"
Team:UC Chile/Team Members
From 2013.igem.org
(Difference between revisions)
| Line 24: | Line 24: | ||
<div class="new_menu"><!--Inicio de new Menu--> | <div class="new_menu"><!--Inicio de new Menu--> | ||
<div class="h1 hexa" onclick="aux(1)"> | <div class="h1 hexa" onclick="aux(1)"> | ||
| + | <div class="rec d"></div> | ||
| + | <div class="rec d d2"></div> | ||
| + | <div class="rec d d3"></div> | ||
| + | <div class="text">Project</div> | ||
| + | <ul class="sub oculto"> | ||
| + | <li class="pos1 sub_item oculto">Whateversisoma<a href="https://2013.igem.org/Team:UC_Chile/Whateversisome"></a></li> | ||
| + | <li class="pos2 sub_item oculto">Biobricks<a href="https://2013.igem.org/Team:UC_Chile/Biobricks"></a></li> | ||
| + | <li class="pos3 sub_item oculto">Biosafety<a href="https://2013.igem.org/Team:UC_Chile/Biosafety"></a></li> | ||
| + | <li class="pos4 sub_item oculto">Side project<a href="https://2013.igem.org/Team:UC_Chile/Side Project"></a></li> | ||
| + | </ul> | ||
| + | </div> | ||
| + | <div class="h2 hexa" onclick="aux(2)"> | ||
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
| Line 33: | Line 45: | ||
</ul> | </ul> | ||
</div> | </div> | ||
| - | <div class=" | + | <div class="h3 hexa" onclick="aux(3)"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
| Line 43: | Line 55: | ||
</ul> | </ul> | ||
</div> | </div> | ||
| - | <div class=" | + | <div class="h4 hexa sele" onclick="aux(4)"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
<div class="rec d d3"></div> | <div class="rec d d3"></div> | ||
<div class="text">Team</div> | <div class="text">Team</div> | ||
| - | <ul class="sub | + | <ul class="sub "> |
| - | <li class="pos1 sub_item | + | <li class="pos1 sub_item ">Team Members<a href="https://2013.igem.org/Team:UC_Chile/Team Members"></a></li> |
| - | <li class="pos2 sub_item | + | <li class="pos2 sub_item ">PSB Lab<a href="https://2013.igem.org/Team:UC_Chile/PSBL Lab"></a></li> |
| - | <li class="pos3 sub_item | + | <li class="pos3 sub_item ">Photo gallery<a href="https://2013.igem.org/Team:UC_Chile/Photo Gallery"></a></li> |
</ul> | </ul> | ||
</div> | </div> | ||
| - | <div class=" | + | <div class="h5 hexa " onclick="aux(5)"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
<div class="rec d d3"></div> | <div class="rec d d3"></div> | ||
<div class="text">Human<br>Practices</div> | <div class="text">Human<br>Practices</div> | ||
| - | <ul class="sub "> | + | <ul class="sub oculto"> |
| - | <li class="pos1 sub_item ">Home<a href="https://2013.igem.org/Team:UC_Chile/Human Practices"></a></li> | + | <li class="pos1 sub_item oculto">Home<a href="https://2013.igem.org/Team:UC_Chile/Human Practices"></a></li> |
</ul> | </ul> | ||
</div> | </div> | ||
| - | <div class=" | + | <div class="h6 hexa" onclick="aux(6)"> |
<div class="rec d"></div> | <div class="rec d"></div> | ||
<div class="rec d d2"></div> | <div class="rec d d2"></div> | ||
| Line 73: | Line 85: | ||
<li class="pos3 sub_item oculto">Attribution<a href="https://2013.igem.org/Team:UC_Chile/Acknoledgments"></a></li> | <li class="pos3 sub_item oculto">Attribution<a href="https://2013.igem.org/Team:UC_Chile/Acknoledgments"></a></li> | ||
</ul> | </ul> | ||
| - | </div> | + | </div> |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
<div class="h7 hexa" onclick="aux(7)"> | <div class="h7 hexa" onclick="aux(7)"> | ||
<div class="rec d"></div> | <div class="rec d"></div> | ||
Revision as of 16:46, 26 September 2013
Team Members
Magdalena Ribbeck
XX - ATGGCAGGCGATGCACTGGAAAACGCA AGAATTTAATAAGAGTGTAAG
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Videogame realization and lab work. |
| Likes to | : | Write, read about psychology, to draw and to practice Judo. |
| Frustrated Dream | : | To be a writer. |
| Fun fact | : | Reads “Origin of species”, Charles Darwin, for fun. |
| Lab mistake | : | Spill chloroform on Valentina. |
Valentina Frenkel
XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Primer design. Wiki and videogame development. Lab work. |
| Likes to | : | Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon. |
| Frustrated Dream | : | To be able to do better illustrations and play an instrument professionally. |
| Fun fact | : | She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings. |
| Lab mistake | : | Use the whole stock pHnCBS1D instead of the dilution. |
Felipe Ignacio Erices Canales
XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT
| Occupation | : | Civil Engineer in Biotechnology. |
| iGEM | : | Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work. |
| Likes to | : | Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami. |
| Frustrated Dream | : | Not to be ignored, try to keep the lab neat and be able to hibernate. |
| Fun fact | : | He can split an apple in half just with his hands. |
| Lab mistake | : | Run an important gel without the ladder. |
Ilenne Del Valle.
XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA
| Occupation | : | Biochemist |
| iGEM | : | Prevention of future complications. Lab work organization and administration. Experimental design. |
| Likes to | : | Practice Judo and read. |
| Frustrated Dream | : | That the iGEM team doesn’t think that she is sending the emails while angry at them. |
| Fun fact | : | She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group. |
| Lab mistake | : | Break a huge ellermeyer flask the very first day in the lab and in front of the boss. |
Josefina Philippi
XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA
| Occupation | : | Economist and Biologist. |
| iGEM | : | Team’s boss. Bureaucratics and lab experiment management. |
| Likes to | : | Cook, sitcom series, "The Little Prince" and the beach. |
| Frustrated Dream | : | To be a good singer. |
| Fun fact | : | She makes the lab explode with dry ice. |
| Lab mistake | : | Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform. |
Sebastián Álvarez
XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA
| Occupation | : | Biologist. |
| iGEM | : | More that he can handle, but not enough to get credit for it. |
| Likes to | : | Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff. |
| Frustrated Dream | : | To grow a majestic beard, the manliest ever seen. |
| Fun fact | : | He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire. |
| Lab mistake | : | Leave the centrifuge working with no tubes inside … all night long. |
Javier Cillero
XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA
| Occupation | : | Biologist. |
| iGEM | : | Lab work and experimental design. |
| Likes to | : | Play soccer, go to the stadium, walk under the rain and feel like a fish. |
| Frustrated Dream | : | To be a soccer player and be able to play any instrument. |
| Fun fact | : | He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!. |
| Lab mistake | : | He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box. |
Belén Céspedes
XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT
| Occupation | : | Physicist. |
| iGEM | : | Mathematical modelling, Human Practices and paper traffic. |
| Likes to | : | Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná. |
| Frustrated Dream | : | To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil. |
| Fun fact | : | She can talk with animals, juggles and rides a monocycle. She’s allergic to everything. |
| Lab mistake | : | She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction. |
Manuel Álamo
XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA
| Occupation | : | Physicist. |
| iGEM | : | Mathematical modeling and Human Practice organization. |
| Likes to | : | Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics. |
| Frustrated Dream | : | Have a good voice, be able to draw, recognize colors, have good eyesight and more time. |
| Fun fact | : | Not a funny guy. |
| Lab mistake | : | Nobody knows how he made a gel that didn’t solidify. |
