Team:Biwako Nagahama/Material & Method
From 2013.igem.org
(→CelC) |
|||
Line 23: | Line 23: | ||
<p>CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI. </p> | <p>CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI. </p> | ||
[[File:Biwako-Nagahama_T.Ksenpai_celC1.png|500px|]] | [[File:Biwako-Nagahama_T.Ksenpai_celC1.png|500px|]] | ||
+ | <p> Inverse PCR | ||
+ | </p> | ||
+ | <p>※Restriction Enzyme sol.(line No.5 CelC_EcoRI)which has 1M NaCl dissolved in it, so, the band in lane no.5 appeared as upper-side. | ||
+ | </p> | ||
+ | <p> CelC_Fw: TGACGAAAGCACTGATCTGC | ||
+ | |||
+ | </p> | ||
+ | <p> CelC_Rv: GAAAAGATCGAAACGGTGG | ||
+ | </p> | ||
+ | <p> TA cloning of CelC | ||
+ | </p> | ||
+ | <p>16℃ 30min incubate | ||
+ | </p> | ||
+ | <p> Ligation of CelC/pMD20 and Transformation in JM109. | ||
+ | </p> | ||
+ | <p> Cells were stored on ice for 30min. | ||
+ | </p> | ||
+ | <p> After 42℃ 30sec heat shock, cells were stored on ice for 2min. | ||
+ | </p> | ||
+ | <p> Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate. | ||
+ | </p> | ||
+ | <p>6/1 Liquid clluture | ||
+ | </p> | ||
+ | <p> CelC/pMD20 22 samples at 37°C, for overnight. | ||
+ | </p> | ||
+ | <p>6/2 MiniPrep of CelC | ||
+ | </p> | ||
+ | <p> Linear CelC/pMD20 DNA :2736bp. This CelC/pMD20 sample is cccDNA. So,white 6,white 7,white 8,white 9,white 14 probably picked up CelC/pMD20. | ||
+ | </p> | ||
+ | <p>6/3 Restriction Enzyme of CelC/pMD20 | ||
+ | </p> | ||
+ | <p> CelC gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CelC/pMD20 gene has 2 restriction enzyme sites,BamHI | ||
+ | </p> | ||
+ | <p> I confirmed the direction of CelC gene. | ||
+ | </p> | ||
+ | <p>6/ Sequence of CelC/pMD20 | ||
+ | |||
+ | </p> | ||
+ | <p>7/18 PointMutation of CelC | ||
+ | </p> | ||
+ | <p> CelC gene had Restriction Enzyme Site,EcoRI. We directed the EcoRI site. | ||
+ | </p> | ||
+ | <p> Front | ||
+ | </p> | ||
+ | <p> Fw1 Primer: | ||
+ | </p> | ||
+ | <p> TATATATTCTAGATGAAGAGCGGGATTTCG | ||
+ | |||
+ | </p> | ||
+ | <p> Rv2 Primer: | ||
+ | </p> | ||
+ | <p> CATTATATCCGAACTCCGGCTG | ||
+ | </p> | ||
+ | <p> Rear | ||
+ | </p> | ||
+ | <p> Fw2 Primer: | ||
+ | </p> | ||
+ | <p> AGCCGGAGTTCGGATATAATGC | ||
+ | </p> | ||
+ | |||
+ | |||
+ | <p> Rv1 Primer: | ||
+ | </p> | ||
+ | <p> CAGCACGAACTAGTATTATTATCATCGGC | ||
== <h2>Crds</h2> == | == <h2>Crds</h2> == |
Revision as of 18:48, 27 September 2013
Contents |
Material & Method
CelC
Agro Notebook
5/31 Cloning of CelC and Restriction Enzyme
By Koki Tsutsumi
CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI.
Inverse PCR
※Restriction Enzyme sol.(line No.5 CelC_EcoRI)which has 1M NaCl dissolved in it, so, the band in lane no.5 appeared as upper-side.
CelC_Fw: TGACGAAAGCACTGATCTGC
CelC_Rv: GAAAAGATCGAAACGGTGG
TA cloning of CelC
16℃ 30min incubate
Ligation of CelC/pMD20 and Transformation in JM109.
Cells were stored on ice for 30min.
After 42℃ 30sec heat shock, cells were stored on ice for 2min.
Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.
6/1 Liquid clluture
CelC/pMD20 22 samples at 37°C, for overnight.
6/2 MiniPrep of CelC
Linear CelC/pMD20 DNA :2736bp. This CelC/pMD20 sample is cccDNA. So,white 6,white 7,white 8,white 9,white 14 probably picked up CelC/pMD20.
6/3 Restriction Enzyme of CelC/pMD20
CelC gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CelC/pMD20 gene has 2 restriction enzyme sites,BamHI
I confirmed the direction of CelC gene.
6/ Sequence of CelC/pMD20
7/18 PointMutation of CelC
CelC gene had Restriction Enzyme Site,EcoRI. We directed the EcoRI site.
Front
Fw1 Primer:
TATATATTCTAGATGAAGAGCGGGATTTCG
Rv2 Primer:
CATTATATCCGAACTCCGGCTG
Rear
Fw2 Primer:
AGCCGGAGTTCGGATATAATGC
Rv1 Primer:
CAGCACGAACTAGTATTATTATCATCGGC
Crds
</div>
</div>
</div>