Team:Washington/PRIMER DESIGN

From 2013.igem.org

(Difference between revisions)
(Created page with "==''''''== <html> <header> <b><u>Primer Design</u></b> </header> <body> <br> <br> <p> IDT’s <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Ana...")
(→')
 
(3 intermediate revisions not shown)
Line 1: Line 1:
 +
<html>
 +
 +
<style type="text/css">
 +
.firstHeading {                                                    /* Gets rid of the default iGEM picture*/
 +
    height:2px;
 +
    visibility:hidden;
 +
}
 +
#catlinks {
 +
    display: none;
 +
}
 +
#content {
 +
    border-left-width:0px;
 +
    border-right-width:0px;
 +
    padding: 0px 5px 0px 5px;
 +
    width:965px;                                                    /* Content width*/
 +
}
 +
#menubar {
 +
    background-color:  #FFFFFF;                              /* left menu bar color*/
 +
}
 +
#menubar ul li a {
 +
    color: #545353; }                                            /* menu text color*/
 +
    .right-menu li a {
 +
    color: red; 
 +
    background-color: #FFFFFF;                              /* right menu bar color*/
 +
}
 +
#p-logo { height 1px; overflow:hidden; display: none;
 +
}
 +
#top-section {     
 +
        background-position: center center;
 +
        background-repeat: no-repeat;
 +
        background-color: #FFFFFF;                        /* top header background color*/
 +
        border-width:0px;
 +
        height:10px;                        /* top header height (determines how low content will start to appear)*/
 +
}
 +
#siteSub {
 +
display:none;
 +
}
 +
#search-controls {                                                /* gets rid of the search bar (it was ugly) */
 +
display:none;
 +
margin-top:0px;
 +
}
 +
#contentSub {
 +
display:none;
 +
}
 +
 +
/*Now to set heading and body fonts*/
 +
body {
 +
background:#000000;
 +
background-image: url("https://static.igem.org/mediawiki/2012/1/1b/Gradientback.jpg");
 +
background-position: center;
 +
background-repeat: repeat-y;
 +
}               
 +
h1
 +
{
 +
color:#262626;
 +
text-align:left;
 +
font-family:"Trebuchet";
 +
font-size:25px;
 +
line-height:100%;
 +
border-bottom: none;
 +
padding:0px 0px 0px 0px; 
 +
margin: 0px 0px 0px 0px;
 +
}
 +
h2
 +
{
 +
color:#262626;
 +
text-align:left;
 +
font-family:"Trebuchet";
 +
font-size:20px;
 +
line-height: 100%;
 +
border-bottom: none; 
 +
padding:0px 0px 0px 0px; 
 +
margin: 0px 0px 0px 0x;
 +
}
 +
h3
 +
{
 +
color:#262626;
 +
text-align:left;
 +
font-family:"Trebuchet";
 +
font-size:17px;
 +
line-height: 100%;
 +
border-bottom: none; 
 +
padding:0px 0px 0px 0px; 
 +
margin: 0px 0px 0px 0x;
 +
}
 +
p
 +
{
 +
color:#262626;
 +
text-align: justify;
 +
font-family:"Arial";
 +
font-size:14px;
 +
line-height:100%
 +
border-bottom: none;
 +
padding:0px 0px 0px 0px; 
 +
margin: 0px 0px 0px 0x;
 +
border:0px
 +
}
 +
body {
 +
color:#808080;
 +
line-height: 1;
 +
font-family:"Arial";
 +
font-size:11px; 
 +
}
 +
 +
.whitebox {
 +
  -moz-box-shadow:  0px 0px 0px #ccc;
 +
  -webkit-box-shadow:  0px 0px 0px #ccc;
 +
  box-shadow:  0px 0px 15px #ccc;
 +
  background-color: #FFFFFF;
 +
  -moz-border-radius: 1px;
 +
  border-radius: 15px;
 +
  margin-top: 20px;
 +
  padding-top: 20px;
 +
  padding-left: 20px;
 +
  padding-right: 20px;
 +
  padding-bottom: 20px;
 +
  margin-left: 15px;
 +
  margin-right: 25px;
 +
}
 +
.thumbnail
 +
{
 +
margin-bottom:0px;
 +
padding-bottom:0px;
 +
position:relative;
 +
}
 +
 +
#igemuwmenu, #igemuwmenu ul {
 +
margin: 0;
 +
padding: 0;
 +
list-style: none;
 +
}
 +
 +
#igemuwmenu {
 +
width: 820px;
 +
margin: 10px auto;
 +
border: 1px solid #222;
 +
background-color: #111;
 +
background-image: -moz-linear-gradient(#444, #111);
 +
background-image: -webkit-gradient(linear, left top, left bottom, from(#444), to(#111));
 +
background-image: -webkit-linear-gradient(#444, #111);
 +
background-image: -o-linear-gradient(#444, #111);
 +
background-image: -ms-linear-gradient(#444, #111);
 +
background-image: linear-gradient(#444, #111);
 +
-moz-border-radius: 6px;
 +
-webkit-border-radius: 6px;
 +
border-radius: 6px;
 +
-moz-box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
-webkit-box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
                display: inline-block;
 +
                white-space: nowrap;
 +
}
 +
 +
#igemuwmenu:before,
 +
#igemuwmenu:after {
 +
content: "";
 +
display: table;
 +
}
 +
 +
#igemuwmenu:after {
 +
clear: both;
 +
}
 +
 +
#igemuwmenu {
 +
zoom:1;
 +
}
 +
 +
#igemuwmenu li {
 +
border-right: 1px solid #222;
 +
-moz-box-shadow: 1px 0 0 #444;
 +
-webkit-box-shadow: 1px 0 0 #444;
 +
box-shadow: 1px 0 0 #444;
 +
position: relative;
 +
                display: inline-block;
 +
                white-space: nowrap;
 +
}
 +
 +
#igemuwmenu a {
 +
padding: 12px 20px;
 +
color: #999;
 +
text-transform: uppercase;
 +
font: bold 11.4px Arial, Helvetica;
 +
text-decoration: none;
 +
text-shadow: 0 1px 0 #000;
 +
                display: inline-block;
 +
                white-block: nowrap;
 +
}
 +
       
 +
    #igemuwmenu li:hover > a {
 +
color: #fafafa;
 +
}
 +
 +
*html #igemuwmenu li a:hover { /* IE6 only */
 +
color: #fafafa;
 +
}
 +
 +
#igemuwmenu ul {
 +
margin: 20px 0 0 0;
 +
_margin: 0; /*IE6 only*/
 +
opacity: 0;
 +
visibility: hidden;
 +
position: absolute;
 +
top: 38px;
 +
left: 0;
 +
z-index: 1;   
 +
background: #444;
 +
background: -moz-linear-gradient(#444, #111);
 +
background-image: -webkit-gradient(linear, left top, left bottom, from(#444), to(#111));
 +
background: -webkit-linear-gradient(#444, #111);   
 +
background: -o-linear-gradient(#444, #111);
 +
background: -ms-linear-gradient(#444, #111);
 +
background: linear-gradient(#444, #111);
 +
-moz-box-shadow: 0 -1px rgba(255,255,255,.3);
 +
-webkit-box-shadow: 0 -1px 0 rgba(255,255,255,.3);
 +
box-shadow: 0 -1px 0 rgba(255,255,255,.3);
 +
-moz-border-radius: 3px;
 +
-webkit-border-radius: 3px;
 +
border-radius: 3px;
 +
-webkit-transition: all .2s ease-in-out;
 +
-moz-transition: all .2s ease-in-out;
 +
-ms-transition: all .2s ease-in-out;
 +
-o-transition: all .2s ease-in-out;
 +
transition: all .2s ease-in-out; 
 +
}
 +
 +
#igemuwmenu li:hover > ul {
 +
opacity: 1;
 +
visibility: visible;
 +
margin: 0;
 +
}
 +
 +
#igemuwmenu ul ul {
 +
top: 0;
 +
left: 150px;
 +
margin: 0 0 0 20px;
 +
_margin: 0; /*IE6 only*/
 +
-moz-box-shadow: -1px 0 0 rgba(255,255,255,.3);
 +
-webkit-box-shadow: -1px 0 0 rgba(255,255,255,.3);
 +
box-shadow: -1px 0 0 rgba(255,255,255,.3);
 +
}
 +
 +
#igemuwmenu ul li {
 +
float: none;
 +
display: block;
 +
border: 0;
 +
_line-height: 0; /*IE6 only*/
 +
-moz-box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
-webkit-box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
}
 +
#igemuwmenu ul li.active {
 +
float: none;
 +
display: block;
 +
border: 0;
 +
_line-height: 0; /*IE6 only*/
 +
-moz-box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
-webkit-box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
box-shadow: 0 1px 0 #111, 0 2px 0 #666;
 +
}
 +
 +
 +
#igemuwmenu ul li:last-child { 
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;   
 +
}
 +
 +
#igemuwmenu ul a {   
 +
padding: 10px;
 +
width: 130px;
 +
_height: 10px; /*IE6 only*/
 +
display: block;
 +
white-space: nowrap;
 +
float: none;
 +
text-transform: none;
 +
}
 +
     
 +
        #igemuwmenu ul a.selected {   
 +
padding: 10px;
 +
width: 130px;
 +
_height: 10px; /*IE6 only*/
 +
display: block;
 +
white-space: nowrap;
 +
float: none;
 +
text-transform: none;
 +
}
 +
 +
#igemuwmenu ul a:hover {
 +
background-color: #785D84;
 +
background-image: -moz-linear-gradient(#B6A0BA,  #785D84);
 +
background-image: -webkit-gradient(linear, left top, left bottom, from(#B6A0BA), to(#785D84));
 +
background-image: -webkit-linear-gradient(#B6A0BA, #785D84);
 +
background-image: -o-linear-gradient(#B6A0BA, #785D84);
 +
background-image: -ms-linear-gradient(#B6A0BA, #785D84);
 +
background-image: linear-gradient(#B6A0BA, #785D84);
 +
}
 +
 +
#igemuwmenu ul li:first-child > a {
 +
-moz-border-radius: 3px 3px 0 0;
 +
-webkit-border-radius: 3px 3px 0 0;
 +
border-radius: 3px 3px 0 0;
 +
}
 +
 +
#igemuwmenu ul li:first-child > a:after {
 +
content: '';
 +
position: absolute;
 +
left: 40px;
 +
top: -6px;
 +
border-left: 6px solid transparent;
 +
border-right: 6px solid transparent;
 +
border-bottom: 6px solid #444;
 +
}
 +
 +
#igemuwmenu ul ul li:first-child a:after {
 +
left: -6px;
 +
top: 50%;
 +
margin-top: -6px;
 +
border-left: 0;
 +
border-bottom: 6px solid transparent;
 +
border-top: 6px solid transparent;
 +
border-right: 6px solid #3b3b3b;
 +
}
 +
 +
#igemuwmenu ul li:first-child a:hover:after {
 +
border-bottom-color: #B6A0BA;
 +
}
 +
 +
#igemuwmenu ul ul li:first-child a:hover:after {
 +
border-right-color: #0299d3;
 +
border-bottom-color: transparent;
 +
}
 +
 +
#igemuwmenu ul li:last-child > a {
 +
-moz-border-radius: 0 0 3px 3px;
 +
-webkit-border-radius: 0 0 3px 3px;
 +
border-radius: 0 0 3px 3px;
 +
}
 +
 +
/* Mobile */
 +
#igemuwmenu-trigger {
 +
display: none;
 +
}
 +
 +
@media screen and (max-width: 600px) {
 +
 +
/* nav-wrap */
 +
#igemuwmenu-wrap {
 +
position: relative;
 +
}
 +
 +
#igemuwmenu-wrap * {
 +
-moz-box-sizing: border-box;
 +
-webkit-box-sizing: border-box;
 +
box-sizing: border-box;
 +
}
 +
 +
/* menu icon */
 +
#igemuwmenu-trigger {
 +
display: block; /* show menu icon */
 +
height: 40px;
 +
line-height: 40px;
 +
cursor: pointer;
 +
padding: 0 0 0 35px;
 +
border: 1px solid #222;
 +
color: #fafafa;
 +
font-weight: bold;
 +
background-color: #111;
 +
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABIAAAAPCAMAAADeWG8gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyBpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMC1jMDYwIDYxLjEzNDc3NywgMjAxMC8wMi8xMi0xNzozMjowMCAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNSBXaW5kb3dzIiB4bXBNTTpJbnN0YW5jZUlEPSJ4bXAuaWlkOjE2QjAxNjRDOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3IiB4bXBNTTpEb2N1bWVudElEPSJ4bXAuZGlkOjE2QjAxNjREOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3Ij4gPHhtcE1NOkRlcml2ZWRGcm9tIHN0UmVmOmluc3RhbmNlSUQ9InhtcC5paWQ6MTZCMDE2NEE5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciIHN0UmVmOmRvY3VtZW50SUQ9InhtcC5kaWQ6MTZCMDE2NEI5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciLz4gPC9yZGY6RGVzY3JpcHRpb24+IDwvcmRmOlJERj4gPC94OnhtcG1ldGE+IDw/eHBhY2tldCBlbmQ9InIiPz42AEtnAAAABlBMVEX///////9VfPVsAAAAAnRSTlP/AOW3MEoAAAAWSURBVHjaYmAgFzBiACKFho6NAAEGAD07AG1pn932AAAAAElFTkSuQmCC) no-repeat 10px center, -moz-linear-gradient(#444, #111);
 +
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABIAAAAPCAMAAADeWG8gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyBpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMC1jMDYwIDYxLjEzNDc3NywgMjAxMC8wMi8xMi0xNzozMjowMCAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNSBXaW5kb3dzIiB4bXBNTTpJbnN0YW5jZUlEPSJ4bXAuaWlkOjE2QjAxNjRDOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3IiB4bXBNTTpEb2N1bWVudElEPSJ4bXAuZGlkOjE2QjAxNjREOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3Ij4gPHhtcE1NOkRlcml2ZWRGcm9tIHN0UmVmOmluc3RhbmNlSUQ9InhtcC5paWQ6MTZCMDE2NEE5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciIHN0UmVmOmRvY3VtZW50SUQ9InhtcC5kaWQ6MTZCMDE2NEI5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciLz4gPC9yZGY6RGVzY3JpcHRpb24+IDwvcmRmOlJERj4gPC94OnhtcG1ldGE+IDw/eHBhY2tldCBlbmQ9InIiPz42AEtnAAAABlBMVEX///////9VfPVsAAAAAnRSTlP/AOW3MEoAAAAWSURBVHjaYmAgFzBiACKFho6NAAEGAD07AG1pn932AAAAAElFTkSuQmCC) no-repeat 10px center, -webkit-linear-gradient(#444, #111);
 +
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABIAAAAPCAMAAADeWG8gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyBpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMC1jMDYwIDYxLjEzNDc3NywgMjAxMC8wMi8xMi0xNzozMjowMCAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNSBXaW5kb3dzIiB4bXBNTTpJbnN0YW5jZUlEPSJ4bXAuaWlkOjE2QjAxNjRDOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3IiB4bXBNTTpEb2N1bWVudElEPSJ4bXAuZGlkOjE2QjAxNjREOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3Ij4gPHhtcE1NOkRlcml2ZWRGcm9tIHN0UmVmOmluc3RhbmNlSUQ9InhtcC5paWQ6MTZCMDE2NEE5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciIHN0UmVmOmRvY3VtZW50SUQ9InhtcC5kaWQ6MTZCMDE2NEI5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciLz4gPC9yZGY6RGVzY3JpcHRpb24+IDwvcmRmOlJERj4gPC94OnhtcG1ldGE+IDw/eHBhY2tldCBlbmQ9InIiPz42AEtnAAAABlBMVEX///////9VfPVsAAAAAnRSTlP/AOW3MEoAAAAWSURBVHjaYmAgFzBiACKFho6NAAEGAD07AG1pn932AAAAAElFTkSuQmCC) no-repeat 10px center, -o-linear-gradient(#444, #111);
 +
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABIAAAAPCAMAAADeWG8gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyBpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMC1jMDYwIDYxLjEzNDc3NywgMjAxMC8wMi8xMi0xNzozMjowMCAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNSBXaW5kb3dzIiB4bXBNTTpJbnN0YW5jZUlEPSJ4bXAuaWlkOjE2QjAxNjRDOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3IiB4bXBNTTpEb2N1bWVudElEPSJ4bXAuZGlkOjE2QjAxNjREOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3Ij4gPHhtcE1NOkRlcml2ZWRGcm9tIHN0UmVmOmluc3RhbmNlSUQ9InhtcC5paWQ6MTZCMDE2NEE5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciIHN0UmVmOmRvY3VtZW50SUQ9InhtcC5kaWQ6MTZCMDE2NEI5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciLz4gPC9yZGY6RGVzY3JpcHRpb24+IDwvcmRmOlJERj4gPC94OnhtcG1ldGE+IDw/eHBhY2tldCBlbmQ9InIiPz42AEtnAAAABlBMVEX///////9VfPVsAAAAAnRSTlP/AOW3MEoAAAAWSURBVHjaYmAgFzBiACKFho6NAAEGAD07AG1pn932AAAAAElFTkSuQmCC) no-repeat 10px center, -ms-linear-gradient(#444, #111);
 +
background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABIAAAAPCAMAAADeWG8gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyBpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuMC1jMDYwIDYxLjEzNDc3NywgMjAxMC8wMi8xMi0xNzozMjowMCAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENTNSBXaW5kb3dzIiB4bXBNTTpJbnN0YW5jZUlEPSJ4bXAuaWlkOjE2QjAxNjRDOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3IiB4bXBNTTpEb2N1bWVudElEPSJ4bXAuZGlkOjE2QjAxNjREOUNEOTExRTE4RTNFRkI1RDQ2MUYxOTQ3Ij4gPHhtcE1NOkRlcml2ZWRGcm9tIHN0UmVmOmluc3RhbmNlSUQ9InhtcC5paWQ6MTZCMDE2NEE5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciIHN0UmVmOmRvY3VtZW50SUQ9InhtcC5kaWQ6MTZCMDE2NEI5Q0Q5MTFFMThFM0VGQjVENDYxRjE5NDciLz4gPC9yZGY6RGVzY3JpcHRpb24+IDwvcmRmOlJERj4gPC94OnhtcG1ldGE+IDw/eHBhY2tldCBlbmQ9InIiPz42AEtnAAAABlBMVEX///////9VfPVsAAAAAnRSTlP/AOW3MEoAAAAWSURBVHjaYmAgFzBiACKFho6NAAEGAD07AG1pn932AAAAAElFTkSuQmCC) no-repeat 10px center, linear-gradient(#444, #111);
 +
-moz-border-radius: 6px;
 +
-webkit-border-radius: 6px;
 +
border-radius: 6px;
 +
-moz-box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
-webkit-box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
box-shadow: 0 1px 1px #777, 0 1px 0 #666 inset;
 +
}
 +
 +
/* main nav */
 +
#igemuwmenu {
 +
margin: 0; padding: 10px;
 +
position: absolute;
 +
top: 40px;
 +
width: 100%;
 +
z-index: 1;
 +
background-color: #444;
 +
display: none;
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;
 +
}
 +
 +
#igemuwmenu:after {
 +
content: '';
 +
position: absolute;
 +
left: 25px;
 +
top: -8px;
 +
border-left: 8px solid transparent;
 +
border-right: 8px solid transparent;
 +
border-bottom: 8px solid #444;
 +
}
 +
 +
#igemuwmenu ul {
 +
position: static;
 +
visibility: visible;
 +
opacity: 1;
 +
margin: 0;
 +
background: none;
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;
 +
}
 +
 +
#igemuwmenu ul ul {
 +
margin: 0 0 0 20px !important;
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;
 +
}
 +
 +
#igemuwmenu li {
 +
position: static;
 +
display: block;
 +
float: none;
 +
border: 0;
 +
margin: 5px;
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;
 +
}
 +
 +
#igemuwmenu ul li{
 +
margin-left: 20px;
 +
-moz-box-shadow: none;
 +
-webkit-box-shadow: none;
 +
box-shadow: none;
 +
}
 +
 +
#igemuwmenu a{
 +
display: block;
 +
float: none;
 +
padding: 0;
 +
color: #999;
 +
}
 +
 +
#igemuwmenu a:hover{
 +
color: #fafafa;
 +
}
 +
 +
#igemuwmenu ul a{
 +
padding: 0;
 +
width: auto;
 +
}
 +
 +
#igemuwmenu ul a:hover{
 +
background: none;
 +
}
 +
 +
#igemuwmenu ul li:first-child a:after,
 +
#igemuwmenu ul ul li:first-child a:after {
 +
border: 0;
 +
}
 +
 +
}
 +
 +
@media screen and (min-width: 600px) {
 +
#igemuwmenu {
 +
display: block !important;
 +
}
 +
}
 +
 +
/* iPad */
 +
.no-transition {
 +
-webkit-transition: none;
 +
-moz-transition: none;
 +
-ms-transition: none;
 +
-o-transition: none;
 +
transition: none;
 +
opacity: 1;
 +
visibility: visible;
 +
display: none; 
 +
}
 +
 +
#igemuwmenu li:hover > .no-transition {
 +
display: block;
 +
}
 +
 +
</style>
 +
 +
<a href="https://2013.igem.org/Team:Washington"><img class="thumbnail"  src='https://static.igem.org/mediawiki/2013/1/1b/Team_Washington2013_banner_final.jpg' width= "965"/></A>
 +
 +
<a href="http://www.washington.edu/"><img src='https://static.igem.org/mediawiki/2012/2/25/UW_W-Logo_smallRGB.jpg' align="left" width= "57" style="padding-top: 12px; padding-left: 5px;"/></a>
 +
 +
<a href="https://2012.igem.org/Main_Page"><img src='https://static.igem.org/mediawiki/igem.org/c/c8/IGEM_desat.png' align="right" width= "70"/></a>
 +
 +
<style type="text/css">
 +
#content {z-index:4;}
 +
.expand {background: url('https://static.igem.org/mediawiki/2008/e/ef/Icon-expand.png') no-repeat 95% 50%;}
 +
.collapse {background: url('https://static.igem.org/mediawiki/2008/c/cd/Icon-collapse.png') no-repeat 95% 50%;}
 +
.docked {background: #99ccff url("https://static.igem.org/mediawiki/2008/6/62/Ddnavundock.png") no-repeat 50% 50%;}
 +
.undocked {background: #99ccff url("https://static.igem.org/mediawiki/2008/e/e4/Ddnavdock.png") no-repeat 50% 50%;}
 +
</style>
 +
 +
<nav id="igemuwmenu-wrap">   
 +
 +
<ul id="igemuwmenu">
 +
 +
<li><a href="https://2013.igem.org/Team:Washington">Home</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington">UW 2013</a></li>
 +
<li><a href="https://2012.igem.org/Team:Washington">UW 2012</a></li>
 +
<li><a href="https://2011.igem.org/Team:Washington">UW 2011</a></li>
 +
<li><a href="https://2010.igem.org/Team:Washington">UW 2010</a></li>
 +
<li><a href="https://2009.igem.org/Team:Washington">UW 2009</a></li>
 +
<li><a href="https://2008.igem.org/Team:University_of_Washington">UW 2008</a></li>
 +
<li><a href="https://2013.igem.org/Main_Page">iGEM Homepage</a></li>
 +
</ul>
 +
</li>
 +
 +
<!--
 +
<li>
 +
<a </a> main menu on plastic degradation
 +
<ul>
 +
 +
for the drop down of plastic degradation
 +
format <li><a href="https://2012.igem.org/Team:Washington/Plastics#Background">Background</a></li>
 +
 +
 +
</ul>
 +
</li>
 +
-->
 +
 +
 +
<li>
 +
<a href="https://2013.igem.org/Team:Washington/LightSensing">Light Sensing Experiments</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Background">Background</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Cloning">Cloning</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Systems">Our Systems</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Methods">Methods</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Results">Results</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Sources">Scientific Sources</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Future">Future Plans</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/LightSensing#Parts">Parts Submitted</a></li>
 +
</ul>
 +
</li>
 +
 +
 +
<li>
 +
<a href="https://2013.igem.org/Team:Washington/ECOLIGHTTUNE">e.colightTune</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington/ECOLIGHTTUNE#Background">Background</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/ECOLIGHTTUNE#Usage">App</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/ECOLIGHTTUNE#Benefits">Methods</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/ECOLIGHTTUNE#Results">Results Summary</a></li>
 +
</ul>
 +
</li>
 +
 +
<li>
 +
<a href="https://2013.igem.org/Team:Washington/Outreach">Outreach</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington/Outreach#Activities">Activities</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/Outreach#Pictures">Pictures</a></li>
 +
</ul>
 +
</li>
 +
 +
<li>
 +
<a href="https://2013.igem.org/Team:Washington/Protocols">Protocols</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington/Protocols#General_Protocols">General</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/Protocols#Cloning_Protocols">Cloning</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/Protocols#Assay">Light assays</a></li>
 +
</ul>
 +
</li>
 +
 +
<li>
 +
<a href="https://2013.igem.org/Team:Washington/MoreLinks">Links</a>
 +
<ul>
 +
<li><a href="https://2013.igem.org/Team:Washington/MoreLinks#Safety">Safety Form</a></li>
 +
<li><a href="http://parts.igem.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2012&group=Washington">Parts Registry</a></li>
 +
<li><a href="https://2013.igem.org/Team:Washington/MoreLinks#Documentation">Parts Documentation</a></li>
 +
 +
</ul>
 +
</li>
 +
 +
<li style="border-right:0; box-shadow:0px 0 0;">
 +
<a href="https://2013.igem.org/Team:Washington/Funding">Funding</a>
 +
</li>
 +
 +
</li>
 +
                                                                                               
 +
</ul>
 +
</nav>
 +
 +
<script type="text/javascript" src="http://code.jquery.com/jquery-latest.min.js"></script>
 +
<script type="text/javascript">
 +
    $(function() {
 +
if ($.browser.msie && $.browser.version.substr(0,1)<7)
 +
{
 +
$('li').has('ul').mouseover(function(){
 +
$(this).children('ul').css('visibility','visible');
 +
}).mouseout(function(){
 +
$(this).children('ul').css('visibility','hidden');
 +
})
 +
}
 +
 +
/* Mobile */
 +
$('#igemuwmenu-wrap').prepend('<div id="igemuwmenu-trigger">igemuwmenu</div>');
 +
$("#igemuwmenu-trigger").on("click", function(){
 +
$("#menu").slideToggle();
 +
});
 +
 +
// iPad
 +
var isiPad = navigator.userAgent.match(/iPad/i) != null;
 +
if (isiPad) $('#igemuwmenu ul').addClass('no-transition');     
 +
    });
 +
// selection
 +
 +
</script>
 +
 +
<script type="text/javascript">
 +
        $("#content").find("a[href='"+location.href+"']").each(function(){
 +
        $(this).find("a").addClass("selected")
 +
        })
 +
</script>
 +
 +
<script type="text/javascript">
 +
 +
  var _gaq = _gaq || [];
 +
  _gaq.push(['_setAccount', 'UA-26265208-1']);
 +
  _gaq.push(['_trackPageview']);
 +
 +
  (function() {
 +
    var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;
 +
    ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';
 +
    var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);
 +
  })();
 +
 +
</script>
 +
</html>
 +
 +
==''''''==
==''''''==
Line 8: Line 652:
<body>
<body>
-
<br>
 
-
<br>
 
<p>
<p>
IDT’s  
IDT’s  
Line 19: Line 661:
<a href = "http://www.youtube.com/watch?v=tUyBwiyMsSU/">Primer Design for PCR</a><br>
<a href = "http://www.youtube.com/watch?v=tUyBwiyMsSU/">Primer Design for PCR</a><br>
</p>
</p>
-
<br>
+
 
-
<br>
+
<b>General Guidelines:</b>
<b>General Guidelines:</b>
<br>
<br>
-
<a href = "http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html/">PCR Primer Design Guidelines</a><br>
+
<a href = "http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html">PCR Primer Design Guidelines</a><br>
 +
<br>
 +
<br>
<b>Primer Design</b>
<b>Primer Design</b>
-
 
+
<br>
<u>Forward Primer:</u><br>
<u>Forward Primer:</u><br>
Line 34: Line 677:
<br>
<br>
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed)
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed)
 +
<br>
<u>Reverse primer:</u><br>
<u>Reverse primer:</u><br>
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence
Line 43: Line 687:
<b>General notes:</b>
<b>General notes:</b>
 +
<br>
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com”
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com”
<br>
<br>
Line 49: Line 694:
- The primer should end on an G/C for stability
- The primer should end on an G/C for stability
-
<br>When possible use the <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Analyzer</a> or<a href = "http://www.thermoscientificbio.com/webtools/multipleprimer/">Multiple primer analyzer</a> (ignore Tms):
+
<br>When possible use the <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Analyzer</a> or <a href = "http://www.thermoscientificbio.com/webtools/multipleprimer/">Multiple primer analyzer</a> (ignore Tms):
<br>
<br>
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <b><u><-2.0</u></b>  add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore.
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <b><u><-2.0</u></b>  add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore.

Latest revision as of 23:53, 14 September 2013


'

Primer Design

IDT’s Oligo Analyzer

Finnezymes Multiple primer analyzer
Tyler’s primer design video- Primer Design for PCR

General Guidelines:
PCR Primer Design Guidelines


Primer Design
Forward Primer:
Take the beginning of the 18~35 bases of your targeted sequence according to the melting temperature for the gene primer bind to the plasmid you want to transform into. Tms should be around 58*C to match VF2 and VR primers, unless making “hanging primers” by adding the prefix and suffix for cloning - these Tms can be a bit lower to make the combined oligo shorter.
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed)
Reverse primer:
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence
Then reverse complement the whole thing (end of the 20 bases + suffix). Both primers must be listed 5’->3’ for ordering format purposes.

General notes:
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com”
- The primer has to be at least 18 base pairs long ( NO LESS )
- The primer should end on an G/C for stability
When possible use the Oligo Analyzer or Multiple primer analyzer (ignore Tms):
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <-2.0 add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore.
Using Ape:
- The highlighted region that you will use for primers will show “Tm” = mel temps. It should be between 40-50 degrees (THIS HAS MORE PRIORITY THAN THE delta G)

*the prefix and the suffix can be found in the following website:
http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix
(use the prefix for the non-inframe cloning, i.e. the longer one)
*match the melting temperature of forward and reverse primer
*A good way to check whether you design the primer correctly is used “find” (control +F) on a new plasmid file you construct by inserting the segment between the prefix and suffix.

Retrieved from "http://2013.igem.org/Team:Washington/PRIMER_DESIGN"