Team:Biwako Nagahama/Material & Method

From 2013.igem.org

(Difference between revisions)
(CrdS)
(CrdS)
Line 154: Line 154:
<h5>By Koki Tsutsumi</h5>
<h5>By Koki Tsutsumi</h5>
<p>CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI. </p>
<p>CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI. </p>
-
[[File:Biwako-Nagahama_E.P_tutumi1.png|left|160px]]
+
[[File:Biwako-Nagahama_E.P_tutumi1.png|left|155px]]
<div style>
<div style>
<table border="1">
<table border="1">

Revision as of 19:15, 27 September 2013

Contents

Material & Method

CelC

Agro Notebook

5/31 Cloning of CelC and Restriction Enzyme

By Koki Tsutsumi

CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI.

Biwako-Nagahama T.Ksenpai celC1.png

Inverse PCR

※Restriction Enzyme sol.(line No.5 CelC_EcoRI)which has 1M NaCl dissolved in it, so, the band in lane no.5 appeared as upper-side.

CelC_Fw: TGACGAAAGCACTGATCTGC

CelC_Rv: GAAAAGATCGAAACGGTGG

TA cloning of CelC

16℃ 30min incubate

Ligation of CelC/pMD20 and Transformation in JM109.

Cells were stored on ice for 30min.

After 42℃ 30sec heat shock, cells were stored on ice for 2min.

Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.

6/1 Liquid clluture

CelC/pMD20 22 samples at 37°C, for overnight.

6/2 MiniPrep of CelC

Linear CelC/pMD20 DNA :2736bp. This CelC/pMD20 sample is cccDNA. So,white 6,white 7,white 8,white 9,white 14 probably picked up CelC/pMD20.

6/3 Restriction Enzyme of CelC/pMD20

CelC gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CelC/pMD20 gene has 2 restriction enzyme sites,BamHI

I confirmed the direction of CelC gene.

6/ Sequence of CelC/pMD20

7/18 PointMutation of CelC

CelC gene had Restriction Enzyme Site,EcoRI. We directed the EcoRI site.

Front

Fw1 Primer:

TATATATTCTAGATGAAGAGCGGGATTTCG

Rv2 Primer:

CATTATATCCGAACTCCGGCTG

Rear

Fw2 Primer:

AGCCGGAGTTCGGATATAATGC


Rv1 Primer:

CAGCACGAACTAGTATTATTATCATCGGC

7/19 Gel Purification of CelC gene’s Front Fragment and Rear Fragment

Front Fragment DNA and Rear Fragment DNA that 765bp and 347bp band performed Gel Purification by illustra GFX PCR Purification Kit.

7/21 CelC gene’s Front Fragment and Rear Fragment Overlap PCR

No.6,7,8,9,14 each fragment Overlap PCR completed.

I selected No.8.

7/22 Gel Purification of CelC gene No.8

No.8 DNA that about 1ooo bp band performed Gel Purification by illustra GFX PCR Purification Kit.

8/1 Adapter PCR of CelC gene No.8 (BioBrick Part)

Fw Primer:

GTTTCTTCGAATTCGCGGCCGCTTCTAGATG

Rv Primer:

GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATC

8/11 BioBrick of CelC Restrict Enzyme ,EcoRI.

I confirmed BioBrick of CelC non-Restriction Enzyme ,EcoRI.

9/5 Brick Part of CelC and pSB1C3 Restrict Enzyme,EcoRI and PstI.

9/5 Ligation of CelC/pSB1C3 and Transformation in JM109.

9/7 Colony PCR of CelC/pSB1C3

CelC/pSB1C3 DNA(VR-VF2) :1370bp. So,No.5 and No.12 probably picked up CelC/pSB1C3

9/8 Miniprep of CelC/pSB1C3

Linear CelC/pSB1C3 DNA :3126bp. This CelC/pSB1C3 sample is cccDNA. So,No.5 and No.12 probably picked up CelC/pSB1C3.

9/15. Sequence of CelC Brick Part sequence.

Result of NCBI BLAST


CrdS

Cloning of CrdS and Restriction Enzyme

By Koki Tsutsumi

CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI.

Biwako-Nagahama E.P tutumi1.png

1500bp DNA ladder10μL
2λ-HindⅢ12μL
3CrdS12μL
4--
5--
6--
7--
8--
Biwako-Nagahama E.P tutumi2.png