</h2><br />
<br />
<p>2.36g of Sodium Succinate was weighed out and dissolved in 200ml of water. The solution was pH&rsquo;d with HCl to pH 6.09. Then 0.0337g of chitin azure was added to 50ml of Succinate assay buffer.</p><br />
<br />
<h3>Assay</h3><br />
<br />
<p>Grow culture in LB overnight. Samples are then centrifuged for 1 minute at 16000g and the supernatant collected and kept on ice. 200&micro;l of supernatant is added to 400&micro;l of chitin azure assay buffer and incubated at 37 oC for 72 h. The samples were then centrifuged at 16,000 g for 5 min and the A560&nbsp;of the supernatant measured. Chitinolytic activity was measured as ∆A560&nbsp;h-1&nbsp;ml-1&nbsp;per OD600&nbsp;unit with respect to a blank incubated with just LB (not culture supernatant).</p><br />
</div><br />
<br />
<table cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Components</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Quantity 1L</p><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>Chitin Azure</p><br />
<br />
<p>Not sterilised</p><br />
<br />
<p>Buffer</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.2% (w/v) chitin azure (Sigma)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Succinate</p><br />
<br />
<p>Adjusted to pH 6 with NaOH</p><br />
<br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.666 g</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>11.8 g</p><br />
</div><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h3>References</h3><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; Coulthurst, S. J., N. R. Williamson, et al. (2006). &quot;Metabolic and regulatory engineering of Serratia marcescens: mimicking phage-mediated horizontal acquisition of antibiotic biosynthesis and quorum-sensing capacities.&quot; Microbiology&nbsp;152(Pt 7): 1899-1911.</p><br />
</div><br />
<br />
<div class="c25"><br />
<p>&nbsp;</p><br />
</div><br />
<html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2013-10-05T03:44:06Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<div class="container"><br />
<div class="well"><br />
<h1>PROTOCOLS</h1><br />
</div><br />
</div><br />
<br />
<div class="container"><br />
<h2>Making LB Agar plates</h2><br />
<br />
<ol start="1"><br />
<li>Weigh 7.0g of LB agar.</li><br />
<li>Add 200ml of deionised water into a flask containing the weighed LB agar.</li><br />
<li>Mix well to dissolve the LB agar powder.</li><br />
<li>Autoclave the flask (remember to cover the flask with foil and sponge)</li><br />
<li>After autoclaving, store it in a clean dry space.</li><br />
</ol><br />
<br />
<p>Re-heating agar to prepare plates.</p><br />
<br />
<ol start="1"><br />
<li>&nbsp;Heat the agar in microwave till the LB agar has fully liquidised.</li><br />
<li>Let it cool.</li><br />
<li>&nbsp;Add required antibiotic in a sterile environment and pour the LB on plates.</li><br />
<li>&nbsp;</li><br />
</ol><br />
<br />
<h2>Preparing competent cells &ndash;Top10 stock</h2><br />
<br />
<ol start="1"><br />
<li>Pick single colony of cells from LB agar plate into 10 ml of LB media containing specific antibiotic for the cell type. Grow the culture overnight at 37 ˚C with shaking at 250rpm.</li><br />
<li>Inoculate 200ml of pre-warmed medium (no antibiotic or specific for the cell type) with 10ml of overnight cultures , and grow at 37 ˚C for 60 min, with vigorous shaking at 250rpm or until OD600 is 0.4-0.5</li><br />
<li>Put the flask on ice for 30min. At the same time chill sterile falcon tubes.</li><br />
<li>Aliquot culture into 50ml each 4 x 50ml chilled falcon tubes.</li><br />
<li>Harvest the cells by centrifugation for 7 minutes at 3500rpm, at 4 ˚C and discard the supernatant.</li><br />
<li>Re-suspend cells in each tube in 12.5ml of 0.1M MgCl2&nbsp;</li><br />
<li>Centrifuge for 7 min at 3500rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 25ml of 0.1M CaCl2</li><br />
<li>Incubate cells on ice for 30 min.</li><br />
<li>Centrifuge for 7 min rpm, at 4˚C and discard supernatant.</li><br />
<li>Re-suspend cells in each tube in 700&micro;l of 0.1M CaCl2&nbsp;and 300&micro;l of 50% glycerol to give a final volume of 1ml in each tube.</li><br />
<li>Aliquot 50&micro;l into 1.5ml sterile micro centrifuge tubes on ice and store at -80˚C.</li><br />
</ol><br />
<br />
<h2>Glycerol stock preparation</h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-sterile 50% glycerol stock</p><br />
<br />
<p>300&micro;l of 50% glycerol is added to 700&micro;l overnight culture in an eppendorf.</p><br />
<br />
<p>Contents were mixed by inverting and immediately stored at -80˚C.</p><br />
<br />
<h2>50% Agarose gel preparation</h2><br />
<br />
<h2>Materials</h2><br />
<br />
<p>-0.5g of agarose weighed and added to 50ml of TAE buffer</p><br />
<br />
<p>&bull; Add a few ml more of the 1X TAE since the buffer will evaporate in the microwave.</p><br />
<br />
<p>Dissolve the agarose in the TAE buffer in the microwave. Ensure all the agarose is completely dissolved. Allow to cool slightly (approx. 60C) and add 1&micro;l of ethidium bromide. Pour gel into gel tray and place comb into position. Ensure there are no bubbles in the gel. Bubbles may be moved to the bottom of the gel using a sterile tip. &nbsp;Allow gel to set completely. Run gel for approx. 1hour at 100volts.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Nanodrop procedure</h1><br />
<br />
<p>Add 1&micro;l of RNAse free water as Blank</p><br />
<br />
<p>Add 1&micro;l of sample to the stage and read.</p><br />
<br />
<p>Ideally want a concentration &gt;100ng/&micro;l and purity (260/289nm) reading close to 1.0</p><br />
<br />
<h2>Preparation of Carbenicillin stock</h2><br />
<br />
<p>50mg/ml stock was prepared as follows:</p><br />
<br />
<p>1g of carbenicillin powder (Sigma product 50mg/ml) was weighed out and dissolved in 10 ml of sterile water. 1ml volumes were aliquotted to eppendorfs and marked with a red stripe and c.</p><br />
<br />
<h2>Preparation of carbenicillin Plates (100&nbsp;&micro;g&nbsp;/ml<span style="font-size:11px">)</span></h2><br />
<br />
<h3>Materials</h3><br />
<br />
<p>-petri dishes</p><br />
<br />
<p>-200ml autoclaved LB agar</p><br />
<br />
<p>50mg/ml<span style="font-size:11px">&nbsp;</span>carbenicillin stock</p><br />
<br />
<p>Melt LB agar in microwave until completely molten. Allow to cool to approx 60C.</p><br />
<br />
<p>400&micro;l of carbenicillin is added to the 200ml LB agar and approx 20ml poured into each plate.</p><br />
<br />
<p>Allow plates to cool and label the plates with red stripe on side to indicate the type of antibiotic.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Transformation</h1><br />
<br />
<h2>Materials</h2><br />
<br />
<p>- competent cells (1 vial per transformation and 1 for the control)</p><br />
<br />
<p>- antibiotic plates (2 per transformation)</p><br />
<br />
<p>- control plate without antibiotic</p><br />
<br />
<p>- control plasmid (PUC19)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>1. Remove plates from fridge and allow to warm and dry in 37C incubator.</p><br />
<br />
<p>2. Re-suspend plasmid DNA from iGEM plate by: (1) Pierce identified location on plate. (2) Add 10&micro;l of sterile water and pipette up and down a few times. (3) Allow to stand for 5 mins.</p><br />
<br />
<p>3. Remove competent cells from -80C and leave on ice for 5 mins. &nbsp;</p><br />
<br />
<p>4. Add 1&micro;l of part DNA to competent cells and mix very gently.</p><br />
<br />
<p>5. Incubate preparation on ice for 5-20 mins.</p><br />
<br />
<p>6. Heat shock at 42C in a heat block (or water bath) for 45 seconds and immediately transfer to ice.</p><br />
<br />
<p>7. Incubate on ice for 5 mins - for chloramphenicol parts, incubate on ice for 20 mins.</p><br />
<br />
<p>8. Add 200&micro;l of SOC or sterile LB broth and incubate at 37C in a shaking incubator for at least 1 hour.</p><br />
<br />
<p>9. Plate out 20&micro;l and 230&micro;l volumes to each LB antibiotic plate and spread using sterile beads.</p><br />
<br />
<p>10. Discard used beads into used beads waste, (beads are later cleaned and autoclaved).</p><br />
<br />
<p>11. Plate out control cells onto non-antibiotic plate to check viability of competent cells.</p><br />
<br />
<p>12. Incubate overnight at 37C and check for individual colonies</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>PCR Protocols</h1><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>Mutagenisis of the Chitinase genes</h2><br />
<br />
<p>In two separate tubes make up 50&micro;l PCR reaction with DNA (plasmid prep of chiA), MgCl2&nbsp;and dNTP and Pfu polymerase.</p><br />
<br />
<p>Tube A &ndash; ChiA-Fwd-Main and Chi-Rev-Muta</p><br />
<br />
<p>Tube B -- &nbsp;ChiA-Fwd-Muta and ChiA-Rev-Main</p><br />
<br />
<h3>Thermal cycling conditions</h3><br />
<br />
<p>95&deg;C for 3 minutes followed by</p><br />
<br />
<p>30 cycles of</p><br />
<br />
<p>95&deg;C for 30 seconds, 55 &deg;C for 40 seconds, and 72 &deg;C for</p><br />
<br />
<p>60 seconds (or 1min/kb), and a final step at 72 &deg;C for 10 minutes.</p><br />
<br />
<p>After PCR &ndash; can run of gel to clean up &ndash; but may not be necessary. Set up a second PCR without any primers, but containing all other PCR components. Add 5&micro;l from each reaction as DNA template and add 15&micro;l of PCR mix (total volume of PCR =25&micro;l.</p><br />
<br />
<p>Run PCR cycle as above for 10 cycles&nbsp;to generate mutated template.</p><br />
<br />
<p>After the 10 cycles &ndash;add a further 25&micro;l of PCR mix &ndash; but this mix will contain the outer (flanking) primers to allow for amplification of the entire mutated sequence.</p><br />
<br />
<p>Run PCR as before for 30 cycles.</p><br />
<br />
<p>Do restriction digest &ndash; then run on gel and then gel purify.</p><br />
<br />
<p>Ligate to pSB1C3 &nbsp;backbone and transform.</p><br />
<br />
<p>Pick colonies and colony PCR and inoculate LB broth.</p><br />
<br />
<p>Select cloned colonies (from colony PCR) and grow those samples overnight in shaker.</p><br />
<br />
<p>Mini-prep and analyse by restriction analysis and send for sequencing</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2>PCR MasterMix</h2><br />
<br />
<p>Make a master mix&nbsp; &nbsp;X6 (6 reactions in total)</p><br />
<br />
<ol start="1"><br />
<li>5x Q5 reaction 30&micro;l</li><br />
<li>10mM dNTPs 3&micro;l</li><br />
<li>DNA pol &nbsp;1.5&micro;l</li><br />
<li>dH2O 94.2&micro;L.</li><br />
</ol><br />
<br />
<p>For each reaction add:- &nbsp; 21.5&micro;l master mix</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1&micro;l Template plasmid</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l Forward primer</p><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;1.25&micro;l reverse primer</p><br />
<br />
<h2>Chitin Azure Assay&nbsp;&ndash; the following was received from Prof. Frank Sargent regarding the chitin azure assay</h2><br />
<br />
<p>2.36g of Sodium Succinate was weighed out and dissolved in 200ml of water. The solution was pH&rsquo;d with HCl to pH 6.09. Then 0.0337g of chitin azure was added to 50ml of Succinate assay buffer.</p><br />
<br />
<h3>Assay</h3><br />
<br />
<p>Grow culture in LB overnight. Samples are then centrifuged for 1 minute at 16000g and the supernatant collected and kept on ice. 200&micro;l of supernatant is added to 400&micro;l of chitin azure assay buffer and incubated at 37 oC for 72 h. The samples were then centrifuged at 16,000 g for 5 min and the A560&nbsp;of the supernatant measured. Chitinolytic activity was measured as ∆A560&nbsp;h-1&nbsp;ml-1&nbsp;per OD600&nbsp;unit with respect to a blank incubated with just LB (not culture supernatant).</p><br />
</div><br />
<br />
<table cellpadding="0" cellspacing="0"><br />
<tbody><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Components</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>Quantity 1L</p><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>Chitin Azure</p><br />
<br />
<p>Not sterilised</p><br />
<br />
<p>Buffer</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.2% (w/v) chitin azure (Sigma)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Succinate</p><br />
<br />
<p>Adjusted to pH 6 with NaOH</p><br />
<br />
<p>&nbsp;</p><br />
</div><br />
</td><br />
<td><br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>0.666 g</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>11.8 g</p><br />
</div><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br />
<div class="container"><br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h3>References</h3><br />
<br />
<p>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; Coulthurst, S. J., N. R. Williamson, et al. (2006). &quot;Metabolic and regulatory engineering of Serratia marcescens: mimicking phage-mediated horizontal acquisition of antibiotic biosynthesis and quorum-sensing capacities.&quot; Microbiology&nbsp;152(Pt 7): 1899-1911.</p><br />
</div><br />
<br />
<div class="c25"><br />
<p>&nbsp;</p><br />
</div><br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/AttributionsTeam:Westminster/Attributions2013-10-05T03:28:56Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<br />
<div class="container"><br />
<div class="well"><br />
<h1 dir="ltr"><u>Attributions</u></h1><br />
<br />
<h2><u>Supervisor</u></h2><br />
<br />
<p dir="ltr">Dr Mark Clements, Department of Molecular and Applied Biosciences. Supervisor.</p><br />
<br />
<p dir="ltr">Louise Usher: PhD student in molecular biology. Role: Lab Supervisor, research and helped&nbsp;with sponsorship.</p><br />
<br />
<p dir="ltr">Silvia Berciano: Research </p><br />
<br />
<p>Armaghan Azizi: Helped with the training in the lab.</p><br />
<br />
<h2><u>Sponsors:</u></h2><br />
<br />
<p>Mantis: Sponsored &pound;175 as well as supplying the bed bugs.</p><br />
<br />
<p>UCL: Modelling, helped with the Synthetic Biology speed debate.</p><br />
<br />
<p>Frank Sargeant: Supplied the chitanase gene from the bacteria <em>Serratia marcescens.</em></p><br />
<br />
<h2 dir="ltr"><strong>Team Member Roles:</strong></h2><br />
<br />
<p dir="ltr">Tom Bridge: Research, Lab work, Public Relations, Obtaining sponsorship.</p><br />
<br />
<p>Hira Khan: Research, Public Relations, Managing Log Book</p><br />
<br />
<p>Chris Kortschak: Created the wiki, lab work.</p><br />
<br />
<p>Mohit Santi: Research, Lab work, Modelling</p><br />
<br />
<p>Caroline Smith: Research, Managing social network (Twitter)</p><br />
<br />
<p>Krunal Polra: Creating the parts, lab work, obtaining sponsorship.</p><br />
<br />
<p>Aishwarya Saxena: Research on the background of bed bugs.</p><br />
<br />
<p>Zeljka Kalinic: Public Relations, Human Practice, lab work.</p><br />
<br />
<p>Yusuf Demir: Research</p><br />
</div><br />
</div><br />
</html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2013-10-05T03:21:42Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container"><div class="well"><br />
<br />
<h1>Human Practice</h1><br />
<br />
<h2>Dr James Logan</h2><br />
<br />
<p>James&nbsp;is Senior Lecturer in the Department of Disease Control and Scientific Director of the Arthropod Control Product Test Centre (<em>arctec</em>). He is Principle Investigator of a large research portfolio investigating novel ways to control arthropod vectors that transmit pathogens of human and animal diseases in the UK and overseas. Through chemical ecology studies, his research group explores the complex interaction between arthropod vectors, vertebrate hosts and pathogens&nbsp;at the behavioural, olfactory and molecular level.</p><br />
<br />
<p>The Westminster iGEM team met up with Dr James Logan at The London school of Hygiene and Tropical Medicine to discuss with him our project and what the iGEM is. We discussed our novel approach to the beg bug problem and our delivery method. We talked about possible issues with contamination and how we could go about solving them. We also discussed how to make our project more affective at targeting beg bug. He suggested using pheromones which cause the bugs to coagulate thus allowing our construct to spread easily through contact. He has even given us some bed bugs to do our testing on&hellip;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Outreach</h1><br />
<br />
<h2>Synthetic Biology Speed Debate</h2><br />
<br />
<p>The team held a speed debate event which was held in the &quot;Pavilion&quot; at the University of Westminster. During the event, participants were allocated to five groups where they had the opportunity to discuss and debate a topic put forward. Individuals then moved to the next table by selecting a random table number. &nbsp;Before the event started, the participants were asked to write down what comes to mind when they hear the word synthetic biology? And this is what they came up with.</p><br />
<br />
<h2>The questions asked in the speed debate were as follows</h2><br />
<br />
<h3>Whose decision should it be to assess the dangers of genetically modified organisms and the release of such organisms into the environment?</h3><br />
<br />
<p>Participants&nbsp;agreed that companies should not have the authority to assess the dangers of GMO&#39;s since they can be influenced by profit rather than concentrating on the benefits the organism may have to society. There may also be some danger if government has over-riding authority as they may favour a GMO as a form&nbsp;propaganda to gain public vote. Some felt that an independent body such as the IPCC should have control over which GMO should be released into the environment after both the advantages and disadvantages are assessed thoroughly.</p><br />
<br />
<h3>How do you feel about the idea of DNA being patented or owned and used for commercial gain?</h3><br />
<br />
<p>This question sparked a lot of dispute and opinions were completely divided. Those who agreed with the idea believed it would have a positive effect by encouraging people to study science and to be able to make a living out of it. Patent DNA would be a form of motivation for people to create new genetic parts with unique properties and build a new scientific market and research area.</p><br />
<br />
<p>However, the ones who disagreed argued that DNA already exists and should not be owned by anyone. They highlighted the dangers of allowing a few people to own the genetic information of humans, animals or plants.</p><br />
<br />
<h3>Is it ethical to take advantage of other life forms and modify them for human benefit?</h3><br />
<br />
<p>Philip Boeing stated that the phrase &ldquo;taking advantage&rdquo; is not fairly used and quite ambiguous in this context. What does it mean by taking advantage? An organisms genome could be modified not just for our benefit but also theirs. Some stated if the organism cannot think or feel pain then modifying after extensive study should not be classified as unethical. Since the Earth&rsquo;s natural sources are running out there is now an urgent demand for alternative methods. On the other hand, the opposing team stated that modified organism would caus &nbsp;a reduction in genetic diversity and the long term effects are unknown.</p><br />
<br />
<h3>Would you feel comfortable in an environmental situation which contained organisms modified by Synthetic Biology?</h3><br />
<br />
<p>This was pretty straightforward. Everyone agreed as long as it was properly regulated, tested and sufficient information was given regarding what organisms have been released.</p><br />
<br />
<h3>Do you think the benefits of Synthetic Biology could outweigh the risks?</h3><br />
<br />
<p>This question was not as clear cut as the others. If the question was a matter of life and death rather than for commercial or cosmetic purposes then it was generally felt that the benefit may outweigh the risks. I general the groups felt that use of synthetic biology may be more accepted if used to cure human illness, but were more cautious in risk to the environment. Releasing modified into the environment may have a knock on effect on other organism and unfortunately at the moment there is just not enough knowledge &nbsp;on the potential harm it may have to the ecosystem.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>At the end of the session, the participants were asked to write down what comes to mind when they hear the word synthetic biology? And this is what they came up with.</p><br />
<br />
<br />
<br />
</div></div><br />
<br />
</html><br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2013-10-05T03:21:19Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<div class="container"><div class="well"><br />
<br />
<h1>Human Practice</h1><br />
<br />
<h2>Dr James Logan</h2><br />
<br />
<p>James&nbsp;is Senior Lecturer in the Department of Disease Control and Scientific Director of the Arthropod Control Product Test Centre (<em>arctec</em>). He is Principle Investigator of a large research portfolio investigating novel ways to control arthropod vectors that transmit pathogens of human and animal diseases in the UK and overseas. Through chemical ecology studies, his research group explores the complex interaction between arthropod vectors, vertebrate hosts and pathogens&nbsp;at the behavioural, olfactory and molecular level.</p><br />
<br />
<p>The Westminster iGEM team met up with Dr James Logan at The London school of Hygiene and Tropical Medicine to discuss with him our project and what the iGEM is. We discussed our novel approach to the beg bug problem and our delivery method. We talked about possible issues with contamination and how we could go about solving them. We also discussed how to make our project more affective at targeting beg bug. He suggested using pheromones which cause the bugs to coagulate thus allowing our construct to spread easily through contact. He has even given us some bed bugs to do our testing on&hellip;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<h1>Outreach</h1><br />
<br />
<h2>Synthetic Biology Speed Debate</h2><br />
<br />
<p>The team held a speed debate event which was held in the &quot;Pavilion&quot; at the University of Westminster. During the event, participants were allocated to five groups where they had the opportunity to discuss and debate a topic put forward. Individuals then moved to the next table by selecting a random table number. &nbsp;Before the event started, the participants were asked to write down what comes to mind when they hear the word synthetic biology? And this is what they came up with.</p><br />
<br />
<h2>The questions asked in the speed debate were as follows</h2><br />
<br />
<h3>Whose decision should it be to assess the dangers of genetically modified organisms and the release of such organisms into the environment?</h3><br />
<br />
<p>Participants&nbsp;agreed that companies should not have the authority to assess the dangers of GMO&#39;s since they can be influenced by profit rather than concentrating on the benefits the organism may have to society. There may also be some danger if government has over-riding authority as they may favour a GMO as a form&nbsp;propaganda to gain public vote. Some felt that an independent body such as the IPCC should have control over which GMO should be released into the environment after both the advantages and disadvantages are assessed thoroughly.</p><br />
<br />
<h3>How do you feel about the idea of DNA being patented or owned and used for commercial gain?</h3><br />
<br />
<p>This question sparked a lot of dispute and opinions were completely divided. Those who agreed with the idea believed it would have a positive effect by encouraging people to study science and to be able to make a living out of it. Patent DNA would be a form of motivation for people to create new genetic parts with unique properties and build a new scientific market and research area.</p><br />
<br />
<p>However, the ones who disagreed argued that DNA already exists and should not be owned by anyone. They highlighted the dangers of allowing a few people to own the genetic information of humans, animals or plants.</p><br />
<br />
<h3>Is it ethical to take advantage of other life forms and modify them for human benefit?</h3><br />
<br />
<p>Philip Boeing stated that the phrase &ldquo;taking advantage&rdquo; is not fairly used and quite ambiguous in this context. What does it mean by taking advantage? An organisms genome could be modified not just for our benefit but also theirs. Some stated if the organism cannot think or feel pain then modifying after extensive study should not be classified as unethical. Since the Earth&rsquo;s natural sources are running out there is now an urgent demand for alternative methods. On the other hand, the opposing team stated that modified organism would caus &nbsp;a reduction in genetic diversity and the long term effects are unknown.</p><br />
<br />
<h3>Would you feel comfortable in an environmental situation which contained organisms modified by Synthetic Biology?</h3><br />
<br />
<p>This was pretty straightforward. Everyone agreed as long as it was properly regulated, tested and sufficient information was given regarding what organisms have been released.</p><br />
<br />
<h3>Do you think the benefits of Synthetic Biology could outweigh the risks?</h3><br />
<br />
<p>This question was not as clear cut as the others. If the question was a matter of life and death rather than for commercial or cosmetic purposes then it was generally felt that the benefit may outweigh the risks. I general the groups felt that use of synthetic biology may be more accepted if used to cure human illness, but were more cautious in risk to the environment. Releasing modified into the environment may have a knock on effect on other organism and unfortunately at the moment there is just not enough knowledge &nbsp;on the potential harm it may have to the ecosystem.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>At the end of the session, the participants were asked to write down what comes to mind when they hear the word synthetic biology? And this is what they came up with.</p><br />
<br />
<br />
<br />
</div></div><br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/SafetyTeam:Westminster/Safety2013-10-05T03:11:04Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container" style="font-size: 14pt;"><br />
<div class="well"><br />
<h1 style="text-align: center;">Safety Safety Safety Safety</h1><br />
<br />
<p>The University of Westminster has a full range of safety documents relating to all laboratory safety issues. Protocols range from the appropriate behaviour in the laboratory to the correct procedure for handling spills. Safety is an important aspect of lab work however it can easily be forgotten or just ignored as many students find it tedious and boring. To prevent injury safety should always be taken seriously as there are many hazards in the lab; from chemicals to microorganisms. These are some of the basic rules and regulations provided by our safety officer, Keith Redway, that we followed when working with microorganism:</p><br />
<br />
<p><br /><br />
&nbsp;</p><br />
<br />
<br />
<ol><br />
<li><br />
<p>At all times you must be properly attired in the laboratory in an appropriate laboratory coat which must be correctly fastened at all times. The School of Biosciences provides laboratory coats for students. These MUST be put on a coat hanger and returned to the rack after use, and NOT thrown on the bench or floor.<br /><br />
You must wear any other protective clothing (<em>e.g</em>. gloves, masks, safety spectacles, visors) as instructed by the member of staff in charge.</p><br />
</li><br />
<li>You must not eat, drink, smoke or apply cosmetics in the laboratory, on any laboratory floors, on stairs, or in lifts.</li><br />
<li>You must not suck or bite pencils or pens. You must not wear sandals, cumbersome jewellery or hats.</li><br />
<li>You must not lick labels prior to sticking them to apparatus (use tap water, self-adhesive labels or marker pen).</li><br />
<li>Avoid touching your face, hair, eyes, mouth,<em> etc</em>. whilst in the laboratory. Long hair must be tied back.</li><br />
<li>You must keep your available bench space clear, clean, tidy and free of inessential clutter,<em> </em>e.g. books.</li><br />
<li>You must not remove any materials from the laboratory,<em> </em>e.g. microbial cultures, without the permission of the lecturer in charge.</li><br />
<li>Manipulations by loop or pipette should be performed in a manner to minimise the production of aerosols.</li><br />
<li>Pipetting by mouth of any material is forbidden. You must always use the teats, syringes, and pipette-fillers provided.</li><br />
<li>All manipulations should be performed aseptically, using plugged pipettes, and the contaminated pipettes disposed of in the containers indicated by the lecturer in charge.</li><br />
<li>Contaminated glassware, plastic ware, microscope slides and discarded Petri dishes,<em> etc</em>. must be placed in the receptacles indicated by the lecturer in charge.</li><br />
<li>It should be recognised that certain procedures or equipment produce aerosols of contaminated material,<em> </em>e.g. the breaking of any fluid film, centrifugation and the agitation of fluids in shaking or orbital incubators. </li><br />
<li>Report all personal accidents, minor cuts and abrasions, breakages and spillages of cultures and reagents to the lecturer in charge. Cuts and abrasions must be protected by an adequate waterproof dressing.</li><br />
<li>If instructed, before leaving your bench, swab the area down with an appropriate disinfectant.</li><br />
<li>Before leaving the laboratory, return personal protective clothing, hang up your lab coat correctly, and wash your hands with soap (preferably germicidal). </li><br />
</ol><br />
<br />
<p>&nbsp;</p><br />
<br />
<h2><strong>Further information about Safety</strong></h2><br />
<br />
<h3>Our project</h3><br />
<br />
<p>During our project we used the appropriate lab safety protocols. Our project did not pose any serious risk to anyone&rsquo;s health because we are working with level 1 organisms, <em style="font-size:13px; line-height:1.6em">Escherichia coli</em>, and low hazardous chemicals. We used genes from a Level 2 organism, <em>Serratia marcescens</em>, however we received the genes from, Prof. Frank Sargent, cloned in E. coli so we did not handle the organism ourselves. The genes are not pathogenic and thus do not raise any threats to anyone&rsquo;s health. When disposing of any possible toxic chemicals, tips, petri dishes with growth and any other disposable lab equipment that may have made contact with microorganisms or possible toxic chemicals we used a separate waste bin which is firstly autoclaved and then discarded as waste. This ensures organisms do not accidently escape and grow outside the laboratory. Also prevents people who are highly susceptible to certain chemicals from making contact with the chemicals as they will not be wearing protective clothing and may react badly.</p><br />
<br />
<h3>Our BioBricks</h3><br />
<br />
<p>None of our BioBricks pose a threat to our team, any staff member or student. Our BioBricks only raise safety issues to organisms with a chitin exoskeleton however we have taken this into consideration when designing our construct and are planning on including safety mechanisms to prevent, as much possible, the targeting of non-target organisms. One of our ideas is induced lysis of our engineered species.</p><br />
<br />
<h3>Our University</h3><br />
<br />
<p>University of Westminster has a biological safety officer, Keith Redway, who deals with lab safety and keeps a check on whether or not the rules are being followed. We were working in an environment surrounded by researchers and PhD students who were also keeping an eye on what we were doing and making sure we followed the rules of the lab and that we were not a treat to ourselves and anyone else.</p><br />
<br />
<h3>The iGEM</h3><br />
<br />
<p>Future iGEM kits could be provided with a variety of kill switches and various other safety parts. Some teams may find it difficult to produce their own safety parts and by providing these parts it ensures that if accidently a BioBrick did leave the lab it would not pose a threat to the environment, and any organism that may be targeted by the BioBricks. This may also prevent the iGEM from being subjected to bad press. There may be a possibility in the future that a team might accidently release a part into the environment that may cause some considerable damage. By providing safety parts it decreases the chances of accidents occurring.</p><br />
<br />
<p><br /><br />
&nbsp;</p><br />
<br />
<br />
</div><br />
<br />
</div><br />
</html><br />
<br />
<br />
[[Safety | safety page]].<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/DiaryTeam:Westminster/Diary2013-10-05T02:52:08Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<p><strong>Westminster 2013 IGEM JOURNAL</strong></p><br />
<br />
<br />
<p><em>Date: 7 February 2013 </em></p><br />
<br />
<p>Today we had our first meeting. A number of ideas were discussed and 6 of the ideas were selected for further research.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>First team meeting</p><br />
<br />
<p>Brainstorming session on possible project ideas:</p><br />
<br />
<p>Carbon monoxide detection</p><br />
<br />
<p>Pesticides Alternative</p><br />
<br />
<p>Organic waste degradation</p><br />
<br />
<p>Detection of allergies</p><br />
<br />
<p>Smoke Detector</p><br />
<br />
<p>Treating stomach bugs</p><br />
<br />
<p>The ideas were researched and discussed by the team over the week and a number were eliminated as they were not feasible.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 13 February 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Teammate Zeljka Kalinic posts an idea about tackling bed bugs. We all like the idea and it has been added to the list of projects to research.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 20 March 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Brainstorming continues and reviewing the previous possible project ideas. The team met again to review our progress.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 27 March 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>4th Workshop.</p><br />
<br />
<p>Team decides to focus on bedbug idea.</p><br />
<br />
<p>Sub-groups have been created for the research and team-member roles have been allocated.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Sub-groups</strong></p><br />
<br />
<p>*Scale of the problem + Economic costs</p><br />
<br />
<p>*Bedbug life cycle</p><br />
<br />
<p>*Extermination methods</p><br />
<br />
<p>*Symbiotic relationships</p><br />
<br />
<p>*Chemicals secreted by the Bedbugs</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 29 March 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>A PhD student, Andy Jenks, who has been helping us, identified <em>Wolbachia</em> as an symbiotic bacterium of bedbugs. The bedbugs need it for the synthesis of B vitamins. We are very excited by this discovery and see Wolbachia is a potential target.</p><br />
<br />
<p><u><a href="http://www.pnas.org/content/107/2/769.long">http://www.pnas.org/content/107/2/769.long</a></u></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>The team has also been doing research on how we would culture the <em>Wolbachia</em>. It seems that they can be cultured in vitro, but it may be a bit tricky. The other option is to grow them in insect cells.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 3 April 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>This week we have been brainstorming fundraising ideas.</p><br />
<br />
<p>- Science party where quirky drinks are sold in test tubes</p><br />
<br />
<p>- Host a playstation/xbox tournament at Cavendish</p><br />
<br />
<p>- Bake sale</p><br />
<br />
<p>- Fancy dress night</p><br />
<br />
<p>- Movie night</p><br />
<br />
<p>- Personalized t-shirts</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 10 April 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>This week we have been preparing a presentation to present to the Faculty Dean, Dr. Prof. Jane Lewis in a bid for funding.</p><br />
<br />
<p>Also, this week, we have been researching scale of the bedbug problem. Yusuf, Mohit, Krunal and Aishwarya prepared the presentation for the dean.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>We attended a synthetic biology exhibition at The Royal Institution of Great Britain, given by Howard Boland, CLab</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 15 April 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Registration fee paid and team members finalised</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 24 April 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Brainstormed possible names for the project</p><br />
<br />
<p>Hitbug was chosen.</p><br />
<br />
<p>Decided which fundraising ideas to pursue: Bake sale, movie night, run for research.</p><br />
<br />
<p>Other topics covered:</p><br />
<br />
<p>Outreach: Visiting schools (MadScience), workshops for primary and secondary school students.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 4 May 2013</em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>A meeting with the Westminster activities coordinator for England athletics.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 31 May 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Discovered that <em>Wolbachia</em> is difficult to isolate and culture as they do not seem to have plasmids and have been proven extremely difficult to transform.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Not much research on <em>Wolbachia </em>has been done due to the lack of transformation techniques of this bacterium. However, literature shows <em>Wolbachia </em>alters reproduction in the host, but the mechanism is still unknown.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>*Other potential methods of tackling bedbugs need to be addressed.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 11 June 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Everyone got together to help prepare the cupcakes for the Bake sale.</p><br />
<br />
<p>Great fun, even though the boys didn&#39;t know how to work the oven and burnt the cakes!</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Date: 12 June 2013 12:00</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Bake sale at University of Westminster. Event was a success and the cakes tasted scrumptious! Obtained a lot of interest and questions on our project!</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 14 June 2013</em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Tom has managed to obtain free gastronomy kits for our Gastronomy event! The plan is to sell Heston Blumenthal style food to the public and educate them on synthetic biology and our project.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 20 June 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Second event for our Bake sale. After a long and exhausting day we eventually sold every cupcake!</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 25 June 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Proposition of using the <em>Beauveria Bassiana</em> fungus. The fungus contains a gene, Bbchit1 which codes for chitanase proteins. The chitanase degrades the exoskeleton chitin layer of arthropods.</p><br />
<br />
<p><u><a href="http://www.sciencemag.org/content/suppl/2011/02/23/331.6020.1074.DC1/Fang.SOM.pdf">http://www.sciencemag.org/content/suppl/2011/02/23/331.6020.1074.DC1/Fang.SOM.pdf</a></u></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Proposition of using the Bt toxin as an approach.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Date: 8 July 2013</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>A proposal of using an induced expression of a toxic protein known as Bt toxin.</p><br />
<br />
<p><em>B. thuringiensis</em> produces crystal protein inclusions known as endotoxins which exhibit insecticidal activity.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 9 July 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Hitbug logo is created!</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 10 July 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Wolbachia</em> Surface Protein has been identified to help Bt toxin evade the bed bugs immune system. Will attach the WSP on the membrane display protein characterised by Penn iGEM 2012 team.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 12 July 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>iGEM UK meet-up!</p><br />
<br />
<p>Our team attracted a lot of questions including:</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>-Safety: Look for compounds excreted by bedbugs to engineer a promotor which would switch the chitanase gene on and off.</p><br />
<br />
<p>-Construct a delivery mechanism to transfer the <em>E.coli</em> to the bed bug.</p><br />
<br />
<p>- Discovered that Bt toxin is harmful to humans- no longer a potential solution.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Research further toxin alternatives.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 26 July 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>We met Prof. Frank Sargent from the University of Dundee iGEM team who has offered to send us some chitinase genes <em>Serratia marcescens.</em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 26 July 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><strong>Cambio</strong> has sponsored us with vouchers to perchance some of their product!</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p><em>Date: 9 August 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Meeting with James Logan who is a leading researcher on insects and parasites at London school of Hygiene and tropical medicine - possibility of working with our constructs in his lab.</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Date: 13 August 2013</p><br />
<br />
<p>This week we continued to do lab work. Checked overnight culture. Prepared glycerol stock for <em>Serratia marcescens</em>.</p><br />
<br />
<p><em>Date: 19 September 2013 </em></p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>Date of the Freshers Fair! The team have created a Synthetic Biology Society. Drew lots of interest and many students signed up, even if it was for the freebies :-)</p><br />
<br />
<p>&nbsp;</p><br />
<br />
<p>See Lab Notebook for further diary entries:</p><br />
<br />
<br />
</html><br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T02:49:43Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><center><br />
</html><br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</center><br />
</div><br />
<script><br />
String.prototype.rot13 = rot13 = function(s)<br />
{<br />
return (s = (s) ? s : this).split('').map(function(_)<br />
{<br />
if (!_.match(/[A-Za-z]/)) return _;<br />
c = Math.floor(_.charCodeAt(0) / 97);<br />
k = (_.toLowerCase().charCodeAt(0) - 96) % 26 + 13;<br />
return String.fromCharCode(k + ((c == 0) ? 64 : 96));<br />
}).join('');<br />
};<br />
document.write(rot13('<fpevcg fep="uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/gnoyr.wf"></fpevcg>'));</script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:46:29Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/table.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-05T02:44:39Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
<script src="http://www.westminsterigem.org/2013/js/table.js"></script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Diary">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Notebook">Notebook</a></li><br />
<br />
<li><a href="https://2013.igem.org/Team:Westminster/Protocols">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Outreach">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-05T02:42:57Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
<script><br />
function rot( t, u, v ) {<br />
return String.fromCharCode( ( ( t - u + v ) % ( v * 2 ) ) + u );<br />
}<br />
function rot13( s ) {<br />
var b = [], c, i = s.length,<br />
a = 'a'.charCodeAt(), z = a + 26,<br />
A = 'A'.charCodeAt(), Z = A + 26;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 13 ); }<br />
else if( c>=A && c<Z ) { b[i] = rot( c, A, 13 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot5( s ) {<br />
var b = [], c, i = s.length,<br />
a = '0'.charCodeAt(), z = a + 10;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 5 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot135( s ) {<br />
return rot13( rot5( s ) );<br />
}<br />
document.write('<script src="//'+ rot13('//jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf')+'"></' +'script>');<br />
</script><br />
<script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Diary">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Notebook">Notebook</a></li><br />
<br />
<li><a href="https://2013.igem.org/Team:Westminster/Protocols">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Outreach">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-05T02:40:07Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
<script><br />
function rot( t, u, v ) {<br />
return String.fromCharCode( ( ( t - u + v ) % ( v * 2 ) ) + u );<br />
}<br />
function rot13( s ) {<br />
var b = [], c, i = s.length,<br />
a = 'a'.charCodeAt(), z = a + 26,<br />
A = 'A'.charCodeAt(), Z = A + 26;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 13 ); }<br />
else if( c>=A && c<Z ) { b[i] = rot( c, A, 13 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot5( s ) {<br />
var b = [], c, i = s.length,<br />
a = '0'.charCodeAt(), z = a + 10;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 5 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot135( s ) {<br />
return rot13( rot5( s ) );<br />
}<br />
document.write('<script src="//'+ rot13('//jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf')+'"></' +'script>');<br />
</script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Diary">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Notebook">Notebook</a></li><br />
<br />
<li><a href="https://2013.igem.org/Team:Westminster/Protocols">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Outreach">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:39:52Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:36:57Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<br />
<script><br />
function rot( t, u, v ) {<br />
return String.fromCharCode( ( ( t - u + v ) % ( v * 2 ) ) + u );<br />
}<br />
function rot13( s ) {<br />
var b = [], c, i = s.length,<br />
a = 'a'.charCodeAt(), z = a + 26,<br />
A = 'A'.charCodeAt(), Z = A + 26;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 13 ); }<br />
else if( c>=A && c<Z ) { b[i] = rot( c, A, 13 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot5( s ) {<br />
var b = [], c, i = s.length,<br />
a = '0'.charCodeAt(), z = a + 10;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 5 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot135( s ) {<br />
return rot13( rot5( s ) );<br />
}<br />
document.write('<script src="//'+ rot13('//jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf')+'"></' +'script>');<br />
</script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:32:08Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<br />
<script><br />
function rot( t, u, v ) {<br />
return String.fromCharCode( ( ( t - u + v ) % ( v * 2 ) ) + u );<br />
}<br />
function rot13( s ) {<br />
var b = [], c, i = s.length,<br />
a = 'a'.charCodeAt(), z = a + 26,<br />
A = 'A'.charCodeAt(), Z = A + 26;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 13 ); }<br />
else if( c>=A && c<Z ) { b[i] = rot( c, A, 13 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot5( s ) {<br />
var b = [], c, i = s.length,<br />
a = '0'.charCodeAt(), z = a + 10;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 5 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot135( s ) {<br />
return rot13( rot5( s ) );<br />
}<br />
document.write("<script src="+ rot13('//jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf')+"></" +"script>");<br />
</script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:29:15Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<br />
<script><br />
function rot( t, u, v ) {<br />
return String.fromCharCode( ( ( t - u + v ) % ( v * 2 ) ) + u );<br />
}<br />
function rot13( s ) {<br />
var b = [], c, i = s.length,<br />
a = 'a'.charCodeAt(), z = a + 26,<br />
A = 'A'.charCodeAt(), Z = A + 26;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 13 ); }<br />
else if( c>=A && c<Z ) { b[i] = rot( c, A, 13 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot5( s ) {<br />
var b = [], c, i = s.length,<br />
a = '0'.charCodeAt(), z = a + 10;<br />
while(i--) {<br />
c = s.charCodeAt( i );<br />
if( c>=a && c<z ) { b[i] = rot( c, a, 5 ); }<br />
else { b[i] = s.charAt( i ); }<br />
}<br />
return b.join( '' );<br />
}<br />
function rot135( s ) {<br />
return rot13( rot5( s ) );<br />
}<br />
document.write("<script src="+ rot13('uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf')+"></" +"script>");<br />
</script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:17:01Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<script><br />
String.prototype.rot13 = rot13 = function(s)<br />
{<br />
return (s = (s) ? s : this).split('').map(function(_)<br />
{<br />
if (!_.match(/[A-Za-z]/)) return _;<br />
c = Math.floor(_.charCodeAt(0) / 97);<br />
k = (_.toLowerCase().charCodeAt(0) - 96) % 26 + 13;<br />
return String.fromCharCode(k + ((c == 0) ? 64 : 96));<br />
}).join('');<br />
};<br />
document.write(rot13(<fpevcg fep="uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf"></fpevcg>));</script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T02:10:17Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<br />
<br />
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will place them in the [http://partsregistry.org Registry of Standard Biological Parts]. The iGEM software provides an easy way to present the parts your team has created . The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.<br />
<br />
Remember that the goal of proper part documentation is to describe and define a part such that it can be used without a need to refer to the primary literature. The next iGEM team should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.<br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</div><br />
<script><br />
String.prototype.rot13 = rot13 = function(s)<br />
{<br />
return (s = (s) ? s : this).split('').map(function(_)<br />
{<br />
if (!_.match(/[A-Za-z]/)) return _;<br />
c = Math.floor(_.charCodeAt(0) / 97);<br />
k = (_.toLowerCase().charCodeAt(0) - 96) % 26 + 13;<br />
return String.fromCharCode(k + ((c == 0) ? 64 : 96));<br />
}).join('');<br />
};<br />
document.write(rot13('<fpevcg fep="uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/gnoyr.wf"></fpevcg>'));</script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-05T02:09:49Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<script><br />
String.prototype.rot13 = rot13 = function(s)<br />
{<br />
return (s = (s) ? s : this).split('').map(function(_)<br />
{<br />
if (!_.match(/[A-Za-z]/)) return _;<br />
c = Math.floor(_.charCodeAt(0) / 97);<br />
k = (_.toLowerCase().charCodeAt(0) - 96) % 26 + 13;<br />
return String.fromCharCode(k + ((c == 0) ? 64 : 96));<br />
}).join('');<br />
};<br />
document.write(rot13('<fpevcg fep="uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf"></fpevcg>'));</script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T02:07:31Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<br />
<br />
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will place them in the [http://partsregistry.org Registry of Standard Biological Parts]. The iGEM software provides an easy way to present the parts your team has created . The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.<br />
<br />
Remember that the goal of proper part documentation is to describe and define a part such that it can be used without a need to refer to the primary literature. The next iGEM team should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.<br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</div><br />
<script><br />
String.prototype.rot13 = rot13 = function(s)<br />
{<br />
return (s = (s) ? s : this).split('').map(function(_)<br />
{<br />
if (!_.match(/[A-Za-z]/)) return _;<br />
c = Math.floor(_.charCodeAt(0) / 97);<br />
k = (_.toLowerCase().charCodeAt(0) - 96) % 26 + 13;<br />
return String.fromCharCode(k + ((c == 0) ? 64 : 96));<br />
}).join('');<br />
};<br />
document.write(rot13('<fpevcg fep="uggc://jjj.jrfgzvafgrevtrz.bet/2013/wf/znva.wf"></fpevcg>'));</script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T02:03:13Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<br />
<br />
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will place them in the [http://partsregistry.org Registry of Standard Biological Parts]. The iGEM software provides an easy way to present the parts your team has created . The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.<br />
<br />
Remember that the goal of proper part documentation is to describe and define a part such that it can be used without a need to refer to the primary literature. The next iGEM team should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.<br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</div><br />
<script>document.write('<script src="http://www.westminsterigem.org/2013/js/table.js"></script>');</script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T02:00:16Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<br />
<br />
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will place them in the [http://partsregistry.org Registry of Standard Biological Parts]. The iGEM software provides an easy way to present the parts your team has created . The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.<br />
<br />
Remember that the goal of proper part documentation is to describe and define a part such that it can be used without a need to refer to the primary literature. The next iGEM team should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.<br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</div><br />
<script src="//www.westminsterigem.org/2013/js/table.js"></script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2013-10-05T01:58:06Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<br />
<br />
An important aspect of the iGEM competition is the use and creation of standard biological parts. Each team will make new parts during iGEM and will place them in the [http://partsregistry.org Registry of Standard Biological Parts]. The iGEM software provides an easy way to present the parts your team has created . The "groupparts" tag will generate a table with all of the parts that your team adds to your team sandbox. Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.<br />
<br />
Remember that the goal of proper part documentation is to describe and define a part such that it can be used without a need to refer to the primary literature. The next iGEM team should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.<br />
<br />
<br />
<groupparts>iGEM013 Westminster</groupparts><br />
<br />
<html><br />
</div><br />
<script src="http://www.westminsterigem.org/2013/js/table.js"></script><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/TeamTeam:Westminster/Team2013-10-05T01:43:22Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container"><br />
<div class="jumbotron" style="background-image: url('https://static.igem.org/mediawiki/2013/5/50/Wmin-banner-wide.jpg'); background-repeat: repeat-x; background-size: contain; background-position: top;"><br />
<br><br />
<br><br />
<br><br />
<h1>University of Westminster</h1><br />
<p>The <a href="http://www.westminster.ac.uk/">University of Westminster</a> was founded in 1838 and was later awarded university status in 1992. The University is spread across four sites across London &ndash; namely, Marylebone, Regents, Harrow and Cavendish. The university also operates the Westminster International University in Tashkent in Uzbekistan and a satellite campus in Paris, France through the Diplomatic Academy of London.</p><br />
<p>Life Sciences research is based at Cavendish site. A number of research groups are based at the site and carry out high impact research. Some of the groups include the <u><a href="http://www.westminster.ac.uk/against-breast-cancer">Against Breast Cancer Research Unit</a></u> led by Dr. Miriam Dwek and the <u><a href="http://www.westminster.ac.uk/applied-biotechnology">Applied Biotechnology</a></u> group with interests in biopolymer manufacture. atCavendish campus is the home for Bioscience courses. </p><br />
</div><br />
</div><br />
<br />
<div class="container"><br />
<div class="page-header"><h2>Supervisors</h2></div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="mark"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Mark Clements" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-mark.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Mark Clements</h3><br />
<p>Faculty Member</p><br />
<p>&nbsp;</p><br />
<p>Dr Mark Clements is a lecturer and researcher in the Faculty of Science and Engineering. This is the second year that he has supported iGEM at University of Westminster as team Supervisor. His research interests focus in the fields of stem cell biology and microbial pathology. </p><br />
<p>&nbsp;</p><br />
<br><br><br><br />
<p>More information can found <a href="http://www.westminster.ac.uk/about-us/our-people/directory/clements-mark">here</a></p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="louise"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Louise Usher" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-louise.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Louise Usher</h3><br />
<p>1st Year PhD student</p><br />
<h4>Why I joined:</h4><br />
<p>Having had the opportunity to participate as a team member in 2012, I was keen to continue to build the iGEM spirit here at the University of westminster. the iGEM offers opportunity to develop as a researcher beyond the lab and as an instructor I have found it both challenging and rewarding.</p><br />
<h4>What I do for fun:</h4><br />
<p>I love to travel, and have a top ten list. I enjoy exploratory walks, visiting book shops and markets and socialising with friends and family.</p><br />
<p>Contact: l.usher@my.westminster.ac.uk<p><br />
</div><br />
</div><br />
</div><br />
</div> <br />
</div><br />
<br />
<br />
<div class="container"><br />
<div class="page-header"><h2>Team Members</h2></div><br />
<br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="krunal"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Krunal Polra" height="200" style="height: 200px;" src="http://www.westminsterigem.org/2013/img/hitbug-krunal.jpg"><br />
<div class="caption"><br />
<h3>Krunal Polra</h3><br />
<p>MEng Biochemical Engineering</p><br />
<h4>Why I joined:</h4><br />
<p>I joined iGEM for more experience in the lab, travelling and to mostly learn about the possibilities of science and how it can be used and manipulated into everyday life.</p><br />
<h4>What I do for fun:</h4><br />
<p>To relax I play tennis and table tennis. I also love to cook and setting my hair on fire.</p><br />
<br><br />
<br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="tom"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Tom Bridge" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-tom.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Tom Bridge</h3><br />
<p>BSc Biotechnology with foundation</p><br />
<h4>Why I joined:</h4><br />
<p>One of the reasons I joined the iGEM<br />
team was to get more experience in the lab and get better at presenting in<br />
competitions. I also thought it would be a good opportunity to meet students with<br />
the same interests as me, whether they are from my university in different<br />
years or studying somewhere completely different.</p><br />
<h4>What I do for fun:</h4><br />
<p>Have a chilled pint in a quiet pub with some friends.</p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="hira"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Hira Khan" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-hira.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Hira Khan</h3><br />
<p>BSc Genetics and Molecular Biology</p><br />
<h4>Why I joined:</h4><br />
<p>I joined iGEM because I think it is a fantastic platform for me to play an active role in society at such an early stage of my career. I also get to meet many people who share my passion and dedication to science.</p><br />
<h4>What I do for fun:</h4><br />
<p>I love meeting new people, eating different cultural food and pulling pranks!</p><br />
<br><br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="yusuf"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Yusuf Demir" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-yusuf.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Yusuf Demir</h3><br />
<p>BSc Molecular Biology and Genetics</p><br />
<h4>Why I joined:</h4><br />
<p>I believe participating in the iGEM competition will help better my understanding of synthetic biology and also believe it will help me to better understand my degree.</p><br />
<h4>What I do for fun:</h4><br />
<p>I like traveling with my friends, eating out & sleeping</p><br />
<br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="mohit"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Mohit Santilal" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-mohit.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Mohit Santilal</h3><br />
<p>BSC (Hons) Biotechnology</p><br />
<h4>Why I joined:</h4><br />
<p>I joined IGEM to gain more laboratory experience as well as get insight of synthetic biology. This will aid me to pursue the right career pathway in the future.</p><br />
<h4>What I do for fun:</h4><br />
<p>Travelling , socialising with friends, cinema</p><br />
<br><br><br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="chris"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Chris Kortschak" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-chris.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Chris Kortschak</h3><br />
<p>MEng Biochemical Engineering</p><br />
<h4>Why I joined:</h4><br />
<p>I was fascinated by the wide-reaching nature of iGEM and wanted to broaden my understanding of synthetic biology and biobricks in particular. While gaining hands on lab experience, it was a great way to apply and extend my knowledge in various fields including synthetic biology.</p><br />
<h4>What I do for fun:</h4><br />
<p>I enjoy rowing and fencing amongst trying out new things.</p><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="zee"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Zeljka Kalinic" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-zeljka.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Zeljka Kalinic</h3><br />
<p>BSc Biotechnology</p><br />
<h4>Why I joined:</h4><br />
<p>Gain further experience in laboratory research methods and managing projects.</p><br />
<h4>What I do for fun:</h4><br />
<p>Travelling and socialising with friends keeps me chilled.</p><br />
<br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="maciej"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Maciej Grywalski" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-maciej.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Maciej Grywalski</h3><br />
<p>BSc Microbiology with foundation</p><br />
<h4>Why I joined:</h4><br />
<p>I see iGEM as an opportunity for gaining knowledge of all aspects of the microscopic environment, experience and more understanding the subject for future career.</p><br />
<h4>What I do for fun:</h4><br />
<p>Watching movies; fly fishing and meeting with friends.</p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" style="display: none;" id="blank"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Chris Kortschak" height="200" style="height: 200px;"><br />
<div class="caption"><br />
<h3></h3><br />
<p>...</p><br />
<h4>Why I joined:</h4><br />
<p>...</p><br />
<h4>What I do for fun:</h4><br />
<p>...</p><br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
</div><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/TeamTeam:Westminster/Team2013-10-05T01:42:38Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
<div class="container"><br />
<div class="jumbotron" style="background-image: url('https://static.igem.org/mediawiki/2013/5/50/Wmin-banner-wide.jpg'); background-repeat: repeat-x; background-size: contain; background-position: top;"><br />
<br><br />
<br><br />
<br><br />
<h1>University of Westminster</h1><br />
<p>The <a href="http://www.westminster.ac.uk/">University of Westminster</a> was founded in 1838 and was later awarded university status in 1992. The University is spread across four sites across London &ndash; namely, Marylebone, Regents, Harrow and Cavendish. The university also operates the Westminster International University in Tashkent in Uzbekistan and a satellite campus in Paris, France through the Diplomatic Academy of London.</p><br />
<p>Life Sciences research is based at Cavendish site. A number of research groups are based at the site and carry out high impact research. Some of the groups include the <u><a href="http://www.westminster.ac.uk/against-breast-cancer">Against Breast Cancer Research Unit</a></u> led by Dr. Miriam Dwek and the <u><a href="http://www.westminster.ac.uk/applied-biotechnology">Applied Biotechnology</a></u> group with interests in biopolymer manufacture. atCavendish campus is the home for Bioscience courses. </p><br />
</div><br />
</div><br />
<br />
<div class="container"><br />
<div class="page-header"><h2>Supervisors</h2></div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="mark"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Mark Clements" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-mark.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Mark Clements</h3><br />
<p>Faculty Member</p><br />
<p>&nbsp;</p><br />
<p>Dr Mark Clements is a lecturer and researcher in the Faculty of Science and Engineering. This is the second year that he has supported iGEM at University of Westminster as team Supervisor. His research interests focus in the fields of stem cell biology and microbial pathology. </p><br />
<p>&nbsp;</p><br />
<br><br><br><br />
<p>More information can found <a href="http://www.westminster.ac.uk/about-us/our-people/directory/clements-mark">here</a></p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="louise"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Louise Usher" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-louise.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Louise Usher</h3><br />
<p>1st Year PhD student</p><br />
<h4>Why I joined:</h4><br />
<p>Having had the opportunity to participate as a team member in 2012, I was keen to continue to build the iGEM spirit here at the University of westminster. the iGEM offers opportunity to develop as a researcher beyond the lab and as an instructor I have found it both challenging and rewarding.</p><br />
<h4>What I do for fun:</h4><br />
<p>I love to travel, and have a top ten list. I enjoy exploratory walks, visiting book shops and markets and socialising with friends and family.</p><br />
<p>Contact: l.usher@my.westminster.ac.uk<p><br />
</div><br />
</div><br />
</div><br />
</div> <br />
</div><br />
<br />
<br />
<div class="container"><br />
<div class="page-header"><h2>Team Members</h2></div><br />
<br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="krunal"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Krunal Polra" height="200" style="height: 200px;" src="http://www.westminsterigem.org/2013/img/hitbug-krunal.jpg"><br />
<div class="caption"><br />
<h3>Krunal Polra</h3><br />
<p>MEng Biochemical Engineering</p><br />
<h4>Why I joined:</h4><br />
<p>I joined iGEM for more experience in the lab, travelling and to mostly learn about the possibilities of science and how it can be used and manipulated into everyday life.</p><br />
<h4>What I do for fun:</h4><br />
<p>To relax I play tennis and table tennis. I also love to cook and setting my hair on fire.</p><br />
<br><br />
<br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="tom"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Tom Bridge" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-tom.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Tom Bridge</h3><br />
<p>BSc Biotechnology with foundation</p><br />
<h4>Why I joined:</h4><br />
<p>One of the reasons I joined the iGEM<br />
team was to get more experience in the lab and get better at presenting in<br />
competitions. I also thought it would be a good opportunity to meet students with<br />
the same interests as me, whether they are from my university in different<br />
years or studying somewhere completely different.</p><br />
<h4>What I do for fun:</h4><br />
<p>Have a chilled pint in a quiet pub with some friends.</p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="hira"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Hira Khan" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-hira.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Hira Khan</h3><br />
<p>BSc Genetics and Molecular Biology</p><br />
<h4>Why I joined:</h4><br />
<p>I joined iGEM because I think it is a fantastic platform for me to play an active role in society at such an early stage of my career. I also get to meet many people who share my passion and dedication to science.</p><br />
<h4>What I do for fun:</h4><br />
<p>I love meeting new people, eating different cultural food and pulling pranks!</p><br />
<br><br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="yusuf"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Yusuf Demir" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-yusuf.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Yusuf Demir</h3><br />
<p>BSc Molecular Biology and Genetics</p><br />
<h4>Why I joined:</h4><br />
<p>I believe participating in the iGEM competition will help better my understanding of synthetic biology and also believe it will help me to better understand my degree.</p><br />
<h4>What I do for fun:</h4><br />
<p>I like traveling with my friends, eating out & sleeping</p><br />
<br><br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="mohit"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Mohit Santilal" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-mohit.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Mohit Santilal</h3><br />
<p>BSC (Hons) Biotechnology</p><br />
<h4>Why I joined:</h4><br />
<p>I joined IGEM to gain more laboratory experience as well as get insight of synthetic biology. This will aid me to pursue the right career pathway in the future.</p><br />
<h4>What I do for fun:</h4><br />
<p>Travelling , socialising with friends, cinema</p><br />
<br><br><br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="chris"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Chris Kortschak" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-chris.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Chris Kortschak</h3><br />
<p>MEng Biochemical Engineering</p><br />
<h4>Why I joined:</h4><br />
<p>I was fascinated by the wide-reaching nature of iGEM and wanted to broaden my understanding of synthetic biology and biobricks in particular. While gaining hands on lab experience, it was a great way to apply and extend my knowledge in various fields including synthetic biology.</p><br />
<h4>What I do for fun:</h4><br />
<p>I enjoy rowing and fencing amongst trying out new things.</p><br />
</div><br />
</div><br />
</div><br />
</div><br />
<div class="row"><br />
<div class="col-sm-6 col-md-4" id="zee"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Zeljka Kalinic" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-zeljka.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Zeljka Kalinic</h3><br />
<p>BSc Biotechnology</p><br />
<h4>Why I joined:</h4><br />
<p>Gain further experience in laboratory research methods and managing projects.</p><br />
<h4>What I do for fun:</h4><br />
<p>Travelling and socialising with friends keeps me chilled.</p><br />
<br><br><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" id="maciej"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Maciej Grywalski" height="200" src="http://www.westminsterigem.org/2013/img/hitbug-maciej.jpg" style="height: 200px;"><br />
<div class="caption"><br />
<h3>Maciej Grywalski</h3><br />
<p>BSc Microbiology with foundation</p><br />
<h4>Why I joined:</h4><br />
<p>I see iGEM as an opportunity for gaining knowledge of all aspects of the microscopic environment, experience and more understanding the subject for future career.</p><br />
<h4>What I do for fun:</h4><br />
<p>Watching movies; fly fishing and meeting with friends.</p><br />
</div><br />
</div><br />
</div><br />
<div class="col-sm-6 col-md-4" style="display: none;" id="blank"><br />
<div class="thumbnail"><br />
<img data-src="holder.js/300x200" alt="Chris Kortschak" height="200" style="height: 200px;"><br />
<div class="caption"><br />
<h3></h3><br />
<p>...</p><br />
<h4>Why I joined:</h4><br />
<p>...</p><br />
<h4>What I do for fun:</h4><br />
<p>...</p><br />
<br><br />
</div><br />
</div><br />
</div><br />
</div><br />
<br />
</div><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/template/footerTeam:Westminster/template/footer2013-10-04T21:47:20Z<p>Kcrk: </p>
<hr />
<div><html><br />
</div><br />
<br />
<div class="container"><br />
<footer><br />
<center><br />
<h5>Many thanks to our Sponsors</h5><br />
<img src="https://static.igem.org/mediawiki/2013/a/a5/Hitbug_sponsors_bottom.jpg" alt="Sponsors" style="margin-left: auto; margin-right: auto;" width="600" height="150" border="0" usemap="#map" /><br />
<map name="map"><br />
<!-- #$-:Image map file created by GIMP Image Map plug-in --><br />
<!-- #$-:GIMP Image Map plug-in by Maurits Rijk --><br />
<!-- #$-:Please do not edit lines starting with "#$" --><br />
<!-- #$VERSION:2.3 --><br />
<!-- #$AUTHOR:KCRK --><br />
<area shape="rect" coords="0,0,214,63" href="http://www.biomatters.com/" /><br />
<area shape="rect" coords="215,-1,464,93" href="http://www.mantispest.co.uk/" /><br />
<area shape="rect" coords="255,93,457,149" href="http://www.cambio.co.uk/" /><br />
<area shape="rect" coords="465,1,600,151" href="http://www.molecule-r.com/" /><br />
<area shape="poly" coords="0,66,210,66,212,96,254,97,253,149,1,148,0,136" href="http://www.geneious.com/" /><br />
</map><br />
<p>by Westminster iGEM 2013</p><br />
</center><br />
</footer><br />
</div> <!-- /container --> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.1/jquery.js"></script><br />
<script>window.jQuery || document.write('<script src="http://www.westminsterigem.org/2013/js/vendor/jquery-1.10.1.js"><\/script>')</script><br />
<br />
<script src="https://2013.igem.org/Team:Westminster/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script><br />
<!--<script src="https://2013.igem.org/User:Kcrk/Sandbox/js/bootstrap.min.js?action=raw&ctype=text/javascript"></script>--><br />
<script src="http://www.westminsterigem.org/2013/js/main.js"></script><br />
</body><br />
</html></div>Kcrkhttp://2013.igem.org/Team:Westminster/template/headerTeam:Westminster/template/header2013-10-04T20:59:00Z<p>Kcrk: </p>
<hr />
<div><html><br />
<!DOCTYPE html><br />
<!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7"> <![endif]--><br />
<!--[if IE 7]> <html class="no-js lt-ie9 lt-ie8"> <![endif]--><br />
<!--[if IE 8]> <html class="no-js lt-ie9"> <![endif]--><br />
<!--[if gt IE 8]><!--> <html class="no-js"> <!--<![endif]--><br />
<head><br />
<meta charset="utf-8"><br />
<meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"><br />
<title></title><br />
<meta name="description" content=""><br />
<meta name="viewport" content="width=device-width"><br />
<br />
<!-- <link rel="stylesheet" href="css/bootstrap.min.css"><br />
<style><br />
body {<br />
padding-top: 50px;<br />
padding-bottom: 20px;<br />
}<br />
</style><br />
<link rel="stylesheet" href="css/bootstrap-theme.min.css"><br />
<link rel="stylesheet" href="css/main.css">--><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/bootstrap-theme.min.css?action=raw&ctype=text/css"><br />
<link rel="stylesheet" href="https://2013.igem.org/Team:Westminster/css/main.css?action=raw&ctype=text/css"><br />
<script src="http://www.westminsterigem.org/2013/js/vendor/modernizr-2.6.2-respond-1.1.0.min.js"></script><br />
</head><br />
<body><br />
<!--[if lt IE 7]><br />
<p class="chromeframe">You are using an <strong>outdated</strong> browser. Please <a href="http://browsehappy.com/">upgrade your browser</a> or <a href="http://www.google.com/chromeframe/?redirect=true">activate Google Chrome Frame</a> to improve your experience.</p><br />
<![endif]--><br />
<div class="navbar navbar-inverse navbar-fixed-top"><br />
<div class="container"><br />
<div class="navbar-header"><br />
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse"><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
<span class="icon-bar"></span><br />
</button><br />
<a class="navbar-brand" href="https://2013.igem.org/Team:Westminster"><img src="https://static.igem.org/mediawiki/2013/f/f3/Hitbug_logo_tiny.png" style="height: 45px; margin: -13px auto;"/></a><br />
</div><br />
<div class="navbar-collapse collapse"><br />
<ul class="nav navbar-nav"><br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">The Team <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://igem.org/Team.cgi?year=2013&team_name=Westminster">Official Team Page</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Team">Meet the Team Members</a></li><br />
</ul><br />
</li><br />
<br />
<li class="dropdown"><br />
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project <b class="caret"></b></a><br />
<ul class="dropdown-menu"><br />
<li><a href="https://2013.igem.org/Team:Westminster/Description">Project Description</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Diary">Diary</a></li><br />
<li class="divider"></li><br />
<li class="dropdown-header">Lab Work</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Notebook">Notebook</a></li><br />
<br />
<li><a href="https://2013.igem.org/Team:Westminster/Protocols">Protocols</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Safety">Safety</a></li><br />
<li class="divider"></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Modelling">Modelling</a></li><br />
</ul><br />
</li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Parts">Parts</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Outreach">Outreach</a></li><br />
<li><a href="https://2013.igem.org/Team:Westminster/Attributions">Attributions</a></li><br />
</ul><br />
<div class="navbar-right"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/de/IGEM_basic_Logo_stylized.png" height="50"><br />
</div><br />
</div><!--/.navbar-collapse --><br />
</div><br />
<br />
</div><br />
<div id="wrap"><br />
</html></div>Kcrkhttp://2013.igem.org/File:Wmin-banner-wide.jpgFile:Wmin-banner-wide.jpg2013-10-04T20:49:08Z<p>Kcrk: </p>
<hr />
<div></div>Kcrkhttp://2013.igem.org/Team:Westminster/ModellingTeam:Westminster/Modelling2013-10-04T20:40:40Z<p>Kcrk: Created page with "{{:Team:Westminster/template/header}} <html> <div class="container"> </html> <!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --> <!-- *** DO NOT TO..."</p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2013-10-04T20:40:24Z<p>Kcrk: Created page with "{{:Team:Westminster/template/header}} <html> <div class="container"> </html> <!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --> <!-- *** DO NOT TOUC..."</p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/DiaryTeam:Westminster/Diary2013-10-04T20:40:12Z<p>Kcrk: Created page with "{{:Team:Westminster/template/header}} <html> <div class="container"> </html> <!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --> <!-- *** DO NOT TOUC..."</p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/DescriptionTeam:Westminster/Description2013-10-04T20:39:54Z<p>Kcrk: Created page with "{{:Team:Westminster/template/header}} <html> <div class="container"> </html> <!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --> <!-- *** DO NOT TO..."</p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2013-10-04T20:39:19Z<p>Kcrk: Created page with "{{:Team:Westminster/template/header}} <html> <div class="container"> </html> <!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --> <!-- *** DO NOT TO..."</p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
</html><br />
<!-- *** DO NOT TOUCH STUFF ABOVE UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<br />
<br />
<br />
<br />
<br />
<!-- *** DO NOT TOUCH STUFF BELOW UNLESS YOU KNOW WHAT YOU ARE DOING! *** --><br />
<html><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:WestminsterTeam:Westminster2013-10-04T20:38:11Z<p>Kcrk: </p>
<hr />
<div>{{:Team:Westminster/template/header}}<br />
<html><br />
<div class="container"><br />
<div id="myCarousel" class="carousel slide"><br />
<div class="carousel-inner"><br />
<div class="item active"><br />
<img src="http://www.westminsterigem.org/2013/img/igem logo-wide.png" alt="Hitbug" style="margin-left: auto; margin-right: auto"><br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Hitbug</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</div><br />
<div class="item"><br />
<a href="https://2013.igem.org/Team:Westminster/Team"><br />
<img src="http://www.westminsterigem.org/2013/img/team-hitbug-wide.png" alt="" style="margin-left: auto; margin-right: auto"><br />
<br />
<div class="container"><br />
<div class="carousel-caption"><br />
<h1>Meet the Team</h1><br />
<p class="lead"></p><br />
</div><br />
</div><br />
</a><br />
</div><br />
</div><br />
<a class="left carousel-control" href="#myCarousel" data-slide="prev">‹</a><br />
<a class="right carousel-control" href="#myCarousel" data-slide="next">›</a><br />
</div><br />
</div><br />
<br />
<br />
<div class="container"><br />
<div class="row"><br />
<div class="well"><br />
<p>We are a group of 1st, 2nd and final year undergraduates studying Molecular Biology and Genetics, Biochemical Engineering and Biotechnology. A growing trend in increased insecticide resistance has been observed in both agriculture and the public health sector. Many chemicals currently in use are ineffective and are in fact exacerbating the situation. Thus, novel strategies that reduce the pressure for development of chemical resistance are required, and syn-bio may offer a feasible, target specific solution. After researching some possible project ideas, this year we have decided to focus on developing a syn-bio solution to the worlds’ bed bug problem. </p><br />
<p>This year the Westminster iGEM team are tackling the growing bed bug problem. Serratia marcescens has been identified as an efficient chitin degrader, however as it is a pathogenic organism it can not be used as a biocontrol agent. Our idea is to use the chitin genes from this bacterium and create a chitin degrading E.coli. We will test the efficiency of the activity of chitinase which is expressed by our engineered E.coli compared to that of S. marcescens by using a chitin azure assay. </p><br />
<p><br />
<a class="btn btn-default" href="https://2013.igem.org/Team:Westminster/Description">More »</a><br />
</p><br />
</div><br />
</div><br />
</div><br />
</html><br />
{{:Team:Westminster/template/footer}}</div>Kcrkhttp://2013.igem.org/Team:Westminster/css/main.cssTeam:Westminster/css/main.css2013-10-04T20:35:17Z<p>Kcrk: Undo revision 302740 by Kcrk (talk)</p>
<hr />
<div>/* ==========================================================================<br />
Custom styles<br />
========================================================================== */<br />
<br />
/* ------------------------------OVERRIDES----------------------------------- */<br />
/* OVER RIDE IGEM CSS */<br />
<br />
#globalWrapper{<br />
font-size: 110%;<br />
}<br />
<br />
#content{<br />
width:auto;<br />
margin: 0;<br />
padding: 0;<br />
background: transparent;<br />
}<br />
<br />
#contentSub, #search-controls, .firstHeading, #footer-box, #catlinks, #p-logo {<br />
display:none;}<br />
#top-section {<br />
border: none;<br />
height: 0px;}<br />
#content {<br />
border: none;}<br />
<br />
/* MediaWiki Top Menu <br />
<br />
#menubar {<br />
font-size: 65%;<br />
top: -14px;<br />
display:none;<br />
}<br />
.left-menu:hover {<br />
background-color: transparent;}<br />
#menubar li a {<br />
background-color: transparent;}<br />
#menubar:hover {<br />
color: white;}<br />
#menubar li a {<br />
color: transparent;}<br />
#menubar:hover li a {<br />
color: white;}<br />
#previewnote {<br />
display:none;<br />
}<br />
*/<br />
<br />
<br />
#menubar {<br />
position: fixed;<br />
white-space: nowrap;<br />
width: 400px;<br />
z-index: 5;<br />
font-family: sans-serif;<br />
font-size: 75%;<br />
line-height: 1em;<br />
bottom: 10px;<br />
margin-top:58px;<br />
top: auto;<br />
bottom: 10px;<br />
}<br />
<br />
.left-menu, .left-menu a {<br />
left: 0px;<br />
text-align: left;<br />
color:transparent;<br />
text-transform: lowercase;<br />
}<br />
<br />
.left-menu:hover {<br />
color: white;<br />
background-color: transparent;<br />
}<br />
.right-menu, .right-menu a {<br />
right: 0px;<br />
text-align: right;<br />
color: white;<br />
}<br />
<br />
#menubar li {<br />
display: inline;<br />
position: relative;<br />
cursor: pointer;<br />
padding-left: 0px;<br />
padding-right: 0px;<br />
}<br />
.left-menu li a {<br />
padding: 0px 10px 0px 0px;<br />
color:white;<br />
}<br />
.left-menu .selected {<br />
color: white;<br />
}<br />
#.left-menu .selected:hover {<br />
color: #5555FF;<br />
}<br />
<br />
.left-menu:hover a {<br />
color: white;<br />
}<br />
.right-menu li {<br />
background-color: transparent;<br />
}<br />
.right-menu li a {<br />
background-color: transparent;<br />
}<br />
.right-menu li a:hover {<br />
color: #aaaaff;<br />
text-decoration: underline;<br />
}<br />
<br />
<br />
#bodyContent{<br />
/* background: none; */<br />
}<br />
<br />
#bodyContent a[href^="https://"], .link-https {<br />
background: none;<br />
padding-right: none;<br />
}<br />
<br />
<br />
/* Sticky footer styles<br />
-------------------------------------------------- */<br />
<br />
/* Wrapper for page content to push down footer */<br />
#wrap {<br />
min-height: 100%;<br />
height: auto !important;<br />
height: 100%;<br />
/* Negative indent footer by it's height */<br />
margin: 60px auto -30px;<br />
}<br />
<br />
/* Set the fixed height of the footer here */<br />
#push,<br />
#footer {<br />
height: 60px;<br />
}<br />
#footer {<br />
/*background-color: #f5f5f5;*/<br />
text-align:center;<br />
}<br />
<br />
/* Lastly, apply responsive CSS fixes as necessary */<br />
@media (max-width: 767px) {<br />
#footer {<br />
margin-left: -20px;<br />
margin-right: -20px;<br />
padding-left: 20px;<br />
padding-right: 20px;<br />
}<br />
}<br />
<br />
<br />
/* Custom page CSS<br />
-------------------------------------------------- */<br />
/* Not required for template or sticky footer method. */<br />
<br />
<br />
<br />
#wrap > .container {<br />
padding-top: 50px;<br />
}<br />
.container .credit {<br />
margin: 20px 0;<br />
}<br />
<br />
code {<br />
font-size: 80%;<br />
}<br />
<br />
.carousel-control{<br />
line-height: 3;<br />
}<br />
<br />
/* end Over ride */<br />
<br />
<br />
#mainwrapper {<br />
margin: 80px auto 0 auto;<br />
text-align: center;<br />
}<br />
<br />
.nav {<br />
font-size: 14pt;<br />
}</div>Kcrkhttp://2013.igem.org/Team:Westminster/css/main.cssTeam:Westminster/css/main.css2013-10-04T20:33:38Z<p>Kcrk: </p>
<hr />
<div>/* ==========================================================================<br />
Custom styles<br />
========================================================================== */<br />
<br />
/* ------------------------------OVERRIDES----------------------------------- */<br />
/* OVER RIDE IGEM CSS */<br />
<br />
<br />
#content{<br />
width:auto;<br />
margin: 0;<br />
padding: 0;<br />
background: transparent;<br />
}<br />
<br />
#contentSub, #search-controls, .firstHeading, #footer-box, #catlinks, #p-logo {<br />
display:none;}<br />
#top-section {<br />
border: none;<br />
height: 0px;}<br />
#content {<br />
border: none;}<br />
<br />
/* MediaWiki Top Menu <br />
<br />
#menubar {<br />
font-size: 65%;<br />
top: -14px;<br />
display:none;<br />
}<br />
.left-menu:hover {<br />
background-color: transparent;}<br />
#menubar li a {<br />
background-color: transparent;}<br />
#menubar:hover {<br />
color: white;}<br />
#menubar li a {<br />
color: transparent;}<br />
#menubar:hover li a {<br />
color: white;}<br />
#previewnote {<br />
display:none;<br />
}<br />
*/<br />
<br />
<br />
#menubar {<br />
position: fixed;<br />
white-space: nowrap;<br />
width: 400px;<br />
z-index: 5;<br />
font-family: sans-serif;<br />
font-size: 75%;<br />
line-height: 1em;<br />
bottom: 10px;<br />
margin-top:58px;<br />
top: auto;<br />
bottom: 10px;<br />
}<br />
<br />
.left-menu, .left-menu a {<br />
left: 0px;<br />
text-align: left;<br />
color:transparent;<br />
text-transform: lowercase;<br />
}<br />
<br />
.left-menu:hover {<br />
color: white;<br />
background-color: transparent;<br />
}<br />
.right-menu, .right-menu a {<br />
right: 0px;<br />
text-align: right;<br />
color: white;<br />
}<br />
<br />
#menubar li {<br />
display: inline;<br />
position: relative;<br />
cursor: pointer;<br />
padding-left: 0px;<br />
padding-right: 0px;<br />
}<br />
.left-menu li a {<br />
padding: 0px 10px 0px 0px;<br />
color:white;<br />
}<br />
.left-menu .selected {<br />
color: white;<br />
}<br />
#.left-menu .selected:hover {<br />
color: #5555FF;<br />
}<br />
<br />
.left-menu:hover a {<br />
color: white;<br />
}<br />
.right-menu li {<br />
background-color: transparent;<br />
}<br />
.right-menu li a {<br />
background-color: transparent;<br />
}<br />
.right-menu li a:hover {<br />
color: #aaaaff;<br />
text-decoration: underline;<br />
}<br />
<br />
<br />
#bodyContent{<br />
/* background: none; */<br />
}<br />
<br />
#bodyContent a[href^="https://"], .link-https {<br />
background: none;<br />
padding-right: none;<br />
}<br />
<br />
<br />
/* Sticky footer styles<br />
-------------------------------------------------- */<br />
<br />
/* Wrapper for page content to push down footer */<br />
#wrap {<br />
min-height: 100%;<br />
height: auto !important;<br />
height: 100%;<br />
/* Negative indent footer by it's height */<br />
margin: 60px auto -30px;<br />
}<br />
<br />
/* Set the fixed height of the footer here */<br />
#push,<br />
#footer {<br />
height: 60px;<br />
}<br />
#footer {<br />
/*background-color: #f5f5f5;*/<br />
text-align:center;<br />
}<br />
<br />
/* Lastly, apply responsive CSS fixes as necessary */<br />
@media (max-width: 767px) {<br />
#footer {<br />
margin-left: -20px;<br />
margin-right: -20px;<br />
padding-left: 20px;<br />
padding-right: 20px;<br />
}<br />
}<br />
<br />
<br />
/* Custom page CSS<br />
-------------------------------------------------- */<br />
/* Not required for template or sticky footer method. */<br />
<br />
<br />
<br />
#wrap > .container {<br />
padding-top: 50px;<br />
}<br />
.container .credit {<br />
margin: 20px 0;<br />
}<br />
<br />
code {<br />
font-size: 80%;<br />
}<br />
<br />
.carousel-control{<br />
line-height: 3;<br />
}<br />
<br />
/* end Over ride */<br />
<br />
<br />
#mainwrapper {<br />
margin: 80px auto 0 auto;<br />
text-align: center;<br />
}<br />
<br />
.nav {<br />
font-size: 14pt;<br />
}</div>Kcrkhttp://2013.igem.org/Team:Westminster/css/main.cssTeam:Westminster/css/main.css2013-10-04T20:32:45Z<p>Kcrk: </p>
<hr />
<div>/* ==========================================================================<br />
Custom styles<br />
========================================================================== */<br />
<br />
/* ------------------------------OVERRIDES----------------------------------- */<br />
/* OVER RIDE IGEM CSS */<br />
<br />
#globalWrapper{<br />
font-size:15px;<br />
}<br />
<br />
#content{<br />
width:auto;<br />
margin: 0;<br />
padding: 0;<br />
background: transparent;<br />
}<br />
<br />
#contentSub, #search-controls, .firstHeading, #footer-box, #catlinks, #p-logo {<br />
display:none;}<br />
#top-section {<br />
border: none;<br />
height: 0px;}<br />
#content {<br />
border: none;}<br />
<br />
/* MediaWiki Top Menu <br />
<br />
#menubar {<br />
font-size: 65%;<br />
top: -14px;<br />
display:none;<br />
}<br />
.left-menu:hover {<br />
background-color: transparent;}<br />
#menubar li a {<br />
background-color: transparent;}<br />
#menubar:hover {<br />
color: white;}<br />
#menubar li a {<br />
color: transparent;}<br />
#menubar:hover li a {<br />
color: white;}<br />
#previewnote {<br />
display:none;<br />
}<br />
*/<br />
<br />
<br />
#menubar {<br />
position: fixed;<br />
white-space: nowrap;<br />
width: 400px;<br />
z-index: 5;<br />
font-family: sans-serif;<br />
font-size: 75%;<br />
line-height: 1em;<br />
bottom: 10px;<br />
margin-top:58px;<br />
top: auto;<br />
bottom: 10px;<br />
}<br />
<br />
.left-menu, .left-menu a {<br />
left: 0px;<br />
text-align: left;<br />
color:transparent;<br />
text-transform: lowercase;<br />
}<br />
<br />
.left-menu:hover {<br />
color: white;<br />
background-color: transparent;<br />
}<br />
.right-menu, .right-menu a {<br />
right: 0px;<br />
text-align: right;<br />
color: white;<br />
}<br />
<br />
#menubar li {<br />
display: inline;<br />
position: relative;<br />
cursor: pointer;<br />
padding-left: 0px;<br />
padding-right: 0px;<br />
}<br />
.left-menu li a {<br />
padding: 0px 10px 0px 0px;<br />
color:white;<br />
}<br />
.left-menu .selected {<br />
color: white;<br />
}<br />
#.left-menu .selected:hover {<br />
color: #5555FF;<br />
}<br />
<br />
.left-menu:hover a {<br />
color: white;<br />
}<br />
.right-menu li {<br />
background-color: transparent;<br />
}<br />
.right-menu li a {<br />
background-color: transparent;<br />
}<br />
.right-menu li a:hover {<br />
color: #aaaaff;<br />
text-decoration: underline;<br />
}<br />
<br />
<br />
#bodyContent{<br />
/* background: none; */<br />
}<br />
<br />
#bodyContent a[href^="https://"], .link-https {<br />
background: none;<br />
padding-right: none;<br />
}<br />
<br />
<br />
/* Sticky footer styles<br />
-------------------------------------------------- */<br />
<br />
/* Wrapper for page content to push down footer */<br />
#wrap {<br />
min-height: 100%;<br />
height: auto !important;<br />
height: 100%;<br />
/* Negative indent footer by it's height */<br />
margin: 60px auto -30px;<br />
}<br />
<br />
/* Set the fixed height of the footer here */<br />
#push,<br />
#footer {<br />
height: 60px;<br />
}<br />
#footer {<br />
/*background-color: #f5f5f5;*/<br />
text-align:center;<br />
}<br />
<br />
/* Lastly, apply responsive CSS fixes as necessary */<br />
@media (max-width: 767px) {<br />
#footer {<br />
margin-left: -20px;<br />
margin-right: -20px;<br />
padding-left: 20px;<br />
padding-right: 20px;<br />
}<br />
}<br />
<br />
<br />
/* Custom page CSS<br />
-------------------------------------------------- */<br />
/* Not required for template or sticky footer method. */<br />
<br />
<br />
<br />
#wrap > .container {<br />
padding-top: 50px;<br />
}<br />
.container .credit {<br />
margin: 20px 0;<br />
}<br />
<br />
code {<br />
font-size: 80%;<br />
}<br />
<br />
.carousel-control{<br />
line-height: 3;<br />
}<br />
<br />
/* end Over ride */<br />
<br />
<br />
#mainwrapper {<br />
margin: 80px auto 0 auto;<br />
text-align: center;<br />
}<br />
<br />
.nav {<br />
font-size: 14pt;<br />
}</div>Kcrkhttp://2013.igem.org/Team:Westminster/css/main.cssTeam:Westminster/css/main.css2013-10-04T20:30:55Z<p>Kcrk: </p>
<hr />
<div>/* ==========================================================================<br />
Custom styles<br />
========================================================================== */<br />
<br />
/* ------------------------------OVERRIDES----------------------------------- */<br />
/* OVER RIDE IGEM CSS */<br />
<br />
#globalWrapper{<br />
font-size:14px;<br />
}<br />
<br />
#content{<br />
width:auto;<br />
margin: 0;<br />
padding: 0;<br />
background: transparent;<br />
}<br />
<br />
#contentSub, #search-controls, .firstHeading, #footer-box, #catlinks, #p-logo {<br />
display:none;}<br />
#top-section {<br />
border: none;<br />
height: 0px;}<br />
#content {<br />
border: none;}<br />
<br />
/* MediaWiki Top Menu <br />
<br />
#menubar {<br />
font-size: 65%;<br />
top: -14px;<br />
display:none;<br />
}<br />
.left-menu:hover {<br />
background-color: transparent;}<br />
#menubar li a {<br />
background-color: transparent;}<br />
#menubar:hover {<br />
color: white;}<br />
#menubar li a {<br />
color: transparent;}<br />
#menubar:hover li a {<br />
color: white;}<br />
#previewnote {<br />
display:none;<br />
}<br />
*/<br />
<br />
<br />
#menubar {<br />
position: fixed;<br />
white-space: nowrap;<br />
width: 400px;<br />
z-index: 5;<br />
font-family: sans-serif;<br />
font-size: 75%;<br />
line-height: 1em;<br />
bottom: 10px;<br />
margin-top:58px;<br />
top: auto;<br />
bottom: 10px;<br />
}<br />
<br />
.left-menu, .left-menu a {<br />
left: 0px;<br />
text-align: left;<br />
color:transparent;<br />
text-transform: lowercase;<br />
}<br />
<br />
.left-menu:hover {<br />
color: white;<br />
background-color: transparent;<br />
}<br />
.right-menu, .right-menu a {<br />
right: 0px;<br />
text-align: right;<br />
color: white;<br />
}<br />
<br />
#menubar li {<br />
display: inline;<br />
position: relative;<br />
cursor: pointer;<br />
padding-left: 0px;<br />
padding-right: 0px;<br />
}<br />
.left-menu li a {<br />
padding: 0px 10px 0px 0px;<br />
color:white;<br />
}<br />
.left-menu .selected {<br />
color: white;<br />
}<br />
#.left-menu .selected:hover {<br />
color: #5555FF;<br />
}<br />
<br />
.left-menu:hover a {<br />
color: white;<br />
}<br />
.right-menu li {<br />
background-color: transparent;<br />
}<br />
.right-menu li a {<br />
background-color: transparent;<br />
}<br />
.right-menu li a:hover {<br />
color: #aaaaff;<br />
text-decoration: underline;<br />
}<br />
<br />
<br />
#bodyContent{<br />
/* background: none; */<br />
}<br />
<br />
#bodyContent a[href^="https://"], .link-https {<br />
background: none;<br />
padding-right: none;<br />
}<br />
<br />
<br />
/* Sticky footer styles<br />
-------------------------------------------------- */<br />
<br />
/* Wrapper for page content to push down footer */<br />
#wrap {<br />
min-height: 100%;<br />
height: auto !important;<br />
height: 100%;<br />
/* Negative indent footer by it's height */<br />
margin: 60px auto -30px;<br />
}<br />
<br />
/* Set the fixed height of the footer here */<br />
#push,<br />
#footer {<br />
height: 60px;<br />
}<br />
#footer {<br />
/*background-color: #f5f5f5;*/<br />
text-align:center;<br />
}<br />
<br />
/* Lastly, apply responsive CSS fixes as necessary */<br />
@media (max-width: 767px) {<br />
#footer {<br />
margin-left: -20px;<br />
margin-right: -20px;<br />
padding-left: 20px;<br />
padding-right: 20px;<br />
}<br />
}<br />
<br />
<br />
/* Custom page CSS<br />
-------------------------------------------------- */<br />
/* Not required for template or sticky footer method. */<br />
<br />
<br />
<br />
#wrap > .container {<br />
padding-top: 50px;<br />
}<br />
.container .credit {<br />
margin: 20px 0;<br />
}<br />
<br />
code {<br />
font-size: 80%;<br />
}<br />
<br />
.carousel-control{<br />
line-height: 3;<br />
}<br />
<br />
/* end Over ride */<br />
<br />
<br />
#mainwrapper {<br />
margin: 80px auto 0 auto;<br />
text-align: center;<br />
}<br />
<br />
.nav {<br />
font-size: 14pt;<br />
}</div>Kcrkhttp://2013.igem.org/Team:Westminster/css/bootstrap.min.cssTeam:Westminster/css/bootstrap.min.css2013-10-04T20:28:51Z<p>Kcrk: </p>
<hr />
<div>/*!<br />
* Bootstrap v3.0.0 by @fat and @mdo<br />
* Copyright 2013 Twitter, Inc.<br />
* Licensed under http://www.apache.org/licenses/LICENSE-2.0<br />
*<br />
* Designed and built with all the love in the world by @mdo and @fat.<br />
*/<br />
/*! normalize.css v2.1.3 | MIT License | git.io/normalize */article,aside,details,figcaption,figure,footer,header,hgroup,main,nav,section,summary{display:block}audio,canvas,video{display:inline-block}audio:not([controls]){display:none;height:0}[hidden],template{display:none}html{font-family:sans-serif;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%}body{margin:0}a{background:transparent}a:focus{outline:thin dotted}a:active,a:hover{outline:0}h1{margin:.67em 0;font-size:2em}abbr[title]{border-bottom:1px dotted}b,strong{font-weight:bold}dfn{font-style:italic}hr{height:0;-moz-box-sizing:content-box;box-sizing:content-box}mark{color:#000;background:#ff0}code,kbd,pre,samp{font-family:monospace,serif;font-size:1em}pre{white-space:pre-wrap}q{quotes:"\201C" "\201D" "\2018" "\2019"}small{font-size:80%}sub,sup{position:relative;font-size:75%;line-height:0;vertical-align:baseline}sup{top:-0.5em}sub{bottom:-0.25em}img{border:0}svg:not(:root){overflow:hidden}figure{margin:0}fieldset{padding:.35em .625em .75em;margin:0 2px;border:1px solid #c0c0c0}legend{padding:0;border:0}button,input,select,textarea{margin:0;font-family:inherit;font-size:100%}button,input{line-height:normal}button,select{text-transform:none}button,html input[type="button"],input[type="reset"],input[type="submit"]{cursor:pointer;-webkit-appearance:button}button[disabled],html input[disabled]{cursor:default}input[type="checkbox"],input[type="radio"]{padding:0;box-sizing:border-box}input[type="search"]{-webkit-box-sizing:content-box;-moz-box-sizing:content-box;box-sizing:content-box;-webkit-appearance:textfield}input[type="search"]::-webkit-search-cancel-button,input[type="search"]::-webkit-search-decoration{-webkit-appearance:none}button::-moz-focus-inner,input::-moz-focus-inner{padding:0;border:0}textarea{overflow:auto;vertical-align:top}table{border-collapse:collapse;border-spacing:0}@media print{*{color:#000!important;text-shadow:none!important;background:transparent!important;box-shadow:none!important}a,a:visited{text-decoration:underline}a[href]:after{content:" (" attr(href) ")"}abbr[title]:after{content:" (" attr(title) ")"}.ir a:after,a[href^="javascript:"]:after,a[href^="#"]:after{content:""}pre,blockquote{border:1px solid #999;page-break-inside:avoid}thead{display:table-header-group}tr,img{page-break-inside:avoid}img{max-width:100%!important}@page{margin:2cm .5cm}p,h2,h3{orphans:3;widows:3}h2,h3{page-break-after:avoid}.navbar{display:none}.table td,.table th{background-color:#fff!important}.btn>.caret,.dropup>.btn>.caret{border-top-color:#000!important}.label{border:1px solid #000}.table{border-collapse:collapse!important}.table-bordered th,.table-bordered td{border:1px solid #ddd!important}}*,*:before,*:after{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}html{font-size:62.5%;-webkit-tap-highlight-color:rgba(0,0,0,0)}body{font-family:Georgia,"Times New Roman",Times,serif;font-size:15px;line-height:1.428571429;color:#323;background-color:#ffc}input,button,select,textarea{font-family:inherit;font-size:inherit;line-height:inherit}a{color:#e30842;text-decoration:none}a:hover,a:focus{color:#99052d;text-decoration:underline}a:focus{outline:thin dotted #333;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}img{vertical-align:middle}.img-responsive{display:block;height:auto;max-width:100%}.img-rounded{border-radius:8px}.img-thumbnail{display:inline-block;height:auto;max-width:100%;padding:4px;line-height:1.428571429;background-color:#ffc;border:1px solid #ddd;border-radius:6px;-webkit-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.img-circle{border-radius:50%}hr{margin-top:21px;margin-bottom:21px;border:0;border-top:1px solid #f6fada}.sr-only{position:absolute;width:1px;height:1px;padding:0;margin:-1px;overflow:hidden;clip:rect(0 0 0 0);border:0}p{margin:0 0 10.5px}.lead{margin-bottom:21px;font-size:17.25px;font-weight:200;line-height:1.4}@media(min-width:768px){.lead{font-size:22.5px}}small,.small{font-size:85%}cite{font-style:normal}.text-muted{color:#dabf9f}.text-primary{color:#e30842}.text-primary:hover{color:#b20634}.text-warning{color:#c09853}.text-warning:hover{color:#a47e3c}.text-danger{color:#b94a48}.text-danger:hover{color:#953b39}.text-success{color:#468847}.text-success:hover{color:#356635}.text-info{color:#3a87ad}.text-info:hover{color:#2d6987}.text-left{text-align:left}.text-right{text-align:right}.text-center{text-align:center}h1,h2,h3,h4,h5,h6,.h1,.h2,.h3,.h4,.h5,.h6{font-family:Georgia,"Times New Roman",Times,serif;font-weight:500;line-height:1.1;color:inherit}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small,.h1 small,.h2 small,.h3 small,.h4 small,.h5 small,.h6 small{font-weight:normal;line-height:1;color:#dabf9f}h1,h2,h3{margin-top:21px;margin-bottom:10.5px}h1 small,h2 small,h3 small{font-size:65%}h4,h5,h6{margin-top:10.5px;margin-bottom:10.5px}h4 small,h5 small,h6 small{font-size:75%}h1,.h1{font-size:39px}h2,.h2{font-size:32px}h3,.h3{font-size:26px}h4,.h4{font-size:19px}h5,.h5{font-size:15px}h6,.h6{font-size:13px}.page-header{padding-bottom:9.5px;margin:42px 0 21px;border-bottom:1px solid #fff}ul,ol{margin-top:0;margin-bottom:10.5px}ul ul,ol ul,ul ol,ol ol{margin-bottom:0}.list-unstyled{padding-left:0;list-style:none}.list-inline{padding-left:0;list-style:none}.list-inline>li{display:inline-block;padding-right:5px;padding-left:5px}dl{margin-bottom:21px}dt,dd{line-height:1.428571429}dt{font-weight:bold}dd{margin-left:0}@media(min-width:768px){.dl-horizontal dt{float:left;width:160px;overflow:hidden;clear:left;text-align:right;text-overflow:ellipsis;white-space:nowrap}.dl-horizontal dd{margin-left:180px}.dl-horizontal dd:before,.dl-horizontal dd:after{display:table;content:" "}.dl-horizontal dd:after{clear:both}.dl-horizontal dd:before,.dl-horizontal dd:after{display:table;content:" "}.dl-horizontal dd:after{clear:both}}abbr[title],abbr[data-original-title]{cursor:help;border-bottom:1px dotted #dabf9f}abbr.initialism{font-size:90%;text-transform:uppercase}blockquote{padding:10.5px 21px;margin:0 0 21px;border-left:5px solid #fff}blockquote p{font-size:18.75px;font-weight:300;line-height:1.25}blockquote p:last-child{margin-bottom:0}blockquote small{display:block;line-height:1.428571429;color:#dabf9f}blockquote small:before{content:'\2014 \00A0'}blockquote.pull-right{padding-right:15px;padding-left:0;border-right:5px solid #fff;border-left:0}blockquote.pull-right p,blockquote.pull-right small{text-align:right}blockquote.pull-right small:before{content:''}blockquote.pull-right small:after{content:'\00A0 \2014'}blockquote:before,blockquote:after{content:""}address{margin-bottom:21px;font-style:normal;line-height:1.428571429}code,kdb,pre,samp{font-family:Monaco,Menlo,Consolas,"Courier New",monospace}code{padding:2px 4px;font-size:90%;color:#c7254e;white-space:nowrap;background-color:#f9f2f4;border-radius:6px}pre{display:block;padding:10px;margin:0 0 10.5px;font-size:14px;line-height:1.428571429;color:#7c5a31;word-break:break-all;word-wrap:break-word;background-color:#f5f5f5;border:1px solid #ccc;border-radius:6px}pre code{padding:0;font-size:inherit;color:inherit;white-space:pre-wrap;background-color:transparent;border:0}.pre-scrollable{max-height:340px;overflow-y:scroll}.container{padding-right:15px;padding-left:15px;margin-right:auto;margin-left:auto}.container:before,.container:after{display:table;content:" "}.container:after{clear:both}.container:before,.container:after{display:table;content:" "}.container:after{clear:both}.row{margin-right:-15px;margin-left:-15px}.row:before,.row:after{display:table;content:" "}.row:after{clear:both}.row:before,.row:after{display:table;content:" "}.row:after{clear:both}.col-xs-1,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9,.col-xs-10,.col-xs-11,.col-xs-12,.col-sm-1,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9,.col-sm-10,.col-sm-11,.col-sm-12,.col-md-1,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9,.col-md-10,.col-md-11,.col-md-12,.col-lg-1,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9,.col-lg-10,.col-lg-11,.col-lg-12{position:relative;min-height:1px;padding-right:15px;padding-left:15px}.col-xs-1,.col-xs-2,.col-xs-3,.col-xs-4,.col-xs-5,.col-xs-6,.col-xs-7,.col-xs-8,.col-xs-9,.col-xs-10,.col-xs-11{float:left}.col-xs-1{width:8.333333333333332%}.col-xs-2{width:16.666666666666664%}.col-xs-3{width:25%}.col-xs-4{width:33.33333333333333%}.col-xs-5{width:41.66666666666667%}.col-xs-6{width:50%}.col-xs-7{width:58.333333333333336%}.col-xs-8{width:66.66666666666666%}.col-xs-9{width:75%}.col-xs-10{width:83.33333333333334%}.col-xs-11{width:91.66666666666666%}.col-xs-12{width:100%}@media(min-width:768px){.container{width:750px}.col-sm-1,.col-sm-2,.col-sm-3,.col-sm-4,.col-sm-5,.col-sm-6,.col-sm-7,.col-sm-8,.col-sm-9,.col-sm-10,.col-sm-11{float:left}.col-sm-1{width:8.333333333333332%}.col-sm-2{width:16.666666666666664%}.col-sm-3{width:25%}.col-sm-4{width:33.33333333333333%}.col-sm-5{width:41.66666666666667%}.col-sm-6{width:50%}.col-sm-7{width:58.333333333333336%}.col-sm-8{width:66.66666666666666%}.col-sm-9{width:75%}.col-sm-10{width:83.33333333333334%}.col-sm-11{width:91.66666666666666%}.col-sm-12{width:100%}.col-sm-push-1{left:8.333333333333332%}.col-sm-push-2{left:16.666666666666664%}.col-sm-push-3{left:25%}.col-sm-push-4{left:33.33333333333333%}.col-sm-push-5{left:41.66666666666667%}.col-sm-push-6{left:50%}.col-sm-push-7{left:58.333333333333336%}.col-sm-push-8{left:66.66666666666666%}.col-sm-push-9{left:75%}.col-sm-push-10{left:83.33333333333334%}.col-sm-push-11{left:91.66666666666666%}.col-sm-pull-1{right:8.333333333333332%}.col-sm-pull-2{right:16.666666666666664%}.col-sm-pull-3{right:25%}.col-sm-pull-4{right:33.33333333333333%}.col-sm-pull-5{right:41.66666666666667%}.col-sm-pull-6{right:50%}.col-sm-pull-7{right:58.333333333333336%}.col-sm-pull-8{right:66.66666666666666%}.col-sm-pull-9{right:75%}.col-sm-pull-10{right:83.33333333333334%}.col-sm-pull-11{right:91.66666666666666%}.col-sm-offset-1{margin-left:8.333333333333332%}.col-sm-offset-2{margin-left:16.666666666666664%}.col-sm-offset-3{margin-left:25%}.col-sm-offset-4{margin-left:33.33333333333333%}.col-sm-offset-5{margin-left:41.66666666666667%}.col-sm-offset-6{margin-left:50%}.col-sm-offset-7{margin-left:58.333333333333336%}.col-sm-offset-8{margin-left:66.66666666666666%}.col-sm-offset-9{margin-left:75%}.col-sm-offset-10{margin-left:83.33333333333334%}.col-sm-offset-11{margin-left:91.66666666666666%}}@media(min-width:992px){.container{width:970px}.col-md-1,.col-md-2,.col-md-3,.col-md-4,.col-md-5,.col-md-6,.col-md-7,.col-md-8,.col-md-9,.col-md-10,.col-md-11{float:left}.col-md-1{width:8.333333333333332%}.col-md-2{width:16.666666666666664%}.col-md-3{width:25%}.col-md-4{width:33.33333333333333%}.col-md-5{width:41.66666666666667%}.col-md-6{width:50%}.col-md-7{width:58.333333333333336%}.col-md-8{width:66.66666666666666%}.col-md-9{width:75%}.col-md-10{width:83.33333333333334%}.col-md-11{width:91.66666666666666%}.col-md-12{width:100%}.col-md-push-0{left:auto}.col-md-push-1{left:8.333333333333332%}.col-md-push-2{left:16.666666666666664%}.col-md-push-3{left:25%}.col-md-push-4{left:33.33333333333333%}.col-md-push-5{left:41.66666666666667%}.col-md-push-6{left:50%}.col-md-push-7{left:58.333333333333336%}.col-md-push-8{left:66.66666666666666%}.col-md-push-9{left:75%}.col-md-push-10{left:83.33333333333334%}.col-md-push-11{left:91.66666666666666%}.col-md-pull-0{right:auto}.col-md-pull-1{right:8.333333333333332%}.col-md-pull-2{right:16.666666666666664%}.col-md-pull-3{right:25%}.col-md-pull-4{right:33.33333333333333%}.col-md-pull-5{right:41.66666666666667%}.col-md-pull-6{right:50%}.col-md-pull-7{right:58.333333333333336%}.col-md-pull-8{right:66.66666666666666%}.col-md-pull-9{right:75%}.col-md-pull-10{right:83.33333333333334%}.col-md-pull-11{right:91.66666666666666%}.col-md-offset-0{margin-left:0}.col-md-offset-1{margin-left:8.333333333333332%}.col-md-offset-2{margin-left:16.666666666666664%}.col-md-offset-3{margin-left:25%}.col-md-offset-4{margin-left:33.33333333333333%}.col-md-offset-5{margin-left:41.66666666666667%}.col-md-offset-6{margin-left:50%}.col-md-offset-7{margin-left:58.333333333333336%}.col-md-offset-8{margin-left:66.66666666666666%}.col-md-offset-9{margin-left:75%}.col-md-offset-10{margin-left:83.33333333333334%}.col-md-offset-11{margin-left:91.66666666666666%}}@media(min-width:1200px){.container{width:1170px}.col-lg-1,.col-lg-2,.col-lg-3,.col-lg-4,.col-lg-5,.col-lg-6,.col-lg-7,.col-lg-8,.col-lg-9,.col-lg-10,.col-lg-11{float:left}.col-lg-1{width:8.333333333333332%}.col-lg-2{width:16.666666666666664%}.col-lg-3{width:25%}.col-lg-4{width:33.33333333333333%}.col-lg-5{width:41.66666666666667%}.col-lg-6{width:50%}.col-lg-7{width:58.333333333333336%}.col-lg-8{width:66.66666666666666%}.col-lg-9{width:75%}.col-lg-10{width:83.33333333333334%}.col-lg-11{width:91.66666666666666%}.col-lg-12{width:100%}.col-lg-push-0{left:auto}.col-lg-push-1{left:8.333333333333332%}.col-lg-push-2{left:16.666666666666664%}.col-lg-push-3{left:25%}.col-lg-push-4{left:33.33333333333333%}.col-lg-push-5{left:41.66666666666667%}.col-lg-push-6{left:50%}.col-lg-push-7{left:58.333333333333336%}.col-lg-push-8{left:66.66666666666666%}.col-lg-push-9{left:75%}.col-lg-push-10{left:83.33333333333334%}.col-lg-push-11{left:91.66666666666666%}.col-lg-pull-0{right:auto}.col-lg-pull-1{right:8.333333333333332%}.col-lg-pull-2{right:16.666666666666664%}.col-lg-pull-3{right:25%}.col-lg-pull-4{right:33.33333333333333%}.col-lg-pull-5{right:41.66666666666667%}.col-lg-pull-6{right:50%}.col-lg-pull-7{right:58.333333333333336%}.col-lg-pull-8{right:66.66666666666666%}.col-lg-pull-9{right:75%}.col-lg-pull-10{right:83.33333333333334%}.col-lg-pull-11{right:91.66666666666666%}.col-lg-offset-0{margin-left:0}.col-lg-offset-1{margin-left:8.333333333333332%}.col-lg-offset-2{margin-left:16.666666666666664%}.col-lg-offset-3{margin-left:25%}.col-lg-offset-4{margin-left:33.33333333333333%}.col-lg-offset-5{margin-left:41.66666666666667%}.col-lg-offset-6{margin-left:50%}.col-lg-offset-7{margin-left:58.333333333333336%}.col-lg-offset-8{margin-left:66.66666666666666%}.col-lg-offset-9{margin-left:75%}.col-lg-offset-10{margin-left:83.33333333333334%}.col-lg-offset-11{margin-left:91.66666666666666%}}table{max-width:100%;background-color:transparent}th{text-align:left}.table{width:100%;margin-bottom:21px}.table>thead>tr>th,.table>tbody>tr>th,.table>tfoot>tr>th,.table>thead>tr>td,.table>tbody>tr>td,.table>tfoot>tr>td{padding:8px;line-height:1.428571429;vertical-align:top;border-top:1px solid #fff}.table>thead>tr>th{vertical-align:bottom;border-bottom:2px solid #fff}.table>caption+thead>tr:first-child>th,.table>colgroup+thead>tr:first-child>th,.table>thead:first-child>tr:first-child>th,.table>caption+thead>tr:first-child>td,.table>colgroup+thead>tr:first-child>td,.table>thead:first-child>tr:first-child>td{border-top:0}.table>tbody+tbody{border-top:2px solid #fff}.table .table{background-color:#ffc}.table-condensed>thead>tr>th,.table-condensed>tbody>tr>th,.table-condensed>tfoot>tr>th,.table-condensed>thead>tr>td,.table-condensed>tbody>tr>td,.table-condensed>tfoot>tr>td{padding:5px}.table-bordered{border:1px solid #fff}.table-bordered>thead>tr>th,.table-bordered>tbody>tr>th,.table-bordered>tfoot>tr>th,.table-bordered>thead>tr>td,.table-bordered>tbody>tr>td,.table-bordered>tfoot>tr>td{border:1px solid #fff}.table-bordered>thead>tr>th,.table-bordered>thead>tr>td{border-bottom-width:2px}.table-striped>tbody>tr:nth-child(odd)>td,.table-striped>tbody>tr:nth-child(odd)>th{background-color:rgba(249,249,249,0.5)}.table-hover>tbody>tr:hover>td,.table-hover>tbody>tr:hover>th{background-color:rgba(255,255,255,0.8)}table col[class*="col-"]{display:table-column;float:none}table td[class*="col-"],table th[class*="col-"]{display:table-cell;float:none}.table>thead>tr>td.active,.table>tbody>tr>td.active,.table>tfoot>tr>td.active,.table>thead>tr>th.active,.table>tbody>tr>th.active,.table>tfoot>tr>th.active,.table>thead>tr.active>td,.table>tbody>tr.active>td,.table>tfoot>tr.active>td,.table>thead>tr.active>th,.table>tbody>tr.active>th,.table>tfoot>tr.active>th{background-color:rgba(255,255,255,0.8)}.table>thead>tr>td.success,.table>tbody>tr>td.success,.table>tfoot>tr>td.success,.table>thead>tr>th.success,.table>tbody>tr>th.success,.table>tfoot>tr>th.success,.table>thead>tr.success>td,.table>tbody>tr.success>td,.table>tfoot>tr.success>td,.table>thead>tr.success>th,.table>tbody>tr.success>th,.table>tfoot>tr.success>th{background-color:#dff0d8;border-color:#d6e9c6}.table-hover>tbody>tr>td.success:hover,.table-hover>tbody>tr>th.success:hover,.table-hover>tbody>tr.success:hover>td,.table-hover>tbody>tr.success:hover>th{background-color:#d0e9c6;border-color:#c9e2b3}.table>thead>tr>td.danger,.table>tbody>tr>td.danger,.table>tfoot>tr>td.danger,.table>thead>tr>th.danger,.table>tbody>tr>th.danger,.table>tfoot>tr>th.danger,.table>thead>tr.danger>td,.table>tbody>tr.danger>td,.table>tfoot>tr.danger>td,.table>thead>tr.danger>th,.table>tbody>tr.danger>th,.table>tfoot>tr.danger>th{background-color:#f2dede;border-color:#ebccd1}.table-hover>tbody>tr>td.danger:hover,.table-hover>tbody>tr>th.danger:hover,.table-hover>tbody>tr.danger:hover>td,.table-hover>tbody>tr.danger:hover>th{background-color:#ebcccc;border-color:#e4b9c0}.table>thead>tr>td.warning,.table>tbody>tr>td.warning,.table>tfoot>tr>td.warning,.table>thead>tr>th.warning,.table>tbody>tr>th.warning,.table>tfoot>tr>th.warning,.table>thead>tr.warning>td,.table>tbody>tr.warning>td,.table>tfoot>tr.warning>td,.table>thead>tr.warning>th,.table>tbody>tr.warning>th,.table>tfoot>tr.warning>th{background-color:#fcf8e3;border-color:#faebcc}.table-hover>tbody>tr>td.warning:hover,.table-hover>tbody>tr>th.warning:hover,.table-hover>tbody>tr.warning:hover>td,.table-hover>tbody>tr.warning:hover>th{background-color:#faf2cc;border-color:#f7e1b5}@media(max-width:768px){.table-responsive{width:100%;margin-bottom:15px;overflow-x:scroll;overflow-y:hidden;border:1px solid #fff;-ms-overflow-style:-ms-autohiding-scrollbar;-webkit-overflow-scrolling:touch}.table-responsive>.table{margin-bottom:0}.table-responsive>.table>thead>tr>th,.table-responsive>.table>tbody>tr>th,.table-responsive>.table>tfoot>tr>th,.table-responsive>.table>thead>tr>td,.table-responsive>.table>tbody>tr>td,.table-responsive>.table>tfoot>tr>td{white-space:nowrap}.table-responsive>.table-bordered{border:0}.table-responsive>.table-bordered>thead>tr>th:first-child,.table-responsive>.table-bordered>tbody>tr>th:first-child,.table-responsive>.table-bordered>tfoot>tr>th:first-child,.table-responsive>.table-bordered>thead>tr>td:first-child,.table-responsive>.table-bordered>tbody>tr>td:first-child,.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.table-responsive>.table-bordered>thead>tr>th:last-child,.table-responsive>.table-bordered>tbody>tr>th:last-child,.table-responsive>.table-bordered>tfoot>tr>th:last-child,.table-responsive>.table-bordered>thead>tr>td:last-child,.table-responsive>.table-bordered>tbody>tr>td:last-child,.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.table-responsive>.table-bordered>tbody>tr:last-child>th,.table-responsive>.table-bordered>tfoot>tr:last-child>th,.table-responsive>.table-bordered>tbody>tr:last-child>td,.table-responsive>.table-bordered>tfoot>tr:last-child>td{border-bottom:0}}fieldset{padding:0;margin:0;border:0}legend{display:block;width:100%;padding:0;margin-bottom:21px;font-size:22.5px;line-height:inherit;color:#7c5a31;border:0;border-bottom:1px solid #e5e5e5}label{display:inline-block;margin-bottom:5px;font-weight:bold}input[type="search"]{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box}input[type="radio"],input[type="checkbox"]{margin:4px 0 0;margin-top:1px \9;line-height:normal}input[type="file"]{display:block}select[multiple],select[size]{height:auto}select optgroup{font-family:inherit;font-size:inherit;font-style:inherit}input[type="file"]:focus,input[type="radio"]:focus,input[type="checkbox"]:focus{outline:thin dotted #333;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}input[type="number"]::-webkit-outer-spin-button,input[type="number"]::-webkit-inner-spin-button{height:auto}output{display:block;padding-top:7px;font-size:15px;line-height:1.428571429;color:#ae7e44;vertical-align:middle}.form-control:-moz-placeholder{color:#dabf9f}.form-control::-moz-placeholder{color:#dabf9f}.form-control:-ms-input-placeholder{color:#dabf9f}.form-control::-webkit-input-placeholder{color:#dabf9f}.form-control{display:block;width:100%;height:35px;padding:6px 12px;font-size:15px;line-height:1.428571429;color:#ae7e44;vertical-align:middle;background-color:rgba(255,255,255,0.95);background-image:none;border:1px solid #ffc37a;border-radius:6px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075);box-shadow:inset 0 1px 1px rgba(0,0,0,0.075);-webkit-transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s;transition:border-color ease-in-out .15s,box-shadow ease-in-out .15s}.form-control:focus{border-color:#66afe9;outline:0;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 8px rgba(102,175,233,0.6);box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 8px rgba(102,175,233,0.6)}.form-control[disabled],.form-control[readonly],fieldset[disabled] .form-control{cursor:not-allowed;background-color:#fff}textarea.form-control{height:auto}.form-group{margin-bottom:15px}.radio,.checkbox{display:block;min-height:21px;padding-left:20px;margin-top:10px;margin-bottom:10px;vertical-align:middle}.radio label,.checkbox label{display:inline;margin-bottom:0;font-weight:normal;cursor:pointer}.radio input[type="radio"],.radio-inline input[type="radio"],.checkbox input[type="checkbox"],.checkbox-inline input[type="checkbox"]{float:left;margin-left:-20px}.radio+.radio,.checkbox+.checkbox{margin-top:-5px}.radio-inline,.checkbox-inline{display:inline-block;padding-left:20px;margin-bottom:0;font-weight:normal;vertical-align:middle;cursor:pointer}.radio-inline+.radio-inline,.checkbox-inline+.checkbox-inline{margin-top:0;margin-left:10px}input[type="radio"][disabled],input[type="checkbox"][disabled],.radio[disabled],.radio-inline[disabled],.checkbox[disabled],.checkbox-inline[disabled],fieldset[disabled] input[type="radio"],fieldset[disabled] input[type="checkbox"],fieldset[disabled] .radio,fieldset[disabled] .radio-inline,fieldset[disabled] .checkbox,fieldset[disabled] .checkbox-inline{cursor:not-allowed}.input-sm{height:31px;padding:5px 10px;font-size:13px;line-height:1.5;border-radius:4px}select.input-sm{height:31px;line-height:31px}textarea.input-sm{height:auto}.input-lg{height:47px;padding:10px 16px;font-size:19px;line-height:1.33;border-radius:8px}select.input-lg{height:47px;line-height:47px}textarea.input-lg{height:auto}.has-warning .help-block,.has-warning .control-label{color:#c09853}.has-warning .form-control{border-color:#c09853;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075);box-shadow:inset 0 1px 1px rgba(0,0,0,0.075)}.has-warning .form-control:focus{border-color:#a47e3c;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #dbc59e;box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #dbc59e}.has-warning .input-group-addon{color:#c09853;background-color:#fcf8e3;border-color:#c09853}.has-error .help-block,.has-error .control-label{color:#b94a48}.has-error .form-control{border-color:#b94a48;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075);box-shadow:inset 0 1px 1px rgba(0,0,0,0.075)}.has-error .form-control:focus{border-color:#953b39;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #d59392;box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #d59392}.has-error .input-group-addon{color:#b94a48;background-color:#f2dede;border-color:#b94a48}.has-success .help-block,.has-success .control-label{color:#468847}.has-success .form-control{border-color:#468847;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075);box-shadow:inset 0 1px 1px rgba(0,0,0,0.075)}.has-success .form-control:focus{border-color:#356635;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #7aba7b;box-shadow:inset 0 1px 1px rgba(0,0,0,0.075),0 0 6px #7aba7b}.has-success .input-group-addon{color:#468847;background-color:#dff0d8;border-color:#468847}.form-control-static{padding-top:7px;margin-bottom:0}.help-block{display:block;margin-top:5px;margin-bottom:10px;color:#805580}@media(min-width:768px){.form-inline .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.form-inline .form-control{display:inline-block}.form-inline .radio,.form-inline .checkbox{display:inline-block;padding-left:0;margin-top:0;margin-bottom:0}.form-inline .radio input[type="radio"],.form-inline .checkbox input[type="checkbox"]{float:none;margin-left:0}}.form-horizontal .control-label,.form-horizontal .radio,.form-horizontal .checkbox,.form-horizontal .radio-inline,.form-horizontal .checkbox-inline{padding-top:7px;margin-top:0;margin-bottom:0}.form-horizontal .form-group{margin-right:-15px;margin-left:-15px}.form-horizontal .form-group:before,.form-horizontal .form-group:after{display:table;content:" "}.form-horizontal .form-group:after{clear:both}.form-horizontal .form-group:before,.form-horizontal .form-group:after{display:table;content:" "}.form-horizontal .form-group:after{clear:both}@media(min-width:768px){.form-horizontal .control-label{text-align:right}}.btn{display:inline-block;padding:6px 12px;margin-bottom:0;font-size:15px;font-weight:normal;line-height:1.428571429;text-align:center;white-space:nowrap;vertical-align:middle;cursor:pointer;background-image:none;border:1px solid transparent;border-radius:6px;-webkit-user-select:none;-moz-user-select:none;-ms-user-select:none;-o-user-select:none;user-select:none}.btn:focus{outline:thin dotted #333;outline:5px auto -webkit-focus-ring-color;outline-offset:-2px}.btn:hover,.btn:focus{color:#333;text-decoration:none}.btn:active,.btn.active{background-image:none;outline:0;-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,0.125);box-shadow:inset 0 3px 5px rgba(0,0,0,0.125)}.btn.disabled,.btn[disabled],fieldset[disabled] .btn{pointer-events:none;cursor:not-allowed;opacity:.65;filter:alpha(opacity=65);-webkit-box-shadow:none;box-shadow:none}.btn-default{color:#333;background-color:#fff;border-color:#ccc}.btn-default:hover,.btn-default:focus,.btn-default:active,.btn-default.active,.open .dropdown-toggle.btn-default{color:#333;background-color:#ebebeb;border-color:#adadad}.btn-default:active,.btn-default.active,.open .dropdown-toggle.btn-default{background-image:none}.btn-default.disabled,.btn-default[disabled],fieldset[disabled] .btn-default,.btn-default.disabled:hover,.btn-default[disabled]:hover,fieldset[disabled] .btn-default:hover,.btn-default.disabled:focus,.btn-default[disabled]:focus,fieldset[disabled] .btn-default:focus,.btn-default.disabled:active,.btn-default[disabled]:active,fieldset[disabled] .btn-default:active,.btn-default.disabled.active,.btn-default[disabled].active,fieldset[disabled] .btn-default.active{background-color:#fff;border-color:#ccc}.btn-primary{color:#fff;background-color:#e30842;border-color:#ca073b}.btn-primary:hover,.btn-primary:focus,.btn-primary:active,.btn-primary.active,.open .dropdown-toggle.btn-primary{color:#fff;background-color:#bc0737;border-color:#8f052a}.btn-primary:active,.btn-primary.active,.open .dropdown-toggle.btn-primary{background-image:none}.btn-primary.disabled,.btn-primary[disabled],fieldset[disabled] .btn-primary,.btn-primary.disabled:hover,.btn-primary[disabled]:hover,fieldset[disabled] .btn-primary:hover,.btn-primary.disabled:focus,.btn-primary[disabled]:focus,fieldset[disabled] .btn-primary:focus,.btn-primary.disabled:active,.btn-primary[disabled]:active,fieldset[disabled] .btn-primary:active,.btn-primary.disabled.active,.btn-primary[disabled].active,fieldset[disabled] .btn-primary.active{background-color:#e30842;border-color:#ca073b}.btn-warning{color:#fff;background-color:#f0ad4e;border-color:#eea236}.btn-warning:hover,.btn-warning:focus,.btn-warning:active,.btn-warning.active,.open .dropdown-toggle.btn-warning{color:#fff;background-color:#ed9c28;border-color:#d58512}.btn-warning:active,.btn-warning.active,.open .dropdown-toggle.btn-warning{background-image:none}.btn-warning.disabled,.btn-warning[disabled],fieldset[disabled] .btn-warning,.btn-warning.disabled:hover,.btn-warning[disabled]:hover,fieldset[disabled] .btn-warning:hover,.btn-warning.disabled:focus,.btn-warning[disabled]:focus,fieldset[disabled] .btn-warning:focus,.btn-warning.disabled:active,.btn-warning[disabled]:active,fieldset[disabled] .btn-warning:active,.btn-warning.disabled.active,.btn-warning[disabled].active,fieldset[disabled] .btn-warning.active{background-color:#f0ad4e;border-color:#eea236}.btn-danger{color:#fff;background-color:#d9534f;border-color:#d43f3a}.btn-danger:hover,.btn-danger:focus,.btn-danger:active,.btn-danger.active,.open .dropdown-toggle.btn-danger{color:#fff;background-color:#d2322d;border-color:#ac2925}.btn-danger:active,.btn-danger.active,.open .dropdown-toggle.btn-danger{background-image:none}.btn-danger.disabled,.btn-danger[disabled],fieldset[disabled] .btn-danger,.btn-danger.disabled:hover,.btn-danger[disabled]:hover,fieldset[disabled] .btn-danger:hover,.btn-danger.disabled:focus,.btn-danger[disabled]:focus,fieldset[disabled] .btn-danger:focus,.btn-danger.disabled:active,.btn-danger[disabled]:active,fieldset[disabled] .btn-danger:active,.btn-danger.disabled.active,.btn-danger[disabled].active,fieldset[disabled] .btn-danger.active{background-color:#d9534f;border-color:#d43f3a}.btn-success{color:#fff;background-color:#5cb85c;border-color:#4cae4c}.btn-success:hover,.btn-success:focus,.btn-success:active,.btn-success.active,.open .dropdown-toggle.btn-success{color:#fff;background-color:#47a447;border-color:#398439}.btn-success:active,.btn-success.active,.open .dropdown-toggle.btn-success{background-image:none}.btn-success.disabled,.btn-success[disabled],fieldset[disabled] .btn-success,.btn-success.disabled:hover,.btn-success[disabled]:hover,fieldset[disabled] .btn-success:hover,.btn-success.disabled:focus,.btn-success[disabled]:focus,fieldset[disabled] .btn-success:focus,.btn-success.disabled:active,.btn-success[disabled]:active,fieldset[disabled] .btn-success:active,.btn-success.disabled.active,.btn-success[disabled].active,fieldset[disabled] .btn-success.active{background-color:#5cb85c;border-color:#4cae4c}.btn-info{color:#fff;background-color:#5bc0de;border-color:#46b8da}.btn-info:hover,.btn-info:focus,.btn-info:active,.btn-info.active,.open .dropdown-toggle.btn-info{color:#fff;background-color:#39b3d7;border-color:#269abc}.btn-info:active,.btn-info.active,.open .dropdown-toggle.btn-info{background-image:none}.btn-info.disabled,.btn-info[disabled],fieldset[disabled] .btn-info,.btn-info.disabled:hover,.btn-info[disabled]:hover,fieldset[disabled] .btn-info:hover,.btn-info.disabled:focus,.btn-info[disabled]:focus,fieldset[disabled] .btn-info:focus,.btn-info.disabled:active,.btn-info[disabled]:active,fieldset[disabled] .btn-info:active,.btn-info.disabled.active,.btn-info[disabled].active,fieldset[disabled] .btn-info.active{background-color:#5bc0de;border-color:#46b8da}.btn-link{font-weight:normal;color:#e30842;cursor:pointer;border-radius:0}.btn-link,.btn-link:active,.btn-link[disabled],fieldset[disabled] .btn-link{background-color:transparent;-webkit-box-shadow:none;box-shadow:none}.btn-link,.btn-link:hover,.btn-link:focus,.btn-link:active{border-color:transparent}.btn-link:hover,.btn-link:focus{color:#99052d;text-decoration:underline;background-color:transparent}.btn-link[disabled]:hover,fieldset[disabled] .btn-link:hover,.btn-link[disabled]:focus,fieldset[disabled] .btn-link:focus{color:#dabf9f;text-decoration:none}.btn-lg{padding:10px 16px;font-size:19px;line-height:1.33;border-radius:8px}.btn-sm,.btn-xs{padding:5px 10px;font-size:13px;line-height:1.5;border-radius:4px}.btn-xs{padding:1px 5px}.btn-block{display:block;width:100%;padding-right:0;padding-left:0}.btn-block+.btn-block{margin-top:5px}input[type="submit"].btn-block,input[type="reset"].btn-block,input[type="button"].btn-block{width:100%}.fade{opacity:0;-webkit-transition:opacity .15s linear;transition:opacity .15s linear}.fade.in{opacity:1}.collapse{display:none}.collapse.in{display:block}.collapsing{position:relative;height:0;overflow:hidden;-webkit-transition:height .35s ease;transition:height .35s ease}@font-face{font-family:'Glyphicons Halflings';src:url('../fonts/glyphicons-halflings-regular.eot');src:url('../fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'),url('../fonts/glyphicons-halflings-regular.woff') format('woff'),url('../fonts/glyphicons-halflings-regular.ttf') format('truetype'),url('../fonts/glyphicons-halflings-regular.svg#glyphicons-halflingsregular') format('svg')}.glyphicon{position:relative;top:1px;display:inline-block;font-family:'Glyphicons Halflings';-webkit-font-smoothing:antialiased;font-style:normal;font-weight:normal;line-height:1}.glyphicon:empty{width:1em}.glyphicon-asterisk:before{content:"\2a"}.glyphicon-plus:before{content:"\2b"}.glyphicon-euro:before{content:"\20ac"}.glyphicon-minus:before{content:"\2212"}.glyphicon-cloud:before{content:"\2601"}.glyphicon-envelope:before{content:"\2709"}.glyphicon-pencil:before{content:"\270f"}.glyphicon-glass:before{content:"\e001"}.glyphicon-music:before{content:"\e002"}.glyphicon-search:before{content:"\e003"}.glyphicon-heart:before{content:"\e005"}.glyphicon-star:before{content:"\e006"}.glyphicon-star-empty:before{content:"\e007"}.glyphicon-user:before{content:"\e008"}.glyphicon-film:before{content:"\e009"}.glyphicon-th-large:before{content:"\e010"}.glyphicon-th:before{content:"\e011"}.glyphicon-th-list:before{content:"\e012"}.glyphicon-ok:before{content:"\e013"}.glyphicon-remove:before{content:"\e014"}.glyphicon-zoom-in:before{content:"\e015"}.glyphicon-zoom-out:before{content:"\e016"}.glyphicon-off:before{content:"\e017"}.glyphicon-signal:before{content:"\e018"}.glyphicon-cog:before{content:"\e019"}.glyphicon-trash:before{content:"\e020"}.glyphicon-home:before{content:"\e021"}.glyphicon-file:before{content:"\e022"}.glyphicon-time:before{content:"\e023"}.glyphicon-road:before{content:"\e024"}.glyphicon-download-alt:before{content:"\e025"}.glyphicon-download:before{content:"\e026"}.glyphicon-upload:before{content:"\e027"}.glyphicon-inbox:before{content:"\e028"}.glyphicon-play-circle:before{content:"\e029"}.glyphicon-repeat:before{content:"\e030"}.glyphicon-refresh:before{content:"\e031"}.glyphicon-list-alt:before{content:"\e032"}.glyphicon-lock:before{content:"\e033"}.glyphicon-flag:before{content:"\e034"}.glyphicon-headphones:before{content:"\e035"}.glyphicon-volume-off:before{content:"\e036"}.glyphicon-volume-down:before{content:"\e037"}.glyphicon-volume-up:before{content:"\e038"}.glyphicon-qrcode:before{content:"\e039"}.glyphicon-barcode:before{content:"\e040"}.glyphicon-tag:before{content:"\e041"}.glyphicon-tags:before{content:"\e042"}.glyphicon-book:before{content:"\e043"}.glyphicon-bookmark:before{content:"\e044"}.glyphicon-print:before{content:"\e045"}.glyphicon-camera:before{content:"\e046"}.glyphicon-font:before{content:"\e047"}.glyphicon-bold:before{content:"\e048"}.glyphicon-italic:before{content:"\e049"}.glyphicon-text-height:before{content:"\e050"}.glyphicon-text-width:before{content:"\e051"}.glyphicon-align-left:before{content:"\e052"}.glyphicon-align-center:before{content:"\e053"}.glyphicon-align-right:before{content:"\e054"}.glyphicon-align-justify:before{content:"\e055"}.glyphicon-list:before{content:"\e056"}.glyphicon-indent-left:before{content:"\e057"}.glyphicon-indent-right:before{content:"\e058"}.glyphicon-facetime-video:before{content:"\e059"}.glyphicon-picture:before{content:"\e060"}.glyphicon-map-marker:before{content:"\e062"}.glyphicon-adjust:before{content:"\e063"}.glyphicon-tint:before{content:"\e064"}.glyphicon-edit:before{content:"\e065"}.glyphicon-share:before{content:"\e066"}.glyphicon-check:before{content:"\e067"}.glyphicon-move:before{content:"\e068"}.glyphicon-step-backward:before{content:"\e069"}.glyphicon-fast-backward:before{content:"\e070"}.glyphicon-backward:before{content:"\e071"}.glyphicon-play:before{content:"\e072"}.glyphicon-pause:before{content:"\e073"}.glyphicon-stop:before{content:"\e074"}.glyphicon-forward:before{content:"\e075"}.glyphicon-fast-forward:before{content:"\e076"}.glyphicon-step-forward:before{content:"\e077"}.glyphicon-eject:before{content:"\e078"}.glyphicon-chevron-left:before{content:"\e079"}.glyphicon-chevron-right:before{content:"\e080"}.glyphicon-plus-sign:before{content:"\e081"}.glyphicon-minus-sign:before{content:"\e082"}.glyphicon-remove-sign:before{content:"\e083"}.glyphicon-ok-sign:before{content:"\e084"}.glyphicon-question-sign:before{content:"\e085"}.glyphicon-info-sign:before{content:"\e086"}.glyphicon-screenshot:before{content:"\e087"}.glyphicon-remove-circle:before{content:"\e088"}.glyphicon-ok-circle:before{content:"\e089"}.glyphicon-ban-circle:before{content:"\e090"}.glyphicon-arrow-left:before{content:"\e091"}.glyphicon-arrow-right:before{content:"\e092"}.glyphicon-arrow-up:before{content:"\e093"}.glyphicon-arrow-down:before{content:"\e094"}.glyphicon-share-alt:before{content:"\e095"}.glyphicon-resize-full:before{content:"\e096"}.glyphicon-resize-small:before{content:"\e097"}.glyphicon-exclamation-sign:before{content:"\e101"}.glyphicon-gift:before{content:"\e102"}.glyphicon-leaf:before{content:"\e103"}.glyphicon-fire:before{content:"\e104"}.glyphicon-eye-open:before{content:"\e105"}.glyphicon-eye-close:before{content:"\e106"}.glyphicon-warning-sign:before{content:"\e107"}.glyphicon-plane:before{content:"\e108"}.glyphicon-calendar:before{content:"\e109"}.glyphicon-random:before{content:"\e110"}.glyphicon-comment:before{content:"\e111"}.glyphicon-magnet:before{content:"\e112"}.glyphicon-chevron-up:before{content:"\e113"}.glyphicon-chevron-down:before{content:"\e114"}.glyphicon-retweet:before{content:"\e115"}.glyphicon-shopping-cart:before{content:"\e116"}.glyphicon-folder-close:before{content:"\e117"}.glyphicon-folder-open:before{content:"\e118"}.glyphicon-resize-vertical:before{content:"\e119"}.glyphicon-resize-horizontal:before{content:"\e120"}.glyphicon-hdd:before{content:"\e121"}.glyphicon-bullhorn:before{content:"\e122"}.glyphicon-bell:before{content:"\e123"}.glyphicon-certificate:before{content:"\e124"}.glyphicon-thumbs-up:before{content:"\e125"}.glyphicon-thumbs-down:before{content:"\e126"}.glyphicon-hand-right:before{content:"\e127"}.glyphicon-hand-left:before{content:"\e128"}.glyphicon-hand-up:before{content:"\e129"}.glyphicon-hand-down:before{content:"\e130"}.glyphicon-circle-arrow-right:before{content:"\e131"}.glyphicon-circle-arrow-left:before{content:"\e132"}.glyphicon-circle-arrow-up:before{content:"\e133"}.glyphicon-circle-arrow-down:before{content:"\e134"}.glyphicon-globe:before{content:"\e135"}.glyphicon-wrench:before{content:"\e136"}.glyphicon-tasks:before{content:"\e137"}.glyphicon-filter:before{content:"\e138"}.glyphicon-briefcase:before{content:"\e139"}.glyphicon-fullscreen:before{content:"\e140"}.glyphicon-dashboard:before{content:"\e141"}.glyphicon-paperclip:before{content:"\e142"}.glyphicon-heart-empty:before{content:"\e143"}.glyphicon-link:before{content:"\e144"}.glyphicon-phone:before{content:"\e145"}.glyphicon-pushpin:before{content:"\e146"}.glyphicon-usd:before{content:"\e148"}.glyphicon-gbp:before{content:"\e149"}.glyphicon-sort:before{content:"\e150"}.glyphicon-sort-by-alphabet:before{content:"\e151"}.glyphicon-sort-by-alphabet-alt:before{content:"\e152"}.glyphicon-sort-by-order:before{content:"\e153"}.glyphicon-sort-by-order-alt:before{content:"\e154"}.glyphicon-sort-by-attributes:before{content:"\e155"}.glyphicon-sort-by-attributes-alt:before{content:"\e156"}.glyphicon-unchecked:before{content:"\e157"}.glyphicon-expand:before{content:"\e158"}.glyphicon-collapse-down:before{content:"\e159"}.glyphicon-collapse-up:before{content:"\e160"}.glyphicon-log-in:before{content:"\e161"}.glyphicon-flash:before{content:"\e162"}.glyphicon-log-out:before{content:"\e163"}.glyphicon-new-window:before{content:"\e164"}.glyphicon-record:before{content:"\e165"}.glyphicon-save:before{content:"\e166"}.glyphicon-open:before{content:"\e167"}.glyphicon-saved:before{content:"\e168"}.glyphicon-import:before{content:"\e169"}.glyphicon-export:before{content:"\e170"}.glyphicon-send:before{content:"\e171"}.glyphicon-floppy-disk:before{content:"\e172"}.glyphicon-floppy-saved:before{content:"\e173"}.glyphicon-floppy-remove:before{content:"\e174"}.glyphicon-floppy-save:before{content:"\e175"}.glyphicon-floppy-open:before{content:"\e176"}.glyphicon-credit-card:before{content:"\e177"}.glyphicon-transfer:before{content:"\e178"}.glyphicon-cutlery:before{content:"\e179"}.glyphicon-header:before{content:"\e180"}.glyphicon-compressed:before{content:"\e181"}.glyphicon-earphone:before{content:"\e182"}.glyphicon-phone-alt:before{content:"\e183"}.glyphicon-tower:before{content:"\e184"}.glyphicon-stats:before{content:"\e185"}.glyphicon-sd-video:before{content:"\e186"}.glyphicon-hd-video:before{content:"\e187"}.glyphicon-subtitles:before{content:"\e188"}.glyphicon-sound-stereo:before{content:"\e189"}.glyphicon-sound-dolby:before{content:"\e190"}.glyphicon-sound-5-1:before{content:"\e191"}.glyphicon-sound-6-1:before{content:"\e192"}.glyphicon-sound-7-1:before{content:"\e193"}.glyphicon-copyright-mark:before{content:"\e194"}.glyphicon-registration-mark:before{content:"\e195"}.glyphicon-cloud-download:before{content:"\e197"}.glyphicon-cloud-upload:before{content:"\e198"}.glyphicon-tree-conifer:before{content:"\e199"}.glyphicon-tree-deciduous:before{content:"\e200"}.caret{display:inline-block;width:0;height:0;margin-left:2px;vertical-align:middle;border-top:4px solid #000;border-right:4px solid transparent;border-bottom:0 dotted;border-left:4px solid transparent}.dropdown{position:relative}.dropdown-toggle:focus{outline:0}.dropdown-menu{position:absolute;top:100%;left:0;z-index:1000;display:none;float:left;min-width:160px;padding:5px 0;margin:2px 0 0;font-size:15px;list-style:none;background-color:#682727;border:1px solid #ccc;border:1px solid rgba(0,0,0,0.15);border-radius:6px;-webkit-box-shadow:0 6px 12px rgba(0,0,0,0.175);box-shadow:0 6px 12px rgba(0,0,0,0.175);background-clip:padding-box}.dropdown-menu.pull-right{right:0;left:auto}.dropdown-menu .divider{height:1px;margin:9.5px 0;overflow:hidden;background-color:#e5e5e5}.dropdown-menu>li>a{display:block;padding:3px 20px;clear:both;font-weight:normal;line-height:1.428571429;color:#e6e6e6;white-space:nowrap}.dropdown-menu>li>a:hover,.dropdown-menu>li>a:focus{color:#6a4d2a;text-decoration:none;background-color:#f5efdf}.dropdown-menu>.active>a,.dropdown-menu>.active>a:hover,.dropdown-menu>.active>a:focus{color:#fff;text-decoration:none;background-color:#e30842;outline:0}.dropdown-menu>.disabled>a,.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{color:#dabf9f}.dropdown-menu>.disabled>a:hover,.dropdown-menu>.disabled>a:focus{text-decoration:none;cursor:not-allowed;background-color:transparent;background-image:none;filter:progid:DXImageTransform.Microsoft.gradient(enabled=false)}.open>.dropdown-menu{display:block}.open>a{outline:0}.dropdown-header{display:block;padding:3px 20px;font-size:13px;line-height:1.428571429;color:#dabf9f}.dropdown-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:990}.pull-right>.dropdown-menu{right:0;left:auto}.dropup .caret,.navbar-fixed-bottom .dropdown .caret{border-top:0 dotted;border-bottom:4px solid #000;content:""}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu{top:auto;bottom:100%;margin-bottom:1px}@media(min-width:768px){.navbar-right .dropdown-menu{right:0;left:auto}}.btn-default .caret{border-top-color:#333}.btn-primary .caret,.btn-success .caret,.btn-warning .caret,.btn-danger .caret,.btn-info .caret{border-top-color:#fff}.dropup .btn-default .caret{border-bottom-color:#333}.dropup .btn-primary .caret,.dropup .btn-success .caret,.dropup .btn-warning .caret,.dropup .btn-danger .caret,.dropup .btn-info .caret{border-bottom-color:#fff}.btn-group,.btn-group-vertical{position:relative;display:inline-block;vertical-align:middle}.btn-group>.btn,.btn-group-vertical>.btn{position:relative;float:left}.btn-group>.btn:hover,.btn-group-vertical>.btn:hover,.btn-group>.btn:focus,.btn-group-vertical>.btn:focus,.btn-group>.btn:active,.btn-group-vertical>.btn:active,.btn-group>.btn.active,.btn-group-vertical>.btn.active{z-index:2}.btn-group>.btn:focus,.btn-group-vertical>.btn:focus{outline:0}.btn-group .btn+.btn,.btn-group .btn+.btn-group,.btn-group .btn-group+.btn,.btn-group .btn-group+.btn-group{margin-left:-1px}.btn-toolbar:before,.btn-toolbar:after{display:table;content:" "}.btn-toolbar:after{clear:both}.btn-toolbar:before,.btn-toolbar:after{display:table;content:" "}.btn-toolbar:after{clear:both}.btn-toolbar .btn-group{float:left}.btn-toolbar>.btn+.btn,.btn-toolbar>.btn-group+.btn,.btn-toolbar>.btn+.btn-group,.btn-toolbar>.btn-group+.btn-group{margin-left:5px}.btn-group>.btn:not(:first-child):not(:last-child):not(.dropdown-toggle){border-radius:0}.btn-group>.btn:first-child{margin-left:0}.btn-group>.btn:first-child:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn:last-child:not(:first-child),.btn-group>.dropdown-toggle:not(:first-child){border-bottom-left-radius:0;border-top-left-radius:0}.btn-group>.btn-group{float:left}.btn-group>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group>.btn-group:first-child>.btn:last-child,.btn-group>.btn-group:first-child>.dropdown-toggle{border-top-right-radius:0;border-bottom-right-radius:0}.btn-group>.btn-group:last-child>.btn:first-child{border-bottom-left-radius:0;border-top-left-radius:0}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle{outline:0}.btn-group-xs>.btn{padding:5px 10px;padding:1px 5px;font-size:13px;line-height:1.5;border-radius:4px}.btn-group-sm>.btn{padding:5px 10px;font-size:13px;line-height:1.5;border-radius:4px}.btn-group-lg>.btn{padding:10px 16px;font-size:19px;line-height:1.33;border-radius:8px}.btn-group>.btn+.dropdown-toggle{padding-right:8px;padding-left:8px}.btn-group>.btn-lg+.dropdown-toggle{padding-right:12px;padding-left:12px}.btn-group.open .dropdown-toggle{-webkit-box-shadow:inset 0 3px 5px rgba(0,0,0,0.125);box-shadow:inset 0 3px 5px rgba(0,0,0,0.125)}.btn .caret{margin-left:0}.btn-lg .caret{border-width:5px 5px 0;border-bottom-width:0}.dropup .btn-lg .caret{border-width:0 5px 5px}.btn-group-vertical>.btn,.btn-group-vertical>.btn-group{display:block;float:none;width:100%;max-width:100%}.btn-group-vertical>.btn-group:before,.btn-group-vertical>.btn-group:after{display:table;content:" "}.btn-group-vertical>.btn-group:after{clear:both}.btn-group-vertical>.btn-group:before,.btn-group-vertical>.btn-group:after{display:table;content:" "}.btn-group-vertical>.btn-group:after{clear:both}.btn-group-vertical>.btn-group>.btn{float:none}.btn-group-vertical>.btn+.btn,.btn-group-vertical>.btn+.btn-group,.btn-group-vertical>.btn-group+.btn,.btn-group-vertical>.btn-group+.btn-group{margin-top:-1px;margin-left:0}.btn-group-vertical>.btn:not(:first-child):not(:last-child){border-radius:0}.btn-group-vertical>.btn:first-child:not(:last-child){border-top-right-radius:6px;border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn:last-child:not(:first-child){border-top-right-radius:0;border-bottom-left-radius:6px;border-top-left-radius:0}.btn-group-vertical>.btn-group:not(:first-child):not(:last-child)>.btn{border-radius:0}.btn-group-vertical>.btn-group:first-child>.btn:last-child,.btn-group-vertical>.btn-group:first-child>.dropdown-toggle{border-bottom-right-radius:0;border-bottom-left-radius:0}.btn-group-vertical>.btn-group:last-child>.btn:first-child{border-top-right-radius:0;border-top-left-radius:0}.btn-group-justified{display:table;width:100%;border-collapse:separate;table-layout:fixed}.btn-group-justified .btn{display:table-cell;float:none;width:1%}[data-toggle="buttons"]>.btn>input[type="radio"],[data-toggle="buttons"]>.btn>input[type="checkbox"]{display:none}.input-group{position:relative;display:table;border-collapse:separate}.input-group.col{float:none;padding-right:0;padding-left:0}.input-group .form-control{width:100%;margin-bottom:0}.input-group-lg>.form-control,.input-group-lg>.input-group-addon,.input-group-lg>.input-group-btn>.btn{height:47px;padding:10px 16px;font-size:19px;line-height:1.33;border-radius:8px}select.input-group-lg>.form-control,select.input-group-lg>.input-group-addon,select.input-group-lg>.input-group-btn>.btn{height:47px;line-height:47px}textarea.input-group-lg>.form-control,textarea.input-group-lg>.input-group-addon,textarea.input-group-lg>.input-group-btn>.btn{height:auto}.input-group-sm>.form-control,.input-group-sm>.input-group-addon,.input-group-sm>.input-group-btn>.btn{height:31px;padding:5px 10px;font-size:13px;line-height:1.5;border-radius:4px}select.input-group-sm>.form-control,select.input-group-sm>.input-group-addon,select.input-group-sm>.input-group-btn>.btn{height:31px;line-height:31px}textarea.input-group-sm>.form-control,textarea.input-group-sm>.input-group-addon,textarea.input-group-sm>.input-group-btn>.btn{height:auto}.input-group-addon,.input-group-btn,.input-group .form-control{display:table-cell}.input-group-addon:not(:first-child):not(:last-child),.input-group-btn:not(:first-child):not(:last-child),.input-group .form-control:not(:first-child):not(:last-child){border-radius:0}.input-group-addon,.input-group-btn{width:1%;white-space:nowrap;vertical-align:middle}.input-group-addon{padding:6px 12px;font-size:15px;font-weight:normal;line-height:1;color:#ae7e44;text-align:center;background-color:#fff;border:1px solid #ffc37a;border-radius:6px}.input-group-addon.input-sm{padding:5px 10px;font-size:13px;border-radius:4px}.input-group-addon.input-lg{padding:10px 16px;font-size:19px;border-radius:8px}.input-group-addon input[type="radio"],.input-group-addon input[type="checkbox"]{margin-top:0}.input-group .form-control:first-child,.input-group-addon:first-child,.input-group-btn:first-child>.btn,.input-group-btn:first-child>.dropdown-toggle,.input-group-btn:last-child>.btn:not(:last-child):not(.dropdown-toggle){border-top-right-radius:0;border-bottom-right-radius:0}.input-group-addon:first-child{border-right:0}.input-group .form-control:last-child,.input-group-addon:last-child,.input-group-btn:last-child>.btn,.input-group-btn:last-child>.dropdown-toggle,.input-group-btn:first-child>.btn:not(:first-child){border-bottom-left-radius:0;border-top-left-radius:0}.input-group-addon:last-child{border-left:0}.input-group-btn{position:relative;white-space:nowrap}.input-group-btn:first-child>.btn{margin-right:-1px}.input-group-btn:last-child>.btn{margin-left:-1px}.input-group-btn>.btn{position:relative}.input-group-btn>.btn+.btn{margin-left:-4px}.input-group-btn>.btn:hover,.input-group-btn>.btn:active{z-index:2}.nav{padding-left:0;margin-bottom:0;list-style:none}.nav:before,.nav:after{display:table;content:" "}.nav:after{clear:both}.nav:before,.nav:after{display:table;content:" "}.nav:after{clear:both}.nav>li{position:relative;display:block}.nav>li>a{position:relative;display:block;padding:10px 15px}.nav>li>a:hover,.nav>li>a:focus{text-decoration:none;background-color:#fff}.nav>li.disabled>a{color:#dabf9f}.nav>li.disabled>a:hover,.nav>li.disabled>a:focus{color:#dabf9f;text-decoration:none;cursor:not-allowed;background-color:transparent}.nav .open>a,.nav .open>a:hover,.nav .open>a:focus{background-color:#fff;border-color:#e30842}.nav .open>a .caret,.nav .open>a:hover .caret,.nav .open>a:focus .caret{border-top-color:#99052d;border-bottom-color:#99052d}.nav .nav-divider{height:1px;margin:9.5px 0;overflow:hidden;background-color:#e5e5e5}.nav>li>a>img{max-width:none}.nav-tabs{border-bottom:1px solid #ddd}.nav-tabs>li{float:left;margin-bottom:-1px}.nav-tabs>li>a{margin-right:2px;line-height:1.428571429;border:1px solid transparent;border-radius:6px 6px 0 0}.nav-tabs>li>a:hover{border-color:#fff #fff #ddd}.nav-tabs>li.active>a,.nav-tabs>li.active>a:hover,.nav-tabs>li.active>a:focus{color:#ae7e44;cursor:default;background-color:#ffc;border:1px solid #ddd;border-bottom-color:transparent}.nav-tabs.nav-justified{width:100%;border-bottom:0}.nav-tabs.nav-justified>li{float:none}.nav-tabs.nav-justified>li>a{margin-bottom:5px;text-align:center}@media(min-width:768px){.nav-tabs.nav-justified>li{display:table-cell;width:1%}.nav-tabs.nav-justified>li>a{margin-bottom:0}}.nav-tabs.nav-justified>li>a{margin-right:0;border-radius:6px}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border:1px solid #ddd}@media(min-width:768px){.nav-tabs.nav-justified>li>a{border-bottom:1px solid #ddd;border-radius:6px 6px 0 0}.nav-tabs.nav-justified>.active>a,.nav-tabs.nav-justified>.active>a:hover,.nav-tabs.nav-justified>.active>a:focus{border-bottom-color:#ffc}}.nav-pills>li{float:left}.nav-pills>li>a{border-radius:6px}.nav-pills>li+li{margin-left:2px}.nav-pills>li.active>a,.nav-pills>li.active>a:hover,.nav-pills>li.active>a:focus{color:#fff;background-color:#e30842}.nav-pills>li.active>a .caret,.nav-pills>li.active>a:hover .caret,.nav-pills>li.active>a:focus .caret{border-top-color:#fff;border-bottom-color:#fff}.nav-stacked>li{float:none}.nav-stacked>li+li{margin-top:2px;margin-left:0}.nav-justified{width:100%}.nav-justified>li{float:none}.nav-justified>li>a{margin-bottom:5px;text-align:center}@media(min-width:768px){.nav-justified>li{display:table-cell;width:1%}.nav-justified>li>a{margin-bottom:0}}.nav-tabs-justified{border-bottom:0}.nav-tabs-justified>li>a{margin-right:0;border-radius:6px}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border:1px solid #ddd}@media(min-width:768px){.nav-tabs-justified>li>a{border-bottom:1px solid #ddd;border-radius:6px 6px 0 0}.nav-tabs-justified>.active>a,.nav-tabs-justified>.active>a:hover,.nav-tabs-justified>.active>a:focus{border-bottom-color:#ffc}}.tabbable:before,.tabbable:after{display:table;content:" "}.tabbable:after{clear:both}.tabbable:before,.tabbable:after{display:table;content:" "}.tabbable:after{clear:both}.tab-content>.tab-pane,.pill-content>.pill-pane{display:none}.tab-content>.active,.pill-content>.active{display:block}.nav .caret{border-top-color:#e30842;border-bottom-color:#e30842}.nav a:hover .caret{border-top-color:#99052d;border-bottom-color:#99052d}.nav-tabs .dropdown-menu{margin-top:-1px;border-top-right-radius:0;border-top-left-radius:0}.navbar{position:relative;z-index:1000;min-height:50px;margin-bottom:21px;border:1px solid transparent}.navbar:before,.navbar:after{display:table;content:" "}.navbar:after{clear:both}.navbar:before,.navbar:after{display:table;content:" "}.navbar:after{clear:both}@media(min-width:768px){.navbar{border-radius:6px}}.navbar-header:before,.navbar-header:after{display:table;content:" "}.navbar-header:after{clear:both}.navbar-header:before,.navbar-header:after{display:table;content:" "}.navbar-header:after{clear:both}@media(min-width:768px){.navbar-header{float:left}}.navbar-collapse{max-height:340px;padding-right:15px;padding-left:15px;overflow-x:visible;border-top:1px solid transparent;box-shadow:inset 0 1px 0 rgba(255,255,255,0.1);-webkit-overflow-scrolling:touch}.navbar-collapse:before,.navbar-collapse:after{display:table;content:" "}.navbar-collapse:after{clear:both}.navbar-collapse:before,.navbar-collapse:after{display:table;content:" "}.navbar-collapse:after{clear:both}.navbar-collapse.in{overflow-y:auto}@media(min-width:768px){.navbar-collapse{width:auto;border-top:0;box-shadow:none}.navbar-collapse.collapse{display:block!important;height:auto!important;padding-bottom:0;overflow:visible!important}.navbar-collapse.in{overflow-y:visible}.navbar-collapse .navbar-nav.navbar-left:first-child{margin-left:-15px}.navbar-collapse .navbar-nav.navbar-right:last-child{margin-right:-15px}.navbar-collapse .navbar-text:last-child{margin-right:0}}.container>.navbar-header,.container>.navbar-collapse{margin-right:-15px;margin-left:-15px}@media(min-width:768px){.container>.navbar-header,.container>.navbar-collapse{margin-right:0;margin-left:0}}.navbar-static-top{border-width:0 0 1px}@media(min-width:768px){.navbar-static-top{border-radius:0}}.navbar-fixed-top,.navbar-fixed-bottom{position:fixed;right:0;left:0;border-width:0 0 1px}@media(min-width:768px){.navbar-fixed-top,.navbar-fixed-bottom{border-radius:0}}.navbar-fixed-top{top:0;z-index:1030}.navbar-fixed-bottom{bottom:0;margin-bottom:0}.navbar-brand{float:left;padding:14.5px 15px;font-size:19px;line-height:21px}.navbar-brand:hover,.navbar-brand:focus{text-decoration:none}@media(min-width:768px){.navbar>.container .navbar-brand{margin-left:-15px}}.navbar-toggle{position:relative;float:right;padding:9px 10px;margin-top:8px;margin-right:15px;margin-bottom:8px;background-color:transparent;border:1px solid transparent;border-radius:6px}.navbar-toggle .icon-bar{display:block;width:22px;height:2px;border-radius:1px}.navbar-toggle .icon-bar+.icon-bar{margin-top:4px}@media(min-width:768px){.navbar-toggle{display:none}}.navbar-nav{margin:7.25px -15px}.navbar-nav>li>a{padding-top:10px;padding-bottom:10px;line-height:21px}@media(max-width:767px){.navbar-nav .open .dropdown-menu{position:static;float:none;width:auto;margin-top:0;background-color:transparent;border:0;box-shadow:none}.navbar-nav .open .dropdown-menu>li>a,.navbar-nav .open .dropdown-menu .dropdown-header{padding:5px 15px 5px 25px}.navbar-nav .open .dropdown-menu>li>a{line-height:21px}.navbar-nav .open .dropdown-menu>li>a:hover,.navbar-nav .open .dropdown-menu>li>a:focus{background-image:none}}@media(min-width:768px){.navbar-nav{float:left;margin:0}.navbar-nav>li{float:left}.navbar-nav>li>a{padding-top:14.5px;padding-bottom:14.5px}}@media(min-width:768px){.navbar-left{float:left!important}.navbar-right{float:right!important}}.navbar-form{padding:10px 15px;margin-top:7.5px;margin-right:-15px;margin-bottom:7.5px;margin-left:-15px;border-top:1px solid transparent;border-bottom:1px solid transparent;-webkit-box-shadow:inset 0 1px 0 rgba(255,255,255,0.1),0 1px 0 rgba(255,255,255,0.1);box-shadow:inset 0 1px 0 rgba(255,255,255,0.1),0 1px 0 rgba(255,255,255,0.1)}@media(min-width:768px){.navbar-form .form-group{display:inline-block;margin-bottom:0;vertical-align:middle}.navbar-form .form-control{display:inline-block}.navbar-form .radio,.navbar-form .checkbox{display:inline-block;padding-left:0;margin-top:0;margin-bottom:0}.navbar-form .radio input[type="radio"],.navbar-form .checkbox input[type="checkbox"]{float:none;margin-left:0}}@media(max-width:767px){.navbar-form .form-group{margin-bottom:5px}}@media(min-width:768px){.navbar-form{width:auto;padding-top:0;padding-bottom:0;margin-right:0;margin-left:0;border:0;-webkit-box-shadow:none;box-shadow:none}}.navbar-nav>li>.dropdown-menu{margin-top:0;border-top-right-radius:0;border-top-left-radius:0}.navbar-fixed-bottom .navbar-nav>li>.dropdown-menu{border-bottom-right-radius:0;border-bottom-left-radius:0}.navbar-nav.pull-right>li>.dropdown-menu,.navbar-nav>li>.dropdown-menu.pull-right{right:0;left:auto}.navbar-btn{margin-top:7.5px;margin-bottom:7.5px}.navbar-text{float:left;margin-top:14.5px;margin-bottom:14.5px}@media(min-width:768px){.navbar-text{margin-right:15px;margin-left:15px}}.navbar-default{background-color:#682727;border-color:#501e1e}.navbar-default .navbar-brand{color:#fff}.navbar-default .navbar-brand:hover,.navbar-default .navbar-brand:focus{color:#e6e6e6;background-color:transparent}.navbar-default .navbar-text{color:#fff}.navbar-default .navbar-nav>li>a{color:#fff}.navbar-default .navbar-nav>li>a:hover,.navbar-default .navbar-nav>li>a:focus{color:#fff;background-color:transparent}.navbar-default .navbar-nav>.active>a,.navbar-default .navbar-nav>.active>a:hover,.navbar-default .navbar-nav>.active>a:focus{color:#fff;background-color:#501e1e}.navbar-default .navbar-nav>.disabled>a,.navbar-default .navbar-nav>.disabled>a:hover,.navbar-default .navbar-nav>.disabled>a:focus{color:#fff;background-color:transparent}.navbar-default .navbar-toggle{border-color:#ddd}.navbar-default .navbar-toggle:hover,.navbar-default .navbar-toggle:focus{background-color:#ddd}.navbar-default .navbar-toggle .icon-bar{background-color:#ccc}.navbar-default .navbar-collapse,.navbar-default .navbar-form{border-color:#501e1e}.navbar-default .navbar-nav>.dropdown>a:hover .caret,.navbar-default .navbar-nav>.dropdown>a:focus .caret{border-top-color:#fff;border-bottom-color:#fff}.navbar-default .navbar-nav>.open>a,.navbar-default .navbar-nav>.open>a:hover,.navbar-default .navbar-nav>.open>a:focus{color:#fff;background-color:#501e1e}.navbar-default .navbar-nav>.open>a .caret,.navbar-default .navbar-nav>.open>a:hover .caret,.navbar-default .navbar-nav>.open>a:focus .caret{border-top-color:#fff;border-bottom-color:#fff}.navbar-default .navbar-nav>.dropdown>a .caret{border-top-color:#fff;border-bottom-color:#fff}@media(max-width:767px){.navbar-default .navbar-nav .open .dropdown-menu>li>a{color:#fff}.navbar-default .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>li>a:focus{color:#fff;background-color:transparent}.navbar-default .navbar-nav .open .dropdown-menu>.active>a,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.active>a:focus{color:#fff;background-color:#501e1e}.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-default .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#fff;background-color:transparent}}.navbar-default .navbar-link{color:#fff}.navbar-default .navbar-link:hover{color:#fff}.navbar-inverse{background-color:#682727;border-color:#431919}.navbar-inverse .navbar-brand{color:#fff}.navbar-inverse .navbar-brand:hover,.navbar-inverse .navbar-brand:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-text{color:#fff}.navbar-inverse .navbar-nav>li>a{color:#fff}.navbar-inverse .navbar-nav>li>a:hover,.navbar-inverse .navbar-nav>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav>.active>a,.navbar-inverse .navbar-nav>.active>a:hover,.navbar-inverse .navbar-nav>.active>a:focus{color:#fff;background-color:#431919}.navbar-inverse .navbar-nav>.disabled>a,.navbar-inverse .navbar-nav>.disabled>a:hover,.navbar-inverse .navbar-nav>.disabled>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-toggle{border-color:#333}.navbar-inverse .navbar-toggle:hover,.navbar-inverse .navbar-toggle:focus{background-color:#333}.navbar-inverse .navbar-toggle .icon-bar{background-color:#fff}.navbar-inverse .navbar-collapse,.navbar-inverse .navbar-form{border-color:#4e1d1d}.navbar-inverse .navbar-nav>.open>a,.navbar-inverse .navbar-nav>.open>a:hover,.navbar-inverse .navbar-nav>.open>a:focus{color:#fff;background-color:#431919}.navbar-inverse .navbar-nav>.dropdown>a:hover .caret{border-top-color:#fff;border-bottom-color:#fff}.navbar-inverse .navbar-nav>.dropdown>a .caret{border-top-color:#fff;border-bottom-color:#fff}.navbar-inverse .navbar-nav>.open>a .caret,.navbar-inverse .navbar-nav>.open>a:hover .caret,.navbar-inverse .navbar-nav>.open>a:focus .caret{border-top-color:#fff;border-bottom-color:#fff}@media(max-width:767px){.navbar-inverse .navbar-nav .open .dropdown-menu>.dropdown-header{border-color:#431919}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a{color:#fff}.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>li>a:focus{color:#fff;background-color:transparent}.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.active>a:focus{color:#fff;background-color:#431919}.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:hover,.navbar-inverse .navbar-nav .open .dropdown-menu>.disabled>a:focus{color:#fff;background-color:transparent}}.navbar-inverse .navbar-link{color:#fff}.navbar-inverse .navbar-link:hover{color:#fff}.breadcrumb{padding:8px 15px;margin-bottom:21px;list-style:none;background-color:#f5f5f5;border-radius:6px}.breadcrumb>li{display:inline-block}.breadcrumb>li+li:before{padding:0 5px;color:#ccc;content:"/\00a0"}.breadcrumb>.active{color:#dabf9f}.pagination{display:inline-block;padding-left:0;margin:21px 0;border-radius:6px}.pagination>li{display:inline}.pagination>li>a,.pagination>li>span{position:relative;float:left;padding:6px 12px;margin-left:-1px;line-height:1.428571429;text-decoration:none;background-color:#fff;border:1px solid #ddd}.pagination>li:first-child>a,.pagination>li:first-child>span{margin-left:0;border-bottom-left-radius:6px;border-top-left-radius:6px}.pagination>li:last-child>a,.pagination>li:last-child>span{border-top-right-radius:6px;border-bottom-right-radius:6px}.pagination>li>a:hover,.pagination>li>span:hover,.pagination>li>a:focus,.pagination>li>span:focus{background-color:#fff}.pagination>.active>a,.pagination>.active>span,.pagination>.active>a:hover,.pagination>.active>span:hover,.pagination>.active>a:focus,.pagination>.active>span:focus{z-index:2;color:#fff;cursor:default;background-color:#e30842;border-color:#e30842}.pagination>.disabled>span,.pagination>.disabled>span:hover,.pagination>.disabled>span:focus,.pagination>.disabled>a,.pagination>.disabled>a:hover,.pagination>.disabled>a:focus{color:#dabf9f;cursor:not-allowed;background-color:#fff;border-color:#ddd}.pagination-lg>li>a,.pagination-lg>li>span{padding:10px 16px;font-size:19px}.pagination-lg>li:first-child>a,.pagination-lg>li:first-child>span{border-bottom-left-radius:8px;border-top-left-radius:8px}.pagination-lg>li:last-child>a,.pagination-lg>li:last-child>span{border-top-right-radius:8px;border-bottom-right-radius:8px}.pagination-sm>li>a,.pagination-sm>li>span{padding:5px 10px;font-size:13px}.pagination-sm>li:first-child>a,.pagination-sm>li:first-child>span{border-bottom-left-radius:4px;border-top-left-radius:4px}.pagination-sm>li:last-child>a,.pagination-sm>li:last-child>span{border-top-right-radius:4px;border-bottom-right-radius:4px}.pager{padding-left:0;margin:21px 0;text-align:center;list-style:none}.pager:before,.pager:after{display:table;content:" "}.pager:after{clear:both}.pager:before,.pager:after{display:table;content:" "}.pager:after{clear:both}.pager li{display:inline}.pager li>a,.pager li>span{display:inline-block;padding:5px 14px;background-color:#fff;border:1px solid #ddd;border-radius:15px}.pager li>a:hover,.pager li>a:focus{text-decoration:none;background-color:#fff}.pager .next>a,.pager .next>span{float:right}.pager .previous>a,.pager .previous>span{float:left}.pager .disabled>a,.pager .disabled>a:hover,.pager .disabled>a:focus,.pager .disabled>span{color:#dabf9f;cursor:not-allowed;background-color:#fff}.label{display:inline;padding:.2em .6em .3em;font-size:75%;font-weight:bold;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;border-radius:.25em}.label[href]:hover,.label[href]:focus{color:#fff;text-decoration:none;cursor:pointer}.label:empty{display:none}.label-default{background-color:#dabf9f}.label-default[href]:hover,.label-default[href]:focus{background-color:#cba77b}.label-primary{background-color:#e30842}.label-primary[href]:hover,.label-primary[href]:focus{background-color:#b20634}.label-success{background-color:#5cb85c}.label-success[href]:hover,.label-success[href]:focus{background-color:#449d44}.label-info{background-color:#5bc0de}.label-info[href]:hover,.label-info[href]:focus{background-color:#31b0d5}.label-warning{background-color:#f0ad4e}.label-warning[href]:hover,.label-warning[href]:focus{background-color:#ec971f}.label-danger{background-color:#d9534f}.label-danger[href]:hover,.label-danger[href]:focus{background-color:#c9302c}.badge{display:inline-block;min-width:10px;padding:3px 7px;font-size:13px;font-weight:bold;line-height:1;color:#fff;text-align:center;white-space:nowrap;vertical-align:baseline;background-color:#dabf9f;border-radius:10px}.badge:empty{display:none}a.badge:hover,a.badge:focus{color:#fff;text-decoration:none;cursor:pointer}.btn .badge{position:relative;top:-1px}a.list-group-item.active>.badge,.nav-pills>.active>a>.badge{color:#e30842;background-color:#fff}.nav-pills>li>a>.badge{margin-left:3px}.jumbotron{padding:30px;margin-bottom:30px;font-size:22.5px;font-weight:200;line-height:2.1428571435;color:inherit;background-color:#f6fada}.jumbotron h1{line-height:1;color:inherit}.jumbotron p{line-height:1.4}.container .jumbotron{border-radius:8px}@media screen and (min-width:768px){.jumbotron{padding-top:48px;padding-bottom:48px}.container .jumbotron{padding-right:60px;padding-left:60px}.jumbotron h1{font-size:67.5px}}.thumbnail{display:inline-block;display:block;height:auto;max-width:100%;padding:4px;margin-bottom:21px;line-height:1.428571429;background-color:#ffc;border:1px solid #ddd;border-radius:6px;-webkit-transition:all .2s ease-in-out;transition:all .2s ease-in-out}.thumbnail>img{display:block;height:auto;max-width:100%}a.thumbnail:hover,a.thumbnail:focus{border-color:#e30842}.thumbnail>img{margin-right:auto;margin-left:auto}.thumbnail .caption{padding:9px;color:#323}.alert{padding:15px;margin-bottom:21px;border:1px solid transparent;border-radius:6px}.alert h4{margin-top:0;color:inherit}.alert .alert-link{font-weight:bold}.alert>p,.alert>ul{margin-bottom:0}.alert>p+p{margin-top:5px}.alert-dismissable{padding-right:35px}.alert-dismissable .close{position:relative;top:-2px;right:-21px;color:inherit}.alert-success{color:#468847;background-color:#dff0d8;border-color:#d6e9c6}.alert-success hr{border-top-color:#c9e2b3}.alert-success .alert-link{color:#356635}.alert-info{color:#3a87ad;background-color:#d9edf7;border-color:#bce8f1}.alert-info hr{border-top-color:#a6e1ec}.alert-info .alert-link{color:#2d6987}.alert-warning{color:#c09853;background-color:#fcf8e3;border-color:#faebcc}.alert-warning hr{border-top-color:#f7e1b5}.alert-warning .alert-link{color:#a47e3c}.alert-danger{color:#b94a48;background-color:#f2dede;border-color:#ebccd1}.alert-danger hr{border-top-color:#e4b9c0}.alert-danger .alert-link{color:#953b39}@-webkit-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@-moz-keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}@-o-keyframes progress-bar-stripes{from{background-position:0 0}to{background-position:40px 0}}@keyframes progress-bar-stripes{from{background-position:40px 0}to{background-position:0 0}}.progress{height:21px;margin-bottom:21px;overflow:hidden;background-color:#f5f5f5;border-radius:6px;-webkit-box-shadow:inset 0 1px 2px rgba(0,0,0,0.1);box-shadow:inset 0 1px 2px rgba(0,0,0,0.1)}.progress-bar{float:left;width:0;height:100%;font-size:13px;line-height:21px;color:#fff;text-align:center;background-color:#e30842;-webkit-box-shadow:inset 0 -1px 0 rgba(0,0,0,0.15);box-shadow:inset 0 -1px 0 rgba(0,0,0,0.15);-webkit-transition:width .6s ease;transition:width .6s ease}.progress-striped .progress-bar{background-image:-webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent));background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:-moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-size:40px 40px}.progress.active .progress-bar{-webkit-animation:progress-bar-stripes 2s linear infinite;-moz-animation:progress-bar-stripes 2s linear infinite;-ms-animation:progress-bar-stripes 2s linear infinite;-o-animation:progress-bar-stripes 2s linear infinite;animation:progress-bar-stripes 2s linear infinite}.progress-bar-success{background-color:#5cb85c}.progress-striped .progress-bar-success{background-image:-webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent));background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:-moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent)}.progress-bar-info{background-color:#5bc0de}.progress-striped .progress-bar-info{background-image:-webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent));background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:-moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent)}.progress-bar-warning{background-color:#f0ad4e}.progress-striped .progress-bar-warning{background-image:-webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent));background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:-moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent)}.progress-bar-danger{background-color:#d9534f}.progress-striped .progress-bar-danger{background-image:-webkit-gradient(linear,0 100%,100% 0,color-stop(0.25,rgba(255,255,255,0.15)),color-stop(0.25,transparent),color-stop(0.5,transparent),color-stop(0.5,rgba(255,255,255,0.15)),color-stop(0.75,rgba(255,255,255,0.15)),color-stop(0.75,transparent),to(transparent));background-image:-webkit-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:-moz-linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent);background-image:linear-gradient(45deg,rgba(255,255,255,0.15) 25%,transparent 25%,transparent 50%,rgba(255,255,255,0.15) 50%,rgba(255,255,255,0.15) 75%,transparent 75%,transparent)}.media,.media-body{overflow:hidden;zoom:1}.media,.media .media{margin-top:15px}.media:first-child{margin-top:0}.media-object{display:block}.media-heading{margin:0 0 5px}.media>.pull-left{margin-right:10px}.media>.pull-right{margin-left:10px}.media-list{padding-left:0;list-style:none}.list-group{padding-left:0;margin-bottom:20px}.list-group-item{position:relative;display:block;padding:10px 15px;margin-bottom:-1px;background-color:#fff;border:1px solid #ddd}.list-group-item:first-child{border-top-right-radius:6px;border-top-left-radius:6px}.list-group-item:last-child{margin-bottom:0;border-bottom-right-radius:6px;border-bottom-left-radius:6px}.list-group-item>.badge{float:right}.list-group-item>.badge+.badge{margin-right:5px}a.list-group-item{color:#555}a.list-group-item .list-group-item-heading{color:#333}a.list-group-item:hover,a.list-group-item:focus{text-decoration:none;background-color:#f5f5f5}.list-group-item.active,.list-group-item.active:hover,.list-group-item.active:focus{z-index:2;color:#fff;background-color:#e30842;border-color:#e30842}.list-group-item.active .list-group-item-heading,.list-group-item.active:hover .list-group-item-heading,.list-group-item.active:focus .list-group-item-heading{color:inherit}.list-group-item.active .list-group-item-text,.list-group-item.active:hover .list-group-item-text,.list-group-item.active:focus .list-group-item-text{color:#fdbacc}.list-group-item-heading{margin-top:0;margin-bottom:5px}.list-group-item-text{margin-bottom:0;line-height:1.3}.panel{margin-bottom:21px;background-color:#fff;border:1px solid transparent;border-radius:6px;-webkit-box-shadow:0 1px 1px rgba(0,0,0,0.05);box-shadow:0 1px 1px rgba(0,0,0,0.05)}.panel-body{padding:15px}.panel-body:before,.panel-body:after{display:table;content:" "}.panel-body:after{clear:both}.panel-body:before,.panel-body:after{display:table;content:" "}.panel-body:after{clear:both}.panel>.list-group{margin-bottom:0}.panel>.list-group .list-group-item{border-width:1px 0}.panel>.list-group .list-group-item:first-child{border-top-right-radius:0;border-top-left-radius:0}.panel>.list-group .list-group-item:last-child{border-bottom:0}.panel-heading+.list-group .list-group-item:first-child{border-top-width:0}.panel>.table,.panel>.table-responsive{margin-bottom:0}.panel>.panel-body+.table,.panel>.panel-body+.table-responsive{border-top:1px solid #fff}.panel>.table-bordered,.panel>.table-responsive>.table-bordered{border:0}.panel>.table-bordered>thead>tr>th:first-child,.panel>.table-responsive>.table-bordered>thead>tr>th:first-child,.panel>.table-bordered>tbody>tr>th:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:first-child,.panel>.table-bordered>tfoot>tr>th:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:first-child,.panel>.table-bordered>thead>tr>td:first-child,.panel>.table-responsive>.table-bordered>thead>tr>td:first-child,.panel>.table-bordered>tbody>tr>td:first-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:first-child,.panel>.table-bordered>tfoot>tr>td:first-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:first-child{border-left:0}.panel>.table-bordered>thead>tr>th:last-child,.panel>.table-responsive>.table-bordered>thead>tr>th:last-child,.panel>.table-bordered>tbody>tr>th:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>th:last-child,.panel>.table-bordered>tfoot>tr>th:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>th:last-child,.panel>.table-bordered>thead>tr>td:last-child,.panel>.table-responsive>.table-bordered>thead>tr>td:last-child,.panel>.table-bordered>tbody>tr>td:last-child,.panel>.table-responsive>.table-bordered>tbody>tr>td:last-child,.panel>.table-bordered>tfoot>tr>td:last-child,.panel>.table-responsive>.table-bordered>tfoot>tr>td:last-child{border-right:0}.panel>.table-bordered>thead>tr:last-child>th,.panel>.table-responsive>.table-bordered>thead>tr:last-child>th,.panel>.table-bordered>tbody>tr:last-child>th,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>th,.panel>.table-bordered>tfoot>tr:last-child>th,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>th,.panel>.table-bordered>thead>tr:last-child>td,.panel>.table-responsive>.table-bordered>thead>tr:last-child>td,.panel>.table-bordered>tbody>tr:last-child>td,.panel>.table-responsive>.table-bordered>tbody>tr:last-child>td,.panel>.table-bordered>tfoot>tr:last-child>td,.panel>.table-responsive>.table-bordered>tfoot>tr:last-child>td{border-bottom:0}.panel-heading{padding:10px 15px;border-bottom:1px solid transparent;border-top-right-radius:5px;border-top-left-radius:5px}.panel-title{margin-top:0;margin-bottom:0;font-size:17px}.panel-title>a{color:inherit}.panel-footer{padding:10px 15px;background-color:#f5f5f5;border-top:1px solid #ddd;border-bottom-right-radius:5px;border-bottom-left-radius:5px}.panel-group .panel{margin-bottom:0;overflow:hidden;border-radius:6px}.panel-group .panel+.panel{margin-top:5px}.panel-group .panel-heading{border-bottom:0}.panel-group .panel-heading+.panel-collapse .panel-body{border-top:1px solid #ddd}.panel-group .panel-footer{border-top:0}.panel-group .panel-footer+.panel-collapse .panel-body{border-bottom:1px solid #ddd}.panel-default{border-color:#ddd}.panel-default>.panel-heading{color:#7c5a31;background-color:#f5f5f5;border-color:#ddd}.panel-default>.panel-heading+.panel-collapse .panel-body{border-top-color:#ddd}.panel-default>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#ddd}.panel-primary{border-color:#e30842}.panel-primary>.panel-heading{color:#fff;background-color:#e30842;border-color:#e30842}.panel-primary>.panel-heading+.panel-collapse .panel-body{border-top-color:#e30842}.panel-primary>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#e30842}.panel-success{border-color:#d6e9c6}.panel-success>.panel-heading{color:#468847;background-color:#dff0d8;border-color:#d6e9c6}.panel-success>.panel-heading+.panel-collapse .panel-body{border-top-color:#d6e9c6}.panel-success>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#d6e9c6}.panel-warning{border-color:#faebcc}.panel-warning>.panel-heading{color:#c09853;background-color:#fcf8e3;border-color:#faebcc}.panel-warning>.panel-heading+.panel-collapse .panel-body{border-top-color:#faebcc}.panel-warning>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#faebcc}.panel-danger{border-color:#ebccd1}.panel-danger>.panel-heading{color:#b94a48;background-color:#f2dede;border-color:#ebccd1}.panel-danger>.panel-heading+.panel-collapse .panel-body{border-top-color:#ebccd1}.panel-danger>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#ebccd1}.panel-info{border-color:#bce8f1}.panel-info>.panel-heading{color:#3a87ad;background-color:#d9edf7;border-color:#bce8f1}.panel-info>.panel-heading+.panel-collapse .panel-body{border-top-color:#bce8f1}.panel-info>.panel-footer+.panel-collapse .panel-body{border-bottom-color:#bce8f1}.well{min-height:20px;padding:19px;margin-bottom:20px;background-color:#ffc;border:1px solid #ffffa8;border-radius:6px;-webkit-box-shadow:inset 0 1px 1px rgba(0,0,0,0.05);box-shadow:inset 0 1px 1px rgba(0,0,0,0.05)}.well blockquote{border-color:#ddd;border-color:rgba(0,0,0,0.15)}.well-lg{padding:24px;border-radius:8px}.well-sm{padding:9px;border-radius:4px}.close{float:right;font-size:22.5px;font-weight:bold;line-height:1;color:#000;text-shadow:0 1px 0 #fff;opacity:.2;filter:alpha(opacity=20)}.close:hover,.close:focus{color:#000;text-decoration:none;cursor:pointer;opacity:.5;filter:alpha(opacity=50)}button.close{padding:0;cursor:pointer;background:transparent;border:0;-webkit-appearance:none}.modal-open{overflow:hidden}body.modal-open,.modal-open .navbar-fixed-top,.modal-open .navbar-fixed-bottom{margin-right:15px}.modal{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1040;display:none;overflow:auto;overflow-y:scroll}.modal.fade .modal-dialog{-webkit-transform:translate(0,-25%);-ms-transform:translate(0,-25%);transform:translate(0,-25%);-webkit-transition:-webkit-transform .3s ease-out;-moz-transition:-moz-transform .3s ease-out;-o-transition:-o-transform .3s ease-out;transition:transform .3s ease-out}.modal.in .modal-dialog{-webkit-transform:translate(0,0);-ms-transform:translate(0,0);transform:translate(0,0)}.modal-dialog{z-index:1050;width:auto;padding:10px;margin-right:auto;margin-left:auto}.modal-content{position:relative;background-color:#fff;border:1px solid #999;border:1px solid rgba(0,0,0,0.2);border-radius:8px;outline:0;-webkit-box-shadow:0 3px 9px rgba(0,0,0,0.5);box-shadow:0 3px 9px rgba(0,0,0,0.5);background-clip:padding-box}.modal-backdrop{position:fixed;top:0;right:0;bottom:0;left:0;z-index:1030;background-color:#000}.modal-backdrop.fade{opacity:0;filter:alpha(opacity=0)}.modal-backdrop.in{opacity:.5;filter:alpha(opacity=50)}.modal-header{min-height:16.428571429px;padding:15px;border-bottom:1px solid #e5e5e5}.modal-header .close{margin-top:-2px}.modal-title{margin:0;line-height:1.428571429}.modal-body{position:relative;padding:20px}.modal-footer{padding:19px 20px 20px;margin-top:15px;text-align:right;border-top:1px solid #e5e5e5}.modal-footer:before,.modal-footer:after{display:table;content:" "}.modal-footer:after{clear:both}.modal-footer:before,.modal-footer:after{display:table;content:" "}.modal-footer:after{clear:both}.modal-footer .btn+.btn{margin-bottom:0;margin-left:5px}.modal-footer .btn-group .btn+.btn{margin-left:-1px}.modal-footer .btn-block+.btn-block{margin-left:0}@media screen and (min-width:768px){.modal-dialog{width:600px;padding-top:30px;padding-bottom:30px}.modal-content{-webkit-box-shadow:0 5px 15px rgba(0,0,0,0.5);box-shadow:0 5px 15px rgba(0,0,0,0.5)}}.tooltip{position:absolute;z-index:1030;display:block;font-size:13px;line-height:1.4;opacity:0;filter:alpha(opacity=0);visibility:visible}.tooltip.in{opacity:.9;filter:alpha(opacity=90)}.tooltip.top{padding:5px 0;margin-top:-3px}.tooltip.right{padding:0 5px;margin-left:3px}.tooltip.bottom{padding:5px 0;margin-top:3px}.tooltip.left{padding:0 5px;margin-left:-3px}.tooltip-inner{max-width:200px;padding:3px 8px;color:#fff;text-align:center;text-decoration:none;background-color:#000;border-radius:6px}.tooltip-arrow{position:absolute;width:0;height:0;border-color:transparent;border-style:solid}.tooltip.top .tooltip-arrow{bottom:0;left:50%;margin-left:-5px;border-top-color:#000;border-width:5px 5px 0}.tooltip.top-left .tooltip-arrow{bottom:0;left:5px;border-top-color:#000;border-width:5px 5px 0}.tooltip.top-right .tooltip-arrow{right:5px;bottom:0;border-top-color:#000;border-width:5px 5px 0}.tooltip.right .tooltip-arrow{top:50%;left:0;margin-top:-5px;border-right-color:#000;border-width:5px 5px 5px 0}.tooltip.left .tooltip-arrow{top:50%;right:0;margin-top:-5px;border-left-color:#000;border-width:5px 0 5px 5px}.tooltip.bottom .tooltip-arrow{top:0;left:50%;margin-left:-5px;border-bottom-color:#000;border-width:0 5px 5px}.tooltip.bottom-left .tooltip-arrow{top:0;left:5px;border-bottom-color:#000;border-width:0 5px 5px}.tooltip.bottom-right .tooltip-arrow{top:0;right:5px;border-bottom-color:#000;border-width:0 5px 5px}.popover{position:absolute;top:0;left:0;z-index:1010;display:none;max-width:276px;padding:1px;text-align:left;white-space:normal;background-color:#fff;border:1px solid #ccc;border:1px solid rgba(0,0,0,0.2);border-radius:8px;-webkit-box-shadow:0 5px 10px rgba(0,0,0,0.2);box-shadow:0 5px 10px rgba(0,0,0,0.2);background-clip:padding-box}.popover.top{margin-top:-10px}.popover.right{margin-left:10px}.popover.bottom{margin-top:10px}.popover.left{margin-left:-10px}.popover-title{padding:8px 14px;margin:0;font-size:15px;font-weight:normal;line-height:18px;background-color:#f7f7f7;border-bottom:1px solid #ebebeb;border-radius:5px 5px 0 0}.popover-content{padding:9px 14px}.popover .arrow,.popover .arrow:after{position:absolute;display:block;width:0;height:0;border-color:transparent;border-style:solid}.popover .arrow{border-width:11px}.popover .arrow:after{border-width:10px;content:""}.popover.top .arrow{bottom:-11px;left:50%;margin-left:-11px;border-top-color:#999;border-top-color:rgba(0,0,0,0.25);border-bottom-width:0}.popover.top .arrow:after{bottom:1px;margin-left:-10px;border-top-color:#fff;border-bottom-width:0;content:" "}.popover.right .arrow{top:50%;left:-11px;margin-top:-11px;border-right-color:#999;border-right-color:rgba(0,0,0,0.25);border-left-width:0}.popover.right .arrow:after{bottom:-10px;left:1px;border-right-color:#fff;border-left-width:0;content:" "}.popover.bottom .arrow{top:-11px;left:50%;margin-left:-11px;border-bottom-color:#999;border-bottom-color:rgba(0,0,0,0.25);border-top-width:0}.popover.bottom .arrow:after{top:1px;margin-left:-10px;border-bottom-color:#fff;border-top-width:0;content:" "}.popover.left .arrow{top:50%;right:-11px;margin-top:-11px;border-left-color:#999;border-left-color:rgba(0,0,0,0.25);border-right-width:0}.popover.left .arrow:after{right:1px;bottom:-10px;border-left-color:#fff;border-right-width:0;content:" "}.carousel{position:relative}.carousel-inner{position:relative;width:100%;overflow:hidden}.carousel-inner>.item{position:relative;display:none;-webkit-transition:.6s ease-in-out left;transition:.6s ease-in-out left}.carousel-inner>.item>img,.carousel-inner>.item>a>img{display:block;height:auto;max-width:100%;line-height:1}.carousel-inner>.active,.carousel-inner>.next,.carousel-inner>.prev{display:block}.carousel-inner>.active{left:0}.carousel-inner>.next,.carousel-inner>.prev{position:absolute;top:0;width:100%}.carousel-inner>.next{left:100%}.carousel-inner>.prev{left:-100%}.carousel-inner>.next.left,.carousel-inner>.prev.right{left:0}.carousel-inner>.active.left{left:-100%}.carousel-inner>.active.right{left:100%}.carousel-control{position:absolute;top:0;bottom:0;left:0;width:15%;font-size:120px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,0.6);opacity:.5;filter:alpha(opacity=50)}.carousel-control.left{background-image:-webkit-gradient(linear,0 top,100% top,from(rgba(0,0,0,0.5)),to(rgba(0,0,0,0.0001)));background-image:-webkit-linear-gradient(left,color-stop(rgba(0,0,0,0.5) 0),color-stop(rgba(0,0,0,0.0001) 100%));background-image:-moz-linear-gradient(left,rgba(0,0,0,0.5) 0,rgba(0,0,0,0.0001) 100%);background-image:linear-gradient(to right,rgba(0,0,0,0.5) 0,rgba(0,0,0,0.0001) 100%);background-repeat:repeat-x;filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000',endColorstr='#00000000',GradientType=1)}.carousel-control.right{right:0;left:auto;background-image:-webkit-gradient(linear,0 top,100% top,from(rgba(0,0,0,0.0001)),to(rgba(0,0,0,0.5)));background-image:-webkit-linear-gradient(left,color-stop(rgba(0,0,0,0.0001) 0),color-stop(rgba(0,0,0,0.5) 100%));background-image:-moz-linear-gradient(left,rgba(0,0,0,0.0001) 0,rgba(0,0,0,0.5) 100%);background-image:linear-gradient(to right,rgba(0,0,0,0.0001) 0,rgba(0,0,0,0.5) 100%);background-repeat:repeat-x;filter:progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000',endColorstr='#80000000',GradientType=1)}.carousel-control:hover,.carousel-control:focus{color:#fff;text-decoration:none;opacity:.9;filter:alpha(opacity=90)}.carousel-control .icon-prev,.carousel-control .icon-next,.carousel-control .glyphicon-chevron-left,.carousel-control .glyphicon-chevron-right{position:absolute;top:50%;z-index:5;display:inline-block}.carousel-control .icon-prev,.carousel-control .glyphicon-chevron-left{left:50%}.carousel-control .icon-next,.carousel-control .glyphicon-chevron-right{right:50%}.carousel-control .icon-prev,.carousel-control .icon-next{width:20px;height:20px;margin-top:-10px;margin-left:-10px;font-family:serif}.carousel-control .icon-prev:before{content:'\2039'}.carousel-control .icon-next:before{content:'\203a'}.carousel-indicators{position:absolute;bottom:10px;left:50%;z-index:15;width:60%;padding-left:0;margin-left:-30%;text-align:center;list-style:none}.carousel-indicators li{display:inline-block;width:10px;height:10px;margin:1px;text-indent:-999px;cursor:pointer;border:1px solid #fff;border-radius:10px}.carousel-indicators .active{width:12px;height:12px;margin:0;background-color:#fff}.carousel-caption{position:absolute;right:15%;bottom:20px;left:15%;z-index:10;padding-top:20px;padding-bottom:20px;color:#fff;text-align:center;text-shadow:0 1px 2px rgba(0,0,0,0.6)}.carousel-caption .btn{text-shadow:none}@media screen and (min-width:768px){.carousel-control .glyphicons-chevron-left,.carousel-control .glyphicons-chevron-right,.carousel-control .icon-prev,.carousel-control .icon-next{width:30px;height:30px;margin-top:-15px;margin-left:-15px;font-size:30px}.carousel-caption{right:20%;left:20%;padding-bottom:30px}.carousel-indicators{bottom:20px}}.clearfix:before,.clearfix:after{display:table;content:" "}.clearfix:after{clear:both}.center-block{display:block;margin-right:auto;margin-left:auto}.pull-right{float:right!important}.pull-left{float:left!important}.hide{display:none!important}.show{display:block!important}.invisible{visibility:hidden}.text-hide{font:0/0 a;color:transparent;text-shadow:none;background-color:transparent;border:0}.affix{position:fixed}@-ms-viewport{width:device-width}.hidden{display:none!important;visibility:hidden!important}.visible-xs,tr.visible-xs,th.visible-xs,td.visible-xs{display:none!important}@media(max-width:767px){.visible-xs{display:block!important}tr.visible-xs{display:table-row!important}th.visible-xs,td.visible-xs{display:table-cell!important}}@media(min-width:768px) and (max-width:991px){.visible-xs.visible-sm{display:block!important}tr.visible-xs.visible-sm{display:table-row!important}th.visible-xs.visible-sm,td.visible-xs.visible-sm{display:table-cell!important}}@media(min-width:992px) and (max-width:1199px){.visible-xs.visible-md{display:block!important}tr.visible-xs.visible-md{display:table-row!important}th.visible-xs.visible-md,td.visible-xs.visible-md{display:table-cell!important}}@media(min-width:1200px){.visible-xs.visible-lg{display:block!important}tr.visible-xs.visible-lg{display:table-row!important}th.visible-xs.visible-lg,td.visible-xs.visible-lg{display:table-cell!important}}.visible-sm,tr.visible-sm,th.visible-sm,td.visible-sm{display:none!important}@media(max-width:767px){.visible-sm.visible-xs{display:block!important}tr.visible-sm.visible-xs{display:table-row!important}th.visible-sm.visible-xs,td.visible-sm.visible-xs{display:table-cell!important}}@media(min-width:768px) and (max-width:991px){.visible-sm{display:block!important}tr.visible-sm{display:table-row!important}th.visible-sm,td.visible-sm{display:table-cell!important}}@media(min-width:992px) and (max-width:1199px){.visible-sm.visible-md{display:block!important}tr.visible-sm.visible-md{display:table-row!important}th.visible-sm.visible-md,td.visible-sm.visible-md{display:table-cell!important}}@media(min-width:1200px){.visible-sm.visible-lg{display:block!important}tr.visible-sm.visible-lg{display:table-row!important}th.visible-sm.visible-lg,td.visible-sm.visible-lg{display:table-cell!important}}.visible-md,tr.visible-md,th.visible-md,td.visible-md{display:none!important}@media(max-width:767px){.visible-md.visible-xs{display:block!important}tr.visible-md.visible-xs{display:table-row!important}th.visible-md.visible-xs,td.visible-md.visible-xs{display:table-cell!important}}@media(min-width:768px) and (max-width:991px){.visible-md.visible-sm{display:block!important}tr.visible-md.visible-sm{display:table-row!important}th.visible-md.visible-sm,td.visible-md.visible-sm{display:table-cell!important}}@media(min-width:992px) and (max-width:1199px){.visible-md{display:block!important}tr.visible-md{display:table-row!important}th.visible-md,td.visible-md{display:table-cell!important}}@media(min-width:1200px){.visible-md.visible-lg{display:block!important}tr.visible-md.visible-lg{display:table-row!important}th.visible-md.visible-lg,td.visible-md.visible-lg{display:table-cell!important}}.visible-lg,tr.visible-lg,th.visible-lg,td.visible-lg{display:none!important}@media(max-width:767px){.visible-lg.visible-xs{display:block!important}tr.visible-lg.visible-xs{display:table-row!important}th.visible-lg.visible-xs,td.visible-lg.visible-xs{display:table-cell!important}}@media(min-width:768px) and (max-width:991px){.visible-lg.visible-sm{display:block!important}tr.visible-lg.visible-sm{display:table-row!important}th.visible-lg.visible-sm,td.visible-lg.visible-sm{display:table-cell!important}}@media(min-width:992px) and (max-width:1199px){.visible-lg.visible-md{display:block!important}tr.visible-lg.visible-md{display:table-row!important}th.visible-lg.visible-md,td.visible-lg.visible-md{display:table-cell!important}}@media(min-width:1200px){.visible-lg{display:block!important}tr.visible-lg{display:table-row!important}th.visible-lg,td.visible-lg{display:table-cell!important}}.hidden-xs{display:block!important}tr.hidden-xs{display:table-row!important}th.hidden-xs,td.hidden-xs{display:table-cell!important}@media(max-width:767px){.hidden-xs,tr.hidden-xs,th.hidden-xs,td.hidden-xs{display:none!important}}@media(min-width:768px) and (max-width:991px){.hidden-xs.hidden-sm,tr.hidden-xs.hidden-sm,th.hidden-xs.hidden-sm,td.hidden-xs.hidden-sm{display:none!important}}@media(min-width:992px) and (max-width:1199px){.hidden-xs.hidden-md,tr.hidden-xs.hidden-md,th.hidden-xs.hidden-md,td.hidden-xs.hidden-md{display:none!important}}@media(min-width:1200px){.hidden-xs.hidden-lg,tr.hidden-xs.hidden-lg,th.hidden-xs.hidden-lg,td.hidden-xs.hidden-lg{display:none!important}}.hidden-sm{display:block!important}tr.hidden-sm{display:table-row!important}th.hidden-sm,td.hidden-sm{display:table-cell!important}@media(max-width:767px){.hidden-sm.hidden-xs,tr.hidden-sm.hidden-xs,th.hidden-sm.hidden-xs,td.hidden-sm.hidden-xs{display:none!important}}@media(min-width:768px) and (max-width:991px){.hidden-sm,tr.hidden-sm,th.hidden-sm,td.hidden-sm{display:none!important}}@media(min-width:992px) and (max-width:1199px){.hidden-sm.hidden-md,tr.hidden-sm.hidden-md,th.hidden-sm.hidden-md,td.hidden-sm.hidden-md{display:none!important}}@media(min-width:1200px){.hidden-sm.hidden-lg,tr.hidden-sm.hidden-lg,th.hidden-sm.hidden-lg,td.hidden-sm.hidden-lg{display:none!important}}.hidden-md{display:block!important}tr.hidden-md{display:table-row!important}th.hidden-md,td.hidden-md{display:table-cell!important}@media(max-width:767px){.hidden-md.hidden-xs,tr.hidden-md.hidden-xs,th.hidden-md.hidden-xs,td.hidden-md.hidden-xs{display:none!important}}@media(min-width:768px) and (max-width:991px){.hidden-md.hidden-sm,tr.hidden-md.hidden-sm,th.hidden-md.hidden-sm,td.hidden-md.hidden-sm{display:none!important}}@media(min-width:992px) and (max-width:1199px){.hidden-md,tr.hidden-md,th.hidden-md,td.hidden-md{display:none!important}}@media(min-width:1200px){.hidden-md.hidden-lg,tr.hidden-md.hidden-lg,th.hidden-md.hidden-lg,td.hidden-md.hidden-lg{display:none!important}}.hidden-lg{display:block!important}tr.hidden-lg{display:table-row!important}th.hidden-lg,td.hidden-lg{display:table-cell!important}@media(max-width:767px){.hidden-lg.hidden-xs,tr.hidden-lg.hidden-xs,th.hidden-lg.hidden-xs,td.hidden-lg.hidden-xs{display:none!important}}@media(min-width:768px) and (max-width:991px){.hidden-lg.hidden-sm,tr.hidden-lg.hidden-sm,th.hidden-lg.hidden-sm,td.hidden-lg.hidden-sm{display:none!important}}@media(min-width:992px) and (max-width:1199px){.hidden-lg.hidden-md,tr.hidden-lg.hidden-md,th.hidden-lg.hidden-md,td.hidden-lg.hidden-md{display:none!important}}@media(min-width:1200px){.hidden-lg,tr.hidden-lg,th.hidden-lg,td.hidden-lg{display:none!important}}.visible-print,tr.visible-print,th.visible-print,td.visible-print{display:none!important}@media print{.visible-print{display:block!important}tr.visible-print{display:table-row!important}th.visible-print,td.visible-print{display:table-cell!important}.hidden-print,tr.hidden-print,th.hidden-print,td.hidden-print{display:none!important}}body{background-attachment:fixed;background-image:none,-moz-linear-gradient(left,rgba(254,232,197,0.8) 0,rgba(254,232,197,0.95) 50%,rgba(254,232,197,0.8) 100%),url('http://www.westminsterigem.org/2013/img/bg.png');background-image:none,-webkit-gradient(linear,left top,right top,color-stop(0,rgba(254,232,197,0.8)),color-stop(50%,rgba(254,232,197,0.95)),color-stop(100%,rgba(254,232,197,0.8))),url('http://www.westminsterigem.org/2013/img/bg.png');background-image:none,-webkit-linear-gradient(left,rgba(254,232,197,0.8) 0,rgba(254,232,197,0.95) 50%,rgba(254,232,197,0.8) 100%),url('http://www.westminsterigem.org/2013/img/bg.png');background-image:none,-o-linear-gradient(left,rgba(254,232,197,0.8) 0,rgba(254,232,197,0.95) 50%,rgba(254,232,197,0.8) 100%),url('http://www.westminsterigem.org/2013/img/bg.png');background-image:none,-ms-linear-gradient(left,rgba(254,232,197,0.8) 0,rgba(254,232,197,0.95) 50%,rgba(254,232,197,0.8) 100%),url('http://www.westminsterigem.org/2013/img/bg.png');background-image:none,linear-gradient(to right,rgba(254,232,197,0.8) 0,rgba(254,232,197,0.95) 50%,rgba(254,232,197,0.8) 100%),url('http://www.westminsterigem.org/2013/img/bg.png');background-repeat:repeat}</div>Kcrk