Team:UNITN-Trento/Protocols

__NOTOC__

{{:Team:UNITN-Trento/Templates/Default|<html>

<!--CSS-->
<link rel="stylesheet" href="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/CSS/Protocols&action=raw&ctype=text/css" type="text/css" />

<!--JS-->
<script src="https://2013.igem.org/wiki/index.php?title=team:UNITN-Trento/JS/Protocols&action=raw&ctype=text/javascript"></script>

<!--Protocol page-->
<div class="container">
	<div class="sheet"></html>

	<h2>PCRs</h2>

	<html><a href="https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator">Tm Calculator (1)</a><br/>
	<a href="http://eu.idtdna.com/analyzer/applications/oligoanalyzer/">Tm Calculator (2)</a></html>

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|RBC Taq DNA Polymerase Protocol V2.0|<html>
		The optimal conditions for the concentration of RBC Taq DNA Polymerase, MgCl2, primers and template DNA will depend on the system being utilized. It may be necessary to determine the optimal conditions for each individual component.<br/>
		<br/>
		1) Add the following components to a sterile microtube on ice:<br/>
		<table>
			<tr>
				<th>Components</th>
				<th>Volume</th>
				<th>Final Concentration</th>
			</tr>
			<tr>
				<td>10X Reaction buffer</td>
				<td>5&micro;l</td>
				<td>1X</td>
			</tr>
			<tr>
				<td>10mM dNTP mix</td>
				<td>0.5&micro;l</td>
				<td>0.1&micro;m</td>
			</tr>
			<tr>
				<td>Primer mix (10&micro;M each)</td>
				<td>1&micro;l</td>
				<td>0.2&micro;m</td>
			</tr>
			<tr>
				<td>Template DNA</td>
				<td>0.5&#8275;10&micro;l</td>
				<td>n/a</td>
			</tr>
			<tr>
				<td>RBC Taq DNA polymerase (5U/&micro;l)</td>
				<td>0.25&micro;l</td>
				<td>1.25units</td>
			</tr>
			<tr>
				<td>ddH2O</td>
				<td>to 50&micro;l</td>
				<td>n/a</td>
			</tr>
		</table>
		<br/>
		2) Suggested Reaction Parameters for RBC Taq DNA Polymerase<br/>
		<table>
			<tr>
				<th>Segment</th>
				<th>Number of cycles</th>
				<th>Temperature</th>
				<th>Duration</th>
			</tr>
			<tr>
				<td>1</td>
				<td>1</td>
				<td>94&deg;C</td>
				<td>1&#8275;3 minutes</td>
			</tr>
			<tr>
				<td>2</td>
				<td>25&#8275;35</td>
				<td>
					94&deg;C (<i>denature</i>)<br/>
					5 degree lower than Tm of Primer<br/>
					72&deg;C (<i>extend</i>)
				</td>
				<td>
					30 seconds&#8275;1 30<br/>
					seconds&#8275;1 minute<br/>
					1minute/Kbp
				</td>
			</tr>
			<tr>
				<td>3</td>
				<td>1</td>
				<td>
					72&deg;C<br/>
					4&deg;C
				</td>
				<td>7 minutes</td>
			</tr>
		</table>
		<br/>
		3) Analyze the amplification products by agarose gel electrophoresis and visualize by ethidium bromide staining.<br/>
		<br/>
		<a href="http://webdownload.rbcbioscience.com/RBC%20Polymerases/DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase/RBC%20Taq%20DNA%20Polymerase%20Protocol%20V2.0.pdf" target="_blank">External link</a><br/>
	</html>|RBC-Taq-DNA-pol-PCR}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Phusion PCR Protocol|<html>
		<table>
			<tr>
				<th>
					Component
				</th>
				<th>
					50 &micro;l Reaction
				</th>
			</tr>
			<tr>
				<td>
					Nuclease-free water
				</td>
				<td>
					to 50 &micro;l
				</td>
			</tr>
			<tr>
				<td>
					5X Phusion HF or GC Buffer
				</td>
				<td>
					10 &micro;l
				</td>
			</tr>
			<tr>
				<td>
					10 mM dNTPs
				</td>
				<td>
					1 &micro;l
				</td>
			</tr>
			<tr>
				<td>
					10 &micro;M Forward Primer
				</td>
				<td>
					2.5 &micro;l
				</td>
			</tr>
			<tr>
				<td>
					10 &micro;M Reverse Primer
				</td>
				<td>
					2.5 &micro;l
				</td>
			</tr>
			<tr>
				<td>
					Template DNA
				</td>
				<td>
					Variable
				</td>
			</tr>
			<tr>
				<td>
					DMSO (optional)
				</td>
				<td>
					(1.5 &micro;l)
				</td>
			</tr>
			<tr>
				<td>
					Phusion DNA Polymerase
				</td>
				<td>
					0.5 &micro;l	
				</td>
			</tr>
		</table><br/>

		For the template DNA, use 1 &micro;l  (50 ng/ &micro;l) of E.coli genomic DNA.<br/>
		<br/>
		Set the PCR with the following parameters:<br/>
		<br/>

		<table>
			<tr>
				<th>Cycle step</th>
				<th>Cycles</th>
				<th>Temp [&deg;C]</th>
				<th>Time [s]</th>
			</tr>
			<tr>
				<td>Initial denaturation</td>
				<td>1</td>
				<td>98</td>
				<td>30</td>
			</tr>
			<tr>
				<td>Denaturation</td>
				<td>30</td>
				<td>98</td>
				<td>5-10</td>
			</tr>
			<tr>
				<td>Annealing</td>
				<td>&nbsp;</td>
				<td>72</td>
				<td>10-30</td>
			</tr>
			<tr>
				<td>Extention</td>
				<td>&nbsp;</td>
				<td>72</td>
				<td>10-30*kb</td>
			</tr>
			<tr>
				<td>Final extention</td>
				<td>1</td>
				<td>72</td>
				<td>5-10 [min]</td>
			</tr>
			<tr>
				<td>Hold</td>
				<td>1</td>
				<td>4</td>
				<td>&infin;</td>
			</tr>
		</table>
	</html>|Phusion-PCR}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|OneTaq + Phu PCR|<html>
		1) Add the following components in a sterile microtube on ice:
		<table>
			<tr>
				<th colspan="2">
					Reaction Mix
				</th>
			</tr>
			<tr>
				<th>5x One Taq Buffer</th>
				<td>10 &micro;l</td>
			</tr>
			<tr>
				<th>Fwd Primer</th>
				<td>1 &micro;l</td>
			</tr>
			<tr>
				<th>Rev Primer</th>
				<td>1 &micro;l</td>
			</tr>
			<tr>
				<th>10 mM dNTP's</th>
				<td>1 &micro;l</td>
			</tr>
			<tr>
				<th>One Taq</th>
				<td>0.25 &micro;l</td>
			</tr>
			<tr>
				<th>Phusion</th>
				<td>0.3 &micro;l</td>
			</tr>
			<tr>
				<th>Template DNA</th>
				<td>50-100 ng</td>
			</tr>
			<tr>
				<th>H20</th>
				<td>up to 50 &micro;l</td>
			</tr>				
		</table>

		2) Suggested reaction parameters:
		<table>
			<tr>
				<th>Cycle Step</th>
				<th>Cycles</th>
				<th>Temp [&deg;C]</th>
				<th>Time [s]</th>
			</tr>
			<tr>
				<td>Inital denaturation</td>
				<td>1</td>
				<td>94</td>
				<td>120</td>
			</tr>
			<tr>
				<td>Denaturation</td>
				<td>30</td>
				<td>94</td>
				<td>30</td>
			</tr>
			<tr>
				<td>Annealing</td>
				<td></td>
				<td>60 *</td>
				<td>60</td>
			</tr>
			<tr>
				<td>Extension</td>
				<td></td>
				<td>68</td>
				<td>60 s/Kbase</td>
			</tr>
			<tr>
				<td>Final Extension</td>
				<td>1</td>
				<td>68</td>
				<td>300</td>
			</tr>
			<tr>
				<td>Hold</td>
				<td>1</td>
				<td>4</td>
				<td>&#8734;</td>
			</tr>
		</table>
	</html>|OneTaq-Phu-PCR}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Illustra GFX PCR DNA and Gel Band Purification Kit|<html>
		<ol>
			<li>
				Sample Capture:
				<ul>
					<li>Add 250 &micro;l of <i>Capture buffer</i> type 3 to the sample.</li>
					<li>Mix and control that the color is yellow or pale orange.</li>
				</ul>
			</li>
			<li>
				Sample Binding:
				<ul>
					<li>Transfer the mix in the assembled <i>GFX MicroSpin column</i> and Collection tube.</li>
					<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li>
					<li>Replace <i>GFX MicroSpin column</i> in the same Collection tube.</li>
				</ul>
			</li>
			<li>
				Wash and Dry:
				<ul>
					<li>Add 500 &micro;l of <i>Wash buffer</i> type 1.</li>
					<li>Spin for 30s at 16000*g (&#8275;13000rpm) and discard the Collection tube.</li>
					<li>Transfer the <i>GFX MicroSpin column</i> in a clean tube.</li>
				</ul>
			</li>
			<li>
				Eluition:
				<ul>
					<li>Add 50 &micro;l of distilled water.</li>
					<li>Incubate for 1 minute at room temperature.</li>
					<li>Spin for 1 minute at 13000rpm.</li>
					<li>Retain flowthrough.</li>
					<li>Quantify the sample at <i>Nanodrop</i> and label it with its concentration.</li>
				</ul>
			</li>
		</ol>
		<br/>
		<a href="https://www.gelifesciences.com/gehcls_images/GELS/Related%20Content/Files/1314774443672/litdoc28951562AA_20110831111511.pdf" target="_blank">External protocol</a><br/>
		<a href="http://www.gelifesciences.com/webapp/wcs/stores/servlet/catalog/en/GELifeSciences/products/AlternativeProductStructure_17513/28903470" target="_blank">External site</a><br/>
	</html>|Illustra-GFX-PCR}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; SV Gel and PCR Clean-Up System Technical Bulletin|<html>
		<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/101/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (136kb)<br/>
		<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20SV%20Gel%20and%20PCR%20Clean-Up%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (75kb)
	</html>|Promega-PCR-Gel}}

	<h2>Cells</h2>

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells preparation|<html>
		<ul>
			<li>Transformation Buffer: sterile 10 mM Tris-HCl, pH 7.0, 50 mM CaCl2</li>
			<li>Grow a 50 mL culture in LB at 37 deg C from 1 colony.</li>
			<li>When OD ~ 0.5, collect the cells in a sterile Falcon tube and chill on ice for 10min.</li>
			<li>Centrifuge at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li>
			<li>Resuspend cells in 15 mL of transformation buffer.</li>
			<li>Chill on ice for 15 min. Spin at 5000 rpm for 10 min at 4 deg C. Discard supernatant.</li>
			<li>Resuspend cells in 4 mL of transformation buffer.</li>
		</ul>
		<br/>
		The cells are now ready to be transformed. They can be stored in this state at 4 deg C for under a week.<br/>
		Alternatively, the competent cells can be aliquoted (200&micro;L), adding glycerol to a final conc of 15% (v/v), and the cells stored at –80 deg C.<br/>
		Every time you make new competent cells you should check for possible contaminations. Plate an aliquot of the new cells in LB plates + antibiotic (i.e. ampicillin, chloramphenicol, kanamycin). Strains such as DH5a, NEB10b, Novablue, should not grow in the presence of antibiotics.<br/>
	</html>|Competent-cells-prep}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation|<html>
		<b>Competent cells must always stay in ice</b>
		<ul>
			<li>Thaw home made CaCl2 competent cells on ice.</li>
			<li>Add 1&micro;L of DNA to 200&micro;L of competent cells (concentration of DNA stock should be between 50–150 ng/&micro;L).</li>
			<li>Incubate on ice for 30 min.</li>
			<li>Heat shock at 42&deg;C for exactly 2 min.</li>
			<li>Incubate on ice 1 min.</li>
			<li>Add 500-700&micro;L of LB (or SOC) and shake at 37&deg;C for 1 h.</li>
			<li>Plate the cells (use plates with the appropriate antibiotic according to your plasmid).</li>
		</ul>
		<br/>
		You can either plate a small amount (200&micro;L) of the cells or more.<br/>
		You should try a few conditions the first time and then choose the one that gives 30–300 separate colonies.<br/>
		If few cells are expected: spin down the cells at 2500 rpm, discard supernatant and resuspend in 150–200&micro;L of LB and plate all the cells.<br/>
		<br/>
		Plates must be labeled as follow:<br/>
		strain – [resistance] – part – “(plasmid)” – YOUR_NAME – date<br/>
		<br/>
		For ligation you should increase the amount of DNA to be transformed (see cloning protocol).<br/>
		<ul><li>Incubate the plates O/N upside down at 37&deg;C.</li></ul>
		<b>!!!Don't plate before four o'clock!!!</b><br/>
	</html>|Competent-cells-transformation}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|B. subtilis transformation (from Groeningen iGEM2013 team)|<html>
		<span>Prepare the competence medium as follow:</span>
		<table class="tn-sp-table">
			<tr colspan="2">
				<th>Competence medium (MC completed)</th>
			</tr>
			<tr>
				<td>
					H2O
				</td>
				<TD>
					1.8 ml
				</TD>
			</tr>
			<tr>
				<td>
					10x MC
				</td>
				<TD>
					200 ul
				</TD>
			</tr>
			<tr>
				<td>
					MgSO4 1M
				</td>
				<TD>
					6.7 ul
				</TD>
			</tr>
			<tr>
				<td>
					trp 1% (for trp - strains)
				</td>
				<TD>
					10 ul
				</TD>
			</tr>
		</table>
		<table class="tn-sp-table">
			<tr>
				<th colspan="2">
					MC 10x
				</th>
			</tr>
			<tr>
				<td colspan="2">
					for 100 ml
				</td>
			</tr>
			<tr>
				<td>
					K2HPO4 3H2O
				</td>
				<TD>
					14.036 g
				</TD>
			</tr>
			<tr>
				<td>
					KH2PO4
				</td>
				<TD>
					5.239 g
				</TD>
			</tr>
			<tr>
				<td>
					Glucose
				</td>
				<TD>
					20 g
				</TD>
			</tr>
			<tr>
				<td>
					Tri-Na Citrate 300 mM
				</td>
				<TD>
					10 ml
				</TD>
			</tr>
			<tr>
				<td>
					Ferric NH4 Citrate
				</td>
				<TD>
					1 ml
				</TD>
			</tr>
			<tr>
				<td>
					Casein Hydrolysate
				</td>
				<TD>
					1 g
				</TD>
			</tr>
			<tr>
				<td>
					K glutamate
				</td>
				<TD>
					2 g
				</TD>
			</tr>
			<tr>
				<td colspan="2">Mix everything in 40-50 ml H2O, then adjust to 100 ml, filter sterilize, freeze at -20 C</td>
			</tr>
		</table>
		<table class="tn-sp-table">
			<tr>
				<th>
					Tri-Na Citrate 300mM
				</th>
				<td>
					8.823 g
				</td>
				<td>
					in 100 ml H2O
				</td>
			</tr>
			<tr>
				<th>
					Ferric NH4 citrate
				</th>
				<td>
					2.2 g
				</td>
				<td>
					in 100 ml H2O
				</td>
			</tr>
			<tr>
				<td colspan="3">
					--> wrap in aluminium foil!!
				</td>
			</tr>
		</table>
		<br/>
		<ol>
			<li>
				Pick up a nice big colony and drop it in 2 ml of completed MC (1x) (see below);
			</li>
			<li>
				Grow at 37 &deg;C for 5 hours (or more if culture is not really turbid);
			</li>
			<li>
				Mix 400 ul of culture with DNA (usually 1 ug) in fresh tube (i.e. 15 ml tubes losely closed);
			</li>
			<li>
				Grow for additional 2 h at 37 &deg;C;
			</li>
			<li>
				Plate all on selective antibiotic plates, and incubate at 37 &deg;C O/N
			</li>
		</ol>
	</html>|subtilis-transformation}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Competent cells transformation efficiency kit (registry)|<html>
		<a href="http://parts.igem.org/Help:Transformation_Efficiency_Kit" target="_blank">External link (registry)</a>
	</html>|Competent-cells-transformation-efficiency}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Gram Staining Protocol|<html>
		<ol>
			<li>
				Transfer 100 ul of sterile distilled water in an eppendorf;
			</li>
			<li>
				Pick up a colony using a tip and resuspend it in the sterile water;
			</li>
			<li>
				Verify that the glass slide is cleaned and degreased or clean it with 70% alcohol;
			</li>
			<li>
				Transfer 20 ul of bacterial suspension on the slide;
			</li>
			<li>
				Swipe gently bacterial suspension with the aid of a sterile loop to occupy 1-2 cm at the center of the slide;
			</li>
			<li>
				Let dry the slide by evaporation;
			</li>
			<li>
				Cover the central part of the slide with methanol, remove the excess and let it evaporate;
			</li>
			<li>
				Sock the slide in the crystal violet solution for 1 min, wash then with sterile water; 
			</li>
			<li>
				Sock the slide in the lugol solution for 1 min, wash then with sterile water; 
			</li>
			<li>
				Pour Gram bleach solution on the product for 20-30 s, wash then with sterile water;
			</li>
			<li>
				Sock the slide in the safranin solution for 1 min, wash then with sterile water;
			</li>
			<li>
				Finally let dry the slide and observe it with the microscope.
			</li>
		</ol>
	</html>|gram-staining}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MNGE medium|<html>

	<table>
		<tr>
			<th colspan="2">MNGE medium 40 ml</th>
		</tr>
		<tr>
			<th>Compound</th>
			<th>Amount</th>
		</tr>
		<tr>
			<td>10xMN-Medium</td>
			<td>3,68ml</td>
		</tr>
		<tr>
			<td>Sterile water</td>
			<td>33,12ml</td>
		</tr>
		<tr>
			<td>Glucose (20%)</td>
			<td>4ml</td>
		</tr>
		<tr>
			<td>K-Glutamat (40%)</td>
			<td>200&micro;l</td>
		</tr>
		<tr>
			<td>Fe[III]-ammonium-citrate (2,2 mg/ml)</td>
			<td>200&micro;l</td>
		</tr>
		<tr>
			<td>Tryptophan (5 mg/ml)</td>
			<td>400&micro;l</td>
		</tr>
		<tr>
			<td>MgSO4 (1M)</td>
			<td>120&micro;l</td>
		</tr>
		<tr>
			<td>threonine (5 mg/ml)</td>
			<td>400&micro;l</td>
		</tr>
	</table>

	<table>
		<tr>
			<th colspan="2">MN medium 10X 50 ml</th>
		</tr>
		<tr>
			<th>Compound</th>
			<th>Amount</th>
		</tr>
		<tr>
			<td>K2HPO4 (x3 H2O)</td>
			<td>6,8 g</td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>3 g</td>
		</tr>
		<tr>
			<td> Na-citrate (x 2 H2O)</td>
			<td>0.5 g</td>
		</tr>
	</table>

	</html>|mnge-medium}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Difco Sporulation Medium (from LMU - Munich iGEM team)|<html>
	<table>
    <tr>
        <td>Nutrienti Broth</td>
        <td>8 g</td>
    </tr>
    <tr>
        <td>KCl</td>
        <td>1 g</td>
    </tr>
    <tr>
        <td>MgSO4 1 M</td>
        <td>1 ml</td>
    </tr>
    <tr>
        <td>MnCl2 10 mM</td>
        <td>1 ml</td>
    </tr>
    <tr>
        <td>H2O   (bidest)</td>
        <td>ad to 1.000   ml</td>
    </tr>
    <tr>
        <td colspan ="2"> after autoclave add</td>
    </tr>
    <tr>
        <td>CaCl2 1 M</td>
        <td>0,5 ml</td>
    </tr>
    <tr>
        <td>FeSO4 1 mM</td>
        <td>1 ml</td>
    </tr>
</table>

	

	</html>|Difco-Sporulation-Medium}}

	<h2>Miscellaneous</h2>

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Parts extraction and transformation (NEB10&beta;).|<html>
		<ol>
			<li>Label the empty eppendorfs that will contain the parts, including antibiotic resistance, part denomination and position (and on which kit).</li>
			<li>Spot the correct well and label it with a pen.</li>
			<li>Push a hole with the pin of a micropipette and resuspend the content with 10ul water.</li>
			<li>When the color is dark red, wait 1 minute.</li>
			<li>Move the re-suspended part into the correct empty eppendorf.</li>
		</ol>
	</html>|parts-registry-extraction}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Wizard&reg; Plus SV Minipreps DNA Purification System Technical Bulletin|<html>
		<a href="http://ita.promega.com/~/media/Files/Resources/Protocols/Technical%20Bulletins/0/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Protocol.pdf" target="_blank">Complete protocol</a> (180kb)<br/>
		<a href="http://ita.promega.com/~/media/Files/Resources/ProtCards/Wizard%20Plus%20SV%20Minipreps%20DNA%20Purification%20System%20Quick%20Protocol.pdf" target="_blank">Quik protocol</a> (72kb)
	</html>|miniprep}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Biobrick cloning|<html>
		<!--biobrick cloning protocol -->
		<p>
			Prepare the digestion mix as follow: 
		</p>
		<table class="tn-sp-table">
			<tr>
				<td>
					DNA 	
				</td>
				<td>
					500 ng
				</td>
			</tr>
			<tr>
				<td>
					10X NEB Buffer
				</td>
				<td>
					2.5 ul 
				</td>
			</tr>
			<tr>
				<td>
					10X BSA
				</td>
				<td>
					2.5 ul 
				</td>
			</tr>
			<tr>
				<td>
					E1
				</td>
				<td>
					1 ul 
				</td>
			</tr>
			<tr>
				<td>
					E2
				</td>
				<td>
					1 ul 
				</td>
			</tr>
				<tr>
				<td>
					H2O
				</td>
				<td>
					Up to 25 ul 
				</td>
			</tr>
		</table>

		<p>
			Incubate the reaction mix at 37 &deg;C for 30 min. Disactivate then the enzymes incubating the mix at 80 &deg;C for 20 min.
			The next step will be the ligation of the digestion products. The raction mix is prepared as follow:
		</p>
		<table class="tn-sp-table">
			<tr>
				<td>
					Insert
				</td>
				<td>
					3 fold excess
				</td>
			</tr>
			<tr>
				<td>
					Vector
				</td>
				<td>
					40 ng
				</td>	
			</tr>
			<tr>
				<td>
					10X T4 Ligase Buffer
				</td>
				<td>
					2 ul
				</td>
			</tr>
			<tr>
				<td>
					T4 Ligase
				</td>
				<td>
					1 ul
				</td>
			</tr>
			<tr>
				<td>
					H2O
				</td>
				<TD>
					Up to 20 ul
				</TD>
			</tr>
		</table>
		<p>
			Gently mix the reaction and incubate for 30 min at room temperature. Disactivate the enzymes at 80 &deg;C for 20 min. Transorm 10 ul of the reaction in competent cells.
		</p>
	</html>|biobrick-cloning}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ligation|<html>

		Prepare the reaction mix, you can use the automatic calculator.<br/>
		</html>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Automatic Calculator|<html>
			<script type="text/javascript">
				/**
				 *
				 */
				function ligateCalc() {
					//Calculate needed plasmid
					insert_need = parseFloat($("input[name=plasmid_need]").val()*$("input[name=insert_length]").val()/$("input[name=plasmid_length]").val()).toFixed(2);
					$("td[data-pseudoid=insert_need]").text(insert_need);

					//Calculate buffer
					buffer = parseFloat($("input[name=total_volume]").val()/$("input[name=buffer_conc]").val()).toFixed(2);
					$("td[data-pseudoid=buffer]").text(buffer);

					//Calculate plasmid
					plasmid = parseFloat($("input[name=plasmid_need]").val()/$("input[name=plasmid_conc]").val()).toFixed(2);
					$("td[data-pseudoid=plasmid]").text(plasmid);

					//Calculate insert
					insert = parseFloat($("td[data-pseudoid=insert_need]").text()/$("input[name=insert_conc]").val()).toFixed(2);
					$("td[data-pseudoid=insert_one]").text(insert);
					$("td[data-pseudoid=insert_two]").text(insert*2);
					$("td[data-pseudoid=insert_three]").text(insert*3);
					$("td[data-pseudoid=insert_four]").text(insert*4);

					//Calculate water
					total_volume = parseFloat($("input[name=total_volume]").val()).toFixed(2);
					$("td[data-pseudoid=water_ctrl]").text(parseFloat(total_volume-buffer-plasmid-1).toFixed(2));
					$("td[data-pseudoid=water_one]").text(parseFloat(total_volume-buffer-plasmid-1-insert).toFixed(2));
					$("td[data-pseudoid=water_two]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*2)).toFixed(2));
					$("td[data-pseudoid=water_three]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*3)).toFixed(2));
					$("td[data-pseudoid=water_four]").text(parseFloat(total_volume-buffer-plasmid-1-(insert*4)).toFixed(2));

				}

				$(document).ready(function() {
					$("#tn-ligation-calc input:text").each(function() {
						$(this).change(function(e) {
							e.preventDefault();
							ligateCalc();
						});
					});
					ligateCalc();
				});
			</script>
			<form id="tn-ligation-calc"><table>
				<tr>
					<th>Plasmid concentration (ng/&micro;l)</th>
					<td><input type="text" name="plasmid_conc" value="1" /></td>
				</tr>
				<tr>
					<th>Plasmid length (bp)</th>
					<td><input type="text" name="plasmid_length" value="1" /></td>
				</tr>
				<tr>
					<th>Insert concentration (ng/&micro;l)</th>
					<td><input type="text" name="insert_conc" value="1" /></td>
				</tr>
				<tr>
					<th>Insert length (bp)</th>
					<td><input type="text" name="insert_length" value="1" /></td>
				</tr>
				<tr>
					<th>Amount of plasmid you want to use (ng)</th>
					<td><input type="text" name="plasmid_need" value="200" /></td>
				</tr>
				<tr>
					<th>Volume of reaction (&micro;l)</th>
					<td><input type="text" name="total_volume" value="20" /></td>
				</tr>
				<tr>
					<th>Buffer concentration (X)</th>
					<td><input type="text" name="buffer_conc" value="10" /></td>
				</tr>
				<tr>
					<th>Amount of insert needed for 1:1 (ng)</th>
					<td data-pseudoid="insert_need">-</td>
				</tr>
			</table>
			<br/>
			<center><b>Results</b></center>
			<table class="results">
				<tr>
					<td style="border: none;">&nbsp;</td>
					<th>ctrl</th>
					<th>1:1</th>
					<th>1:2</th>
					<th>1:3</th>
					<th>1:4</th>
				</tr>
				<tr>
					<th>Buffer (&micro;l to have 1X)</th>
					<td data-pseudoid="buffer" colspan="5"></td>
				</tr>
				<tr>
					<th>Plasmid (&micro;l)</th>
					<td data-pseudoid="plasmid" colspan="5"></td>
				</tr>
				<tr>
					<th>Insert (&micro;l)</th>
					<td>0</td>
					<td data-pseudoid="insert_one"></td>
					<td data-pseudoid="insert_two"></td>
					<td data-pseudoid="insert_three"></td>
					<td data-pseudoid="insert_four"></td>
				</tr>
				<tr>
					<th>Ligase (&micro;l)</th>
					<td colspan="5">1</td>
				</tr>
				<tr>
					<th>Water (&micro;l)</th>
					<td data-pseudoid="water_ctrl"></td>
					<td data-pseudoid="water_one"></td>
					<td data-pseudoid="water_two"></td>
					<td data-pseudoid="water_three"></td>
					<td data-pseudoid="water_four"></td>
				</tr>
			</table></form>
		</html>}}<html>
		Prepare your reaction and incubate at RT for 2 hours. Transform half of the reaction into 200μL of “homemade” competent cells (DH5&alpha;, NEB10&beta;, Novablue or other appropriate strains) following a standard transformation protocol. Plate all the cells.
	</html>|Ligation}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Digestion|<html>
		Assemble the digestion mix as follow (check the correct buffer with the <a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a>).

		<table>
			<tr>
				<td style="border: none;" rowspan="2"></td>
				<th colspan="2">Classic Cloning</th>
				<th rowspan="2">Screening</th>
			</tr>
			<tr>
				<th>PCR products</th>
				<th>Plasmids</th>
			</tr>
			<tr>
				<th>Template</th>
				<td>&#126;3-4&micro;g</td>
				<td>&#126;2-3&micro;g</td>
				<td>&#126;1.0&micro;g</td>
			</tr>
			<tr>
				<th>Enzyme 1</th>
				<td rowspan="2">2.5&micro;l</td>
				<td rowspan="2">1.5&micro;l</td>
				<td rowspan="2">1.0&micro;l</td>
			</tr>
			<tr>
				<th>Enzyme 2</th>
			</tr>
			<tr>
				<th>Buffer (stock 10X)</th>
				<td>10&micro;l</td>
				<td>5&micro;l</td>
				<td>2&micro;l</td>
			</tr>
			<tr>
				<th>BSA (stock 10X)</th>
				<td>10&micro;l</td>
				<td>5&micro;l</td>
				<td>2&micro;l</td>
			</tr>
			<tr>
				<th>Water</th>
				<td>Up to 100&micro;l</td>
				<td>Up to 50&micro;l</td>
				<td>Up to 20&micro;l</td>
			</tr>
		</table>

		<h4>Classic Cloning - for PCR products</h4>
		Incubate at 37&deg;C overnight. The day after add 1&micro;l of DpnI and incubate at 37&deg;C for 2 hours. <i>Please note that PCR product must be purified before digestion.</i>
		<h4>Classic Cloning - for plasmids</h4>
		Incubate at 37&deg;C overnight. The day after add 1&micro;L of phosphatase (CIP or SAP) to the vector and incubate for 2 hours at 37&deg;C.
		<h4>Biobricks Cloning</h4>
	        Incubate at 37&deg;C for 30 minutes. Then disactivate the enzymes at 80&deg;C for 20 minutes.
	        <h4>Screening</h4>
		Incubate for 1.5h at 37&deg;C. Run all the digested product on an agarose gel to screen colonies. 
		<br/><br/><hr/><br/>
		<a href="http://66.155.211.155/nebecomm/DoubleDigestCalculatorIntl.asp">Double Digest finder</a>
	</html>|Digestion}}

	<h2>Details</h2>

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|SAMsynthetase extraction from <i>E. coli</i> (strain MG1655) genome|<html>
		<table>
			<tr>
				<th colspan="4">PRIMERS SEQUENCES</th>
			</tr>
			<tr>
				<td>Primer Forward</td>
				<td>GCCGCTTCTAGAGA AGGAGG AACTACT <b>ATG</b>GCAAAACACCTTTTT</td>
				<td>prefix(only Xba1) + RBS + spacer + ATG...</td>
				<td>Tm = 66&deg;C</td>
			</tr>
			<tr>
				<td>Primer Reverse</td>
				<td>CTGCCGGTCTGAAG TAATAA TACTAGTAGCGGCCGCTGCAG</td>
				<td>sequence + stop codon + suffix</td>
				<td>Tm = 67.5&deg;C</td>
			</tr>
		</table>

		SAMsynthethase gene length = 1155 bp<br>

		<table class="tn-sp-table">
			<tr>
				<th colspan="2">PCR mix</th>
			</tr>
			<tr><!--riga-->
				<th><!--colonna-->Solutes</th>
				<th>Quantities or Concentration</th>
			</tr>
				<tr>
				<td>Template(genome)</td>
				<td>1ng/ &micro;l</td>
			</tr>
			<tr>
				<td>dNTPs</td>
				<td>0.5&micro;l</td>
			</tr>
			<tr>
				<td>Primer Forward</td>
				<td>1 &micro;l</td>
			</tr>
			<tr>
				<td>Primer Reverse</td>
				<td>1 &micro;l</td>
			</tr>
			<tr>
				<td>Buffer RBC</td>
				<td>1X</td>
			</tr>
			<tr>
				<td>Phusion polimerase</td>
				<td>0.3 &micro;l</td>
			</tr>
			<tr>
				<td>RBC Taq polimerase</td>
				<td>0.25 &micro;l</td>
			</tr>
			<tr>
				<td>Water</td>
				<td>up to 50 &micro;l</td>
			</tr>
		</table>

		We have chosen to use RBC for its amplification power and Phusion for its proofreading activity<br>

		The program set on the PCR is the following:

		<table class="tn-sp-table">
			<tr>
				<th colspan="4">PCR Settings</th>
			</tr>
			<tr>
				<th>Step</th>
				<th>Temperature</th>
				<th>Time</th>
				<th>Go to</th>
			</tr>
			<tr>
				<td>1</td>
				<td>94&deg;C</td>
				<td>2 min</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>2</td>
				<td>94&deg;C</td>
				<td>1 min</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>3</td>
				<td>62.5&deg;C</td>
				<td>1 min</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>4</td>
				<td>72&deg;C</td>
				<td>1 min 9 s</td>
				<td>Go to Step 2 for 30 times</td>
			</tr>
			<tr>
				<td>5</td>
				<td>72&deg;C</td>
				<td>7 min</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>6</td>
				<td>4&deg;C</td>
				<td>pause</td>
				<td>&nbsp;</td>
			</tr>
		</table>
	</html>|SAM-extraction-genome-coli}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|pSB1C3 linearization by PCR|<html>
		This protocol is a Phusion PCR using <b>Suffix Forward</b> and <b>Prefix Reverse</b> primers: in this way it is possible to linearize pSB1C3 removing any insert (like RFP,...). <i>Note: it is advisable to perform the PCR at least in triplicates.</i><br/>
		<br/>
		<table>
			<tr>
				<th colspan="2">PCR mix</th>
			</tr>
			<tr>
				<th>Template</th>
				<td>50ng (at least 0.50&micro;l)</td>
			</tr>
			<tr>
				<th>HF Buffer</th>
				<td>10&micro;l</td>
			</tr>
			<tr>
				<th>dNTPs</th>
				<td>1&micro;l</td>
			</tr>
			<tr>
				<th>Primer Fw (suff)</th>
				<td>2.5&micro;l</td>
			</tr>
			<tr>
				<th>Primer Rv (pref)</th>
				<td>2.5&micro;l</td>
			</tr>
			<tr>
				<th>Phusion</th>
				<td>0.5&micro;l</td>
			</tr>
			<tr>
				<th>Water</th>
				<td>up to 50&micro;l</td>
			</tr>
		</table>
		<br/>
		Given that pSB1C3 is 2070bp long and that the annealing temperature of the primers used is 58&deg;C, the PCR program to be used is the following:
		<table>
			<tr>
				<th>Step</th>
				<th>Temperature</th>
				<th>Time</th>
				<th>Type</th>
				<th>Go to</th>
			</tr>
			<tr>
				<td>1</td>
				<td>98&deg;C</td>
				<td>30sec</td>
				<td>&nbsp;</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>2</td>
				<td>98&deg;C</td>
				<td>10sec</td>
				<td>Denaturation</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>3</td>
				<td>58&deg;C</td>
				<td>20sec</td>
				<td>Annealing</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>4</td>
				<td>72&deg;C</td>
				<td>35sec</td>
				<td>Extend</td>
				<td>Go to step #2 for 30 times</td>
			</tr>
			<tr>
				<td>5</td>
				<td>72&deg;C</td>
				<td>10min</td>
				<td>&nbsp;</td>
				<td>&nbsp;</td>
			</tr>
			<tr>
				<td>6</td>
				<td>4&deg;C</td>
				<td>&infinit;</td>
				<td>&nbsp;</td>
				<td>&nbsp;</td>
			</tr>
		</table>
		Then run the PCR samples on a 1% agarose gel to verify the success of the reactions (each sample is prepared with 8&micro;l of PCR reaction and 2&micro;l of 6X loading die; 1kb ladder is good).
	</html>|pSB1C3-linearization-PCR}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Ethylene detection through Micro GC|<html>
		<p>
		An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, the culture was induced with 5 mM arabinose and placed with a stirrer in a sealed vial (V = 15 ml) with a pierceable septum. The sample was kept for about 4 hours at 37 &deg;C in thermoshaker. After that the sample was connected to the Micro Gas Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U
		column (see the tables for colums and method specifications).
		</p>
		<table class="tn-sp-table">
			<TR>
				<th>
					Column
				</th>
				<th>
					Lenght
				</th>
				<th>
					Diameter
				</th>
			</TR>
			<tr>
				<td>
					Mol Sieve 5A Plot
				</td>
				<td>
					10 m
				</td>
				<td>
					0.32 mm
				</td>
			</tr>
			<tr>
				<td>
					Plot U
				</td>
				<td>
					8 m
				</td>
				<td>
					0.32 mm
				</td>
			</tr>
		</table>
		<table class="tn-sp-table">
			<tr>
				<th colspan = '2'>
					Method used
				</th>
			</tr>
			<tr>
				<th>
					t sample
				</th>
				<td>
					50 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t injector
				</th>
				<td>
					55 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t column Mol Sieve 5A Plot
				</th>
				<td>
					110 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t column Plot U 
				</th>
				<td>
					70 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					p column Mol Sieve 5A Plot
				</th>
				<td>
					39.16 psi
				</td>
			</tr>
			<tr>
				<th>
					p column Plot U
				</th>
				<td>
					21.76 psi
				</td>
			</tr>
			<tr>
				<th>
					t injection
				</th>
				<td>
					40 us
				</td>
			</tr>	
			<tr>
				<th>
					t analysis
				</th>
				<td>
					95 s 
				</td>
			</tr>
		</table>
		A measure was then taken.<br/>
		In order to estimate how much gas was taken for each measurement using the settings
		described above, a mass flow meter was connected to the micro GC.
		During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a
		measurment lasts 10 s, the withdrawn volume was 0.5 ml.
	</html>|ethylene-detection-assay}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Kinetic assay for ethylene production through micro GC|<html>
		<p>
		An overnight culture was diluited 1:100 and grown until O.D.600 reached 0.5. After that, 3
		ml of culture induced with 5 mM arabinose was placed with a stirrer in a sealed vial (V =
		15 ml) with a pierceable septum. The sample was then connected to the Micro Gas
		Chromatograph Agilent 3000A endowed with two colums: a Mol Sieve 5A Plot and a Plot U
		column (see the tables for colums and method specifications).
		</p>
		<table class="tn-sp-table">
			<TR>
				<th>
					Column
				</th>
				<th>
					Lenght
				</th>
				<th>
					Diameter
				</th>
			</TR>
			<tr>
				<td>
					Mol Sieve 5A Plot
				</td>
				<td>
					10 m
				</td>
				<td>
					0.32 mm
				</td>
			</tr>
			<tr>
				<td>
					Plot U
				</td>
				<td>
					8 m
				</td>
				<td>
					0.32 mm
				</td>
			</tr>
		</table>
		<table class="tn-sp-table">
			<tr>
				<th colspan = '2'>
					Method used
				</th>
			</tr>
			<tr>
				<th>
					t sample
				</th>
				<td>
					50 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t injector
				</th>
				<td>
					55 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t column Mol Sieve 5A Plot
				</th>
				<td>
					110 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					t column Plot U 
				</th>
				<td>
					70 &deg;C
				</td>
			</tr>
			<tr>
				<th>
					p column Mol Sieve 5A Plot
				</th>
				<td>
					39.16 psi
				</td>
			</tr>
			<tr>
				<th>
					p column Plot U
				</th>
				<td>
					21.76 psi
				</td>
			</tr>
			<tr>
				<th>
					t injection
				</th>
				<td>
					40 us
				</td>
			</tr>	
			<tr>
				<th>
					t analysis
				</th>
				<td>
					95 s 
				</td>
			</tr>
		</table>
		A measurment was taken every 45 min / 1 h in order to get an overview of the time course
		of ethylene production.<br/>
		In order to estimate how much gas was taken for each measurement using the settings
		described above, a mass flow meter was connected to the micro GC.
		During a measurment, a flow of 3 (± 0.15) ml / min was registered. Due to the fact that a
		measurment lasts 10 s, the withdrawn volume was 0.5 ml.
	</html>|kinetic-ethylene-production}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|Application of B. fruity on fruit|<html>
		To test if our system was able to accelerate or to slow down fruit ripening, we designed an ermetically closed jam jar with a rubber hose connector. These jars contained our test-fruit and each one was connected to a flask. The flasks contained 300 ml of induced (or not) culture when its O.D.600 reached 0.8. The flasks contained also a stirrer. The cultures were maintained at 37 &deg;C using a laboratory heating plate connected to a digital thermometer immersed in the culture.<br/>
		For some days, every morning the culture in the flasks was substituted with a new induced (or not) colture .<br/>
		Furthermore, canonical jam jars (i.e.: with no connector) were adopted to contain the negative control fruit samples. All the apparatus was put under the chemical hood. <br/>
		<br/>
		<center>
			<i>The apparatus.</i><br/>
			<br/>
			<img src="https://static.igem.org/mediawiki/2013/1/10/Tn-2013_ripenator_apparatus.JPG" width="450px" />
		</center>
	</html>|Bfruity-application}}

	{{:Team:UNITN-Trento/Templates/Styles/ProtocolSpoiler|MeSA Detection|<html>

		<B>Sample preparation</B>
		<p>
			To detect if <I>E. coli</I> actually produced Methyl salicilate (MeSA), we tried both qualitative (SNIFF Test) and quantitative (GC-MS) tests.
		</p>
		<p>
			All the measurement have to start by inocula in the correct antibiotics (CM) of MeSA producing cells and of normal Neb10&beta; in LB without antibiotic as control. The inocula need to be growth O/N at 37&deg;C in agitation. The following day, dilutions 1:100 were done in falcons with fresh LB and the same antibiotic; the cells were growth at 37&deg;C in agitation until O.D.600&asymp;0.6 was reached.
		</p>
		<p>
			Then the cells were induced by adding Arabinose 5mM by a solution 1 M prepared by dissolving 0,150 g in 1 mL of dH2O. After two hours in some of the samples was added Salicylic Acid 2mM by a solution 1 M obtained by dissolving 0,138 g in 1 mL ethanol 70%. Then the culture were put for other 2 hours at 37&deg;C in agitation waiting for the 4 hours of induction to pass.
		</p>
		<p>
			The tests could also been in M9 medium because it smells less than LB. To do this, when cells in LB reached an O.D. of 400 they were centrifuged at 4100 rpm for 10 minutes to form a pellet. The supernatant was discarded and they were resuspended in fresh M9 medium with the correct antibiotic. This was done because E.coli cells growth in M9 in much more time than in LB. The cells were therefore induced with Arabinose and after two hours SA was added where needed.
		</p>
		At this point the samples were ready for different test.
	<br>
	<br>
	                 <B> GC-FID </B>
	<p>
	To have a quantitative analysis we used the <i> Finnigan Trace GC ULTRA </i> with a flame ionization detector (FID). To achieve the final results and finally measure the quantity presents in our samples many tries were done with different conditions and methods. For what concerns the results presented in our wiki the column exploited was a DB5-MS capillary with a total length of 30 m (loops), an internal diameter of 0.25 mm and a film of 0.25 μm. </p>
	<p>
	The temperature program set for all the analyses was taken from literature <span class="tn-ref"> (Deng, C, et al. Investigation of Tomato Plant Defence Response to Tobacco Mosaic Virus by Determination of Methyl Salicylate with SPME-Capillary GC-MS. Chromatographia. 2004, Vol. 59, 3/4, pp. 263-268) </span> and adapted to our experiment in order to decrease the time of each measurement. In particular the program was set to start with  the column at 80°C for 2’, to increase the temperature at the rate of 30°C/min until reaching the temperature of 280°C and maintaining it for 10’. The temperatures of the injector and of the FID were set 280°C. The carrier in the column was He 1.4 mL/min and the flow of the FID was set to be 40 mL/min of H2, 450 mL/min of air and to make up 30 mL/min of N2. The modality of the introduction of the samples in the detector was set to splitless, in particular 70 mL/min.  With these setting the retention index of MeSA was between 10.20-10.27 min. </p>
	<p> 
	The measuraments were done on liquid (the tries done on the headspace of a standard sample by injection of 1 ul of air were not positive). In particular each bacteria sample was before centrifuged and 1 mL of supernatant was filtrated with a 0.22 μm filter and then 1 μL of each sample was injected in gas chromatography to not damage the instrument. Before and after each injection the syringe was washed with acetone or ethanol for 3 times to eliminate any residual.
	</p>


	</html>|MeSA-detection}}

	<html></div>

    <div class="sheet-2">
        <a href="https://2013.igem.org/Team:UNITN-Trento/Notebook">
            <img class="tn-arr-prev" src="https://static.igem.org/mediawiki/2013/6/6f/Tn-2013-arr-Prot_prev.png" />
        </a>
        <a href="javascript:toTop('#tn-main-wrap-wrap');">
            <img src="https://static.igem.org/mediawiki/2013/6/6e/Tn-2013-arr-AAA_TOP.png" />
        </a>
        <a href="https://2013.igem.org/Team:UNITN-Trento/Laboratory/Meetings">
            <img class="tn-arr-next" src="https://static.igem.org/mediawiki/2013/a/ad/Tn-2013-arr-Prot_next.png" />
        </a>
    </div>
</div>

</html>|<html>https://static.igem.org/mediawiki/2013/a/ab/Tn-2013-headerbg-Sfondosb.jpg</html>|<html>https://static.igem.org/mediawiki/2013/7/7e/Tn-2013-headingbg-Sfondosb_or.jpg</html>}}