Team:UC Chile/Team Members
From 2013.igem.org
(Difference between revisions)
Line 295: | Line 295: | ||
<h4>XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA</h4> | <h4>XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA</h4> | ||
<table> | <table> | ||
- | <tr><td class="col1"><b>Occupation</b></td><td>:</td><td>Physicist. | + | <tr><td class="col1"><b>Occupation</b></td><td>:</td><td>Physicist.</td></tr> |
- | <tr><td class="col1"><b>iGEM</b></td><td>:</td><td>Mathematical modeling and Human Practice organization. | + | <tr><td class="col1"><b>iGEM</b></td><td>:</td><td>Mathematical modeling and Human Practice organization.</td></tr> |
- | <tr><td class="col1"><b>Likes to</b></td><td>:</td><td>Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics. | + | <tr><td class="col1"><b>Likes to</b></td><td>:</td><td>Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics.</td></tr> |
- | <tr><td class="col1"><b>Frustrated Dream</b></td><td>:</td><td>Have a good voice, be able to draw, recognize colors, have good eyesight and more time. | + | <tr><td class="col1"><b>Frustrated Dream</b></td><td>:</td><td>Have a good voice, be able to draw, recognize colors, have good eyesight and more time.</td></tr> |
- | <tr><td class="col1"><b>Fun fact</b></td><td>:</td><td>Not a funny guy. | + | <tr><td class="col1"><b>Fun fact</b></td><td>:</td><td>Not a funny guy.</td></tr> |
- | <tr><td class="col1"><b>Lab mistake</b></td><td>:</td><td>Nobody knows how he made a gel that didn’t solidify. | + | <tr><td class="col1"><b>Lab mistake</b></td><td>:</td><td>Nobody knows how he made a gel that didn’t solidify.</td></tr> |
</table> | </table> | ||
</div> | </div> |
Revision as of 16:41, 26 September 2013
Team Members
Magdalena Ribbeck
XX - ATGGCAGGCGATGCACTGGAAAACGCA AGAATTTAATAAGAGTGTAAG
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Videogame realization and lab work. |
Likes to | : | Write, read about psychology, to draw and to practice Judo. |
Frustrated Dream | : | To be a writer. |
Fun fact | : | Reads “Origin of species”, Charles Darwin, for fun. |
Lab mistake | : | Spill chloroform on Valentina. |
Valentina Frenkel
XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Primer design. Wiki and videogame development. Lab work. |
Likes to | : | Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon. |
Frustrated Dream | : | To be able to do better illustrations and play an instrument professionally. |
Fun fact | : | She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings. |
Lab mistake | : | Use the whole stock pHnCBS1D instead of the dilution. |
Felipe Ignacio Erices Canales
XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT
Occupation | : | Civil Engineer in Biotechnology. |
iGEM | : | Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work. |
Likes to | : | Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami. |
Frustrated Dream | : | Not to be ignored, try to keep the lab neat and be able to hibernate. |
Fun fact | : | He can split an apple in half just with his hands. |
Lab mistake | : | Run an important gel without the ladder. |
Ilenne Del Valle.
XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA
Occupation | : | Biochemist |
iGEM | : | Prevention of future complications. Lab work organization and administration. Experimental design. |
Likes to | : | Practice Judo and read. |
Frustrated Dream | : | That the iGEM team doesn’t think that she is sending the emails while angry at them. |
Fun fact | : | She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group. |
Lab mistake | : | Break a huge ellermeyer flask the very first day in the lab and in front of the boss. |
Josefina Philippi
XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA
Occupation | : | Economist and Biologist. |
iGEM | : | Team’s boss. Bureaucratics and lab experiment management. |
Likes to | : | Cook, sitcom series, "The Little Prince" and the beach. |
Frustrated Dream | : | To be a good singer. |
Fun fact | : | She makes the lab explode with dry ice. |
Lab mistake | : | Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform. |
Sebastián Álvarez
XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA
Occupation | : | Biologist. |
iGEM | : | More that he can handle, but not enough to get credit for it. |
Likes to | : | Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff. |
Frustrated Dream | : | To grow a majestic beard, the manliest ever seen. |
Fun fact | : | He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire. |
Lab mistake | : | Leave the centrifuge working with no tubes inside … all night long. |
Javier Cillero
XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA
Occupation | : | Biologist. |
iGEM | : | Lab work and experimental design. |
Likes to | : | Play soccer, go to the stadium, walk under the rain and feel like a fish. |
Frustrated Dream | : | To be a soccer player and be able to play any instrument. |
Fun fact | : | He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!. |
Lab mistake | : | He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box. |
Belén Céspedes
XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT
Occupation | : | Physicist. |
iGEM | : | Mathematical modelling, Human Practices and paper traffic. |
Likes to | : | Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná. |
Frustrated Dream | : | To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil. |
Fun fact | : | She can talk with animals, juggles and rides a monocycle. She’s allergic to everything. |
Lab mistake | : | She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction. |
Manuel Álamo
XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA
Occupation | : | Physicist. |
iGEM | : | Mathematical modeling and Human Practice organization. |
Likes to | : | Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics. |
Frustrated Dream | : | Have a good voice, be able to draw, recognize colors, have good eyesight and more time. |
Fun fact | : | Not a funny guy. |
Lab mistake | : | Nobody knows how he made a gel that didn’t solidify. |