Team:Bielefeld-Germany/Labjournal/June

{{Team:Bielefeld-Germany/Header2}}
{{Team:Bielefeld-Germany/css/header_cleanup.css}}
{{Team:Bielefeld-Germany/JournalNav2}}

__NOTOC__

<html>
<head>

<script>

</script>
</head>


<style>
h1{padding:10px 350px;}
.toc, #toc{width:230px;}
</style>
</html>

<div id=globalwrapper style="padding-left:20px; padding-right:20px">
<div id="leftcol" style="width:750px; float:left; overflow:auto;">
<html>
<h1>June</h1>
</html>


===Milestones===
<br><br><br><br>








===Week 5===


====Organization====
*iGEM-Team Bielefeld will support the ‘CeBiTec Student Academy’ from 26.-30. August with an own experiment.


====MFC====


====Mediators====


====Porines====
*Primerdesign for isolation of OprF from ''Pseudomonas fluorescens'' strain, with overlaps for Biobrick Prefix and Suffix:
*Forward Primer OprF (49 bp): GAATTCGCGGCCGCTTCTAGATGAAACTGAAAAACACCTTGGGCTTTGC
*Reverse Primer OprF (51 bp): CTGCAGCGGCCGCTACTAGTATTACTTAGCTTGGGCTTCAACCTGCGCTTC


===Week 6===


====Organization====
*Thanks to NEB Biolabs for the [http://www.neb-online.de/index.php/en/neb-announcements/231-igem-2013 free iGEM kit] with many useful laboratory things for all German iGEM teams.
*We are working on our first press release.
*Having a short radio contribution in the Bielefeld university campus radio ([http://www.radiohertz.de/beta-site radio 87.9 hertz]).


====MFC====


====Mediators====
*Glycerol dehydrogenase
**Isolation of shipping vector pSB1C3 out of 2013 Distribution Kit Plate 5 Well 3A with insert Part RFP (<bbpart>J04450</bbpart>) for better transformation characterization ([http://parts.igem.org/Help:2013_DNA_Distribution Distribution Kit BioBrick isolation]). 
**[[Team:Bielefeld-Germany/Labjournal/Molecular#Transformation via electroporation| Transformation]] of <partinfo>BBa_J04450</partinfo> into ''Escherichia coli'' KRX strain.
**[[Team:Bielefeld-Germany/Labjournal/Molecular#Used Kits | Plasmid isolation]] of <partinfo>BBa_J04450</partinfo>.



===Week 7===


====MFC====


====Mediators====


====Cytochromes====


*Cultivation of Shewanella oneidensis MR-1 in liquid LB medium at 30 °C

*Isolation of genomic DNA from S. oneidensis
**4-2006-451: Conc.:453.1 ng/µl    OD260/280: 1.92    OD260/230:2.78
**4-2006-452: Conc.:447.1 ng/µl    OD260/280: 1.92    OD260/230:2.67
**Dilution to PCR template: 4-2006-453: 5.5ng/µl


*Amplification of the mtrCAB cluster
**Gradient: 55.8-56.7-57.8-59.1-60.4-61.7-62.9-63.9
**Clear Bands at the expected 5.2kb


*PCR-CleanUp
**PCR-cleanup of No.2 and No.5 with Macherey-Nagel-Kit and NanoDrop-Measurement
**Lane2: 4-2106-451: 7.4 ng/µl
**Lane5: 4-2106-451: 8.5 ng/µl


====Porines====
*Starting first cultivation of ''Pseudomonas fluorescens'' strain for [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation | complete genome isolation]].
*Successful [[Team:Bielefeld-Germany/Labjournal/Molecular#Whole Genome Isolation | genome isolation]] of ''Pseudomonas fluorescens''. 
*Successful PCR with Forward and Reverse Primer OprF on the OprF gene of ''Pseudomonas fluorescens'' strain.


[[Image:IGEM_Bielefeld_Standard_Phusion_PCR_Master_MixLRO.jpg|300px|thumb|left|<p align="justify"> '''Table 1: Standard Phusion PCR Master Mix. '''</p>]]
[[Image:IGEM_Bielefeld_Standard_Phu_PCR_GldA_OprF.jpg|300px|thumb|center| <p align="justify">'''Table 2: Two step standard Phusion PCR programm for GldA amplification. '''</p>]]


*OprF PCR product was isolated by Agarose gel electrophorese and [[Team:Bielefeld-Germany/Labjournal/Molecular#Used Kits | purificated]].
*Bands are at expected size of 1300 bp.


[[Image:IGEM_Bielefeld_OprF_standard_PCR.jpg|200px|thumb|left| <p align="justify">'''Figure 1: Agarosegel from PCR on the OprF gene of ''Pseudomonas fluorescens'' strain with forward and reverse primer OprF. For Ladder we used [http://www.thermoscientificbio.com/nucleic-acid-electrophoresis/generuler-1-kb-dna-ladder-ready-to-use-250-to-10000-bp GeneRuler™ 1 kb DNA Ladder fromThermo Scientific].  '''</p>]]


<br><br><br><br>
<br><br><br><br>
<br><br><br><br>
<br><br><br><br>
<br><br><br><br>
<br><br><br><br>

===Week 8===


====Organization====
*Let’s go to Lyon, flights are booked for the [https://2013.igem.org/Europe/Pre-Jamboree European jamboree in Lyon] from 11.-13. October 2013.
*We will participate at ‘[http://www.bio.nrw.de/studentconvention BioNRW pHD Student Convention]’ in Düsseldorf at 13. July.


====MFC====


====Mediators====
*Glycerol dehydrogenase
**Cloning of GldA into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB Biobrick Assembly Kit | NEB Biobrick assembly Kit]] did not work as expected.
**Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and Plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows religated pSB1C3 shipping vector.
**Bands are at size of 2000 bp, the length of linear pSB1C3.


[[Image:IGEM_Bielefeld_Religierter_pSB1C3_restriktion.jpg|200px|thumb|left| <p align="justify">'''Figure 2: Agarosegel with [https://www.neb.com/products/n3232-1-kb-dna-ladder NEB 1 kb DNA Ladder] as marker. Bands are showing [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] from cloning of GldA into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB Biobrick Assembly Kit | NEB Biobrick assembly Kit]]. Assembly did not work, only one band at the size of 2000 bp showing religated pSB1C3. '''</p>]]


**Primerdesign for pSB1C3 according an universal usable backbone for [[Team:Bielefeld-Germany/Labjournal/Molecular#Gibson assembly | Gibson Assembly]] with Prefix and Suffix specific overlaps:
***Forward Primer pSB1C3 (23 bp): TACTAGTAGCGGCCGCTGCAGTC
***Reverse Primer pSB1C3 (23 bp): CTCTAGAAGCGGCCGCGAATTCC


====Porines====
*Cloning of OprF into pSB1C3 shipping vector with [[Team:Bielefeld-Germany/Labjournal/Molecular#NEB Biobrick Assembly Kit | NEB Biobrick assembly Kit]] did not work as expected.
*Screening of colonies with [[Team:Bielefeld-Germany/Labjournal/Molecular#Colony PCR | colony PCR]] and Plasmid [[Team:Bielefeld-Germany/Labjournal/Molecular#Restriction analysis | restriction analysis]] shows religated pSB1C3 shipping vector as described for GldA cloning.





<br><br><br><br>
<br><br><br><br>
</div>

<div id="rightcol" style="width:210px; height:450px; margin-left:752px; margin-top:-60px; float:right; position:fixed; overflow-y:scroll;    box-shadow:0px 0px 2px 0px grey;" padding:0px 20px;>
__TOC__
<div id="spacer" style="height:300px"></div>
</div>

</div>