Team:Heidelberg/Templates/DelH overview22
From 2013.igem.org
(Difference between revisions)
(→Results) |
|||
Line 1: | Line 1: | ||
+ | |||
===Results=== | ===Results=== | ||
{| class="wikitable" | {| class="wikitable" | ||
Line 14: | Line 15: | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
<br/> | <br/> | ||
+ | |||
===Vector Maps and Primers=== | ===Vector Maps and Primers=== | ||
Revision as of 11:43, 4 October 2013
Results
Colonies | Alignment File | Sequence |
---|---|---|
III F7 | File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F7.clustal.txt | Mutation |
III F9 | File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F9.clustal.txt | Mutation |
III G3 | File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G3.clustal.txt | Mutation |
III G4 | File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G4.clustal.txt | Mutation |
Vector Maps and Primers
Strategy A: weak Promotor, weak RBS
Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.
Identifier | Order date | Note | Sequence |
---|---|---|---|
FS_78:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev, amplify the Backbone pSB6A1 introducing the RBS BBa_B0032 and the promotor BBa_J23114 and creating an overlap to the first fragment of DelH amplified with primer DN_11 | GATTTGGCGCAGGCGGCCACGG TCCATCTAGTACTTTCCTGTGTGACTCTA GAGCTAGCATTGTACCTAGGACTGAGCT AGCCATAAACTCTAGAAGCGGCCGCGAATTC |
FS_84:BB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify first fragment of DelH introducing the RBS BBa_B0032 and creating an overlap to primer FS_85 thereby partially introducing the promotor BBa_J23114 | GCTCAGTCCTAGGTACAATGCTAGC TCTAGAGTCACACAGGAAAGTACTAGATGGA CCGTGGCCGCCTGCG |
FS_85:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH | GCGATTTGGCGCAGGCGGCCACGGT CCATCTAGTATTTCTCCTCTTTC |
Strategy B: ccdB Construct
Selection for mutated and thus truncated DelH sequences will be minimized by using a ccdB strategy. DelH will be integrated in a pSB4K5 backbone flanked by KpnI and BamHI sites (pFS02). The pSB6A1 backbone will be assembled with a ccdB cassette flanked by KpnI and BamHI sites (pFS03). The final DelH plasmid will be assembled by restriction - ligation of pFS02 and pFS03 to pFS05.
Identifier | Order date | Note | Sequence |
---|---|---|---|
FS_85:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH | GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC |
FS_86:BB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the Backbone pSB4K5 without any promotor introducing a KpnI cutting site for restriction cloning, creates an overlap to DelH and will be used for the ccdB strategy | GGCGATTTGGCGCAGGCGGCCACGGTCCATGTACTTCGAGTCACTAAGGGCTAAC |
FS_87:BB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify the Backbone pSB6A1 introducing a BamHI cutting site for restriction cloning and creating an overlap to the last fragment of DelH | CGCTGGAGTACGCGCTGGACTGAGATCCCAGGCATCAAATAAAACG |
FS_90:ccdB_HPLC_fw | 26-09-2013 | Gibson-Primer fw to amplify the ccdB cassette from the template pDonor Plasmid introducing a KpnI cutting site for restriction cloning, creates an overlap to the promotor BBa_J23114 and will be used for the ccdB strategy | CTCAGTCCTAGGTACAATGCTAGCTCTAGAGTCACACAGGAAAGCAGTAC ACTGGCTGTGTATAAGGGAG |
FS_93:ccdB_HPLC_rev | 26-09-2013 | Gibson-Primer rev to amplify the ccdB cassette from the template pDonor Plasmid introducing a BamHI cutting site for restriction cloning, creates an overlap to the backbone pSB6A1 and will be used for the ccdB strategy | GTTCACCGACAAACAACAGATGATCCGCGTGGATCCGGCTTAC |
FS_94:BB_HPLC_fw | 26-09-2013 | Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy | ATCTGTTGTTTGTCGGTGAACGC |