Team:Heidelberg/Templates/DelH overview16
From 2013.igem.org
Vector Maps and Primers
1st Strategy: DelH & pSB6A1 without mRFP

Vector map of the PHM04-DelH-pSB6A1(without mRFP) Gibson plasmid.
Identifier | Order date | Note | Sequence |
---|---|---|---|
HM17:DelH_Terminator_BB_fw | 16-08-2013 | Amplification of Backbone pSb6A1-lacI-mRFP | ATTGGCGCTGGAGTACGCGCTGGACTGA aggcatcaaataaaacgaaaggctcag |
2nd Strategy: DelH & Tetracycline Resistance & pSB6A1 without mRFP

Vector map of the PHM05-DelH-tetR-pSB6A1 Gibson plasmid.
Identifier | Order date | Note | Sequence |
---|---|---|---|
HM14:DelH_tetR_fw | 2013-08-16 | Gibson-Primer DelH-tetR: amplifies the tetracycline resistance from the pSB1T3 Backbone and creates an overlap to the end of DelH | ATTGGCGCTGGAGTACGCGCTGGACTGA atgaagttttaaatcaatctaaag |
HM15:tetR_stop_BB_rev | 2013-08-16 | Gibson-Primer tetR-pSB6A1: amplifies the tetracycline resistance and creates an overlap with the Terminator of the Backbone pSB6A1 | Cgactgagcctttcgttttatttgatgcctggc ctcgtgatacgcctatttttatagg |
HM16:tetR_pSB6A1_fw | 2013-08-16 | Gibson-Primer DelH, amplifies the Backbone pSB6A1 creating an overlap with the tetracycline resistance | Aaaaataggcgtatcacgag gccaggcatcaaataaaacgaaaggctcag |
Additional Screening Primer
Identifier | Order date | Note | Sequence |
---|---|---|---|
HM13:Screen_DelH_end_fw | 2013-08-16 | New screening primer for the end of DelH together with the VR2 primer from the registry | TTTCTGACGACCCTGCACCTGAAG |