"
Team:MSOE Milwaukee/Primers
From 2013.igem.org
(Difference between revisions)
Vanhandelp (Talk | contribs) |
Vanhandelp (Talk | contribs) |
||
| Line 3: | Line 3: | ||
<TABLE> | <TABLE> | ||
<TR align = center> | <TR align = center> | ||
| - | <TD bgcolor = #649327 width = | + | <TD bgcolor = #649327 width = 200 valign = bottom height = 50><font color = "white" size = "+20">PRIMER</TD> |
| - | <TD bgcolor = #649327 width = | + | <TD bgcolor = #649327 width = 760 valign = bottom height = 50><font color = "white" size = "+20">SEQUENCE (5' to 3')</TD> |
| - | + | ||
</TR> | </TR> | ||
<TR align = center> | <TR align = center> | ||
| - | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2"> | + | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">1,8-cineole synthase forward</TD> |
| - | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2"> | + | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">ATCGGAATTCGCGGCCGCTTCTAGATGGCTACCCTGCGTATC</TD> |
| - | + | ||
</TR> | </TR> | ||
<TR align = center> | <TR align = center> | ||
| - | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2"> | + | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">1,8-cineole synthase reverse</TD> |
| - | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2"> | + | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">GCTAATGATCATCGCCGGCGACGTCCTTATTAACCCAGACGGTTAACG</TD> |
| - | + | ||
</TR> | </TR> | ||
<TR align = center> | <TR align = center> | ||
| Line 30: | Line 27: | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">mvaK2</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">mvaK2</TD> | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">Phosphomevalonate kinase</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">Phosphomevalonate kinase</TD> | ||
| - | |||
</TR> | </TR> | ||
<TR align = center> | <TR align = center> | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">mvaD</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">mvaD</TD> | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">Mevalonate-5-pyrophosphate decarboxylase</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">Mevalonate-5-pyrophosphate decarboxylase</TD> | ||
| - | |||
</TR> | </TR> | ||
<TR align = center> | <TR align = center> | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">TPS-CIN</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">TPS-CIN</TD> | ||
<TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">1,8-cineole synthase</TD> | <TD bgcolor = #9BBB59 width = 320 valign = center height = 50><font color = "white" size = "+2">1,8-cineole synthase</TD> | ||
| - | |||
</TR> | </TR> | ||
</TABLE> | </TABLE> | ||
</HTML> | </HTML> | ||
Revision as of 18:24, 8 July 2013
|
|
|
|
|
|
|
|
|
| PRIMER | SEQUENCE (5' to 3') | |
| 1,8-cineole synthase forward | ATCGGAATTCGCGGCCGCTTCTAGATGGCTACCCTGCGTATC | |
| 1,8-cineole synthase reverse | GCTAATGATCATCGCCGGCGACGTCCTTATTAACCCAGACGGTTAACG | |
| mvaS | HMG-CoA synthase | 1152 |
| mvaK1 | Mevalonate Kinase | 879 |
| mvaK2 | Phosphomevalonate kinase | |
| mvaD | Mevalonate-5-pyrophosphate decarboxylase | |
| TPS-CIN | 1,8-cineole synthase |
