Contents 1 Material & Method 1.1 General protocol 1.2 CelC 1.2.1 CrdS 1.2.2 Cloning of CrdS and Restriction Enzyme 1.2.2.1 By Koki Tsutsumi

Material & Method

• General protocol

CelC

Agro Notebook

5/31 Cloning of CelC and Restriction Enzyme

By Koki Tsutsumi

CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI.

Inverse PCR

※Restriction Enzyme sol.(line No.5 CelC_EcoRI)which has 1M NaCl dissolved in it, so, the band in lane no.5 appeared as upper-side.

CelC_Fw: TGACGAAAGCACTGATCTGC

CelC_Rv: GAAAAGATCGAAACGGTGG

TA cloning of CelC

16℃ 30min incubate

Ligation of CelC/pMD20 and Transformation in JM109.

Cells were stored on ice for 30min.

After 42℃ 30sec heat shock, cells were stored on ice for 2min.

Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.

6/1 Liquid clluture

CelC/pMD20 22 samples at 37°C, for overnight.

6/2 MiniPrep of CelC

Linear CelC/pMD20 DNA :2736bp. This CelC/pMD20 sample is cccDNA. So,white 6,white 7,white 8,white 9,white 14 probably picked up CelC/pMD20.

6/3 Restriction Enzyme of CelC/pMD20

CelC gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CelC/pMD20 gene has 2 restriction enzyme sites,BamHI

I confirmed the direction of CelC gene.

6/ Sequence of CelC/pMD20

7/18 PointMutation of CelC

CelC gene had Restriction Enzyme Site,EcoRI. We directed the EcoRI site.

Front

Fw1 Primer:

TATATATTCTAGATGAAGAGCGGGATTTCG

Rv2 Primer:

CATTATATCCGAACTCCGGCTG

Rear

Fw2 Primer:

AGCCGGAGTTCGGATATAATGC

Rv1 Primer:

CAGCACGAACTAGTATTATTATCATCGGC

CrdS

Cloning of CrdS and Restriction Enzyme

By Koki Tsutsumi

<p>CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI.