Team:Heidelberg/Templates/Del week12 overview
From 2013.igem.org
(One intermediate revision not shown) | |||
Line 29: | Line 29: | ||
====Results==== | ====Results==== | ||
+ | |||
{| class="wikitable" | {| class="wikitable" | ||
|- | |- |
Latest revision as of 18:21, 4 October 2013
Contents |
Strategy
As we discovered that there is a predicted promoter located right in front of DelO, we decided to include this promotor into our construct. This should ensure that the genes DelO, DelP and DelL are still expressed in the case that there is a terminator by the end of DelG. For this we designed primer FS_22 which binds right at the predicted promoter. However, this also meant, that we had to change the reverse primer for the DelG fragment in order to enable Gibson assembly of these fragments next to each oterh. Furthermore we created new primers for amplifying DelE, DelF and DelG as we were not successful in amplifying these fragments so far. These primers now offer more potential fragment combinations which can be tested. We hope to get the missing fragments with this new strategy.
Primer pairs, corresponding sequences and usage
Identifier | Order date | Note | Sequence |
---|---|---|---|
FS_21: DelF_fw | 2013-07-13 | Amplification of DelF from Delftia acidovorans Gibson Primer | GACGCCATCTACCACCTGTG |
FS_22: DelOP_short_fw | 2013-08-02 | Amplification of DelOP from Delftia acidovorans inlcuding the recently predicted endogenous Promotor for DelOP Gibson Primer | GATGACGCAGGGCGGCGGAATTTGTTCATC |
FS_23: DelG_long_rv | 2013-07-13 | Amplification of DelG from Delftia acidovorans Gibson primer with overhang to DelOP element including the recently predicted endogenous Promotor | GATGAACAAATTCCGCCGCCCTGCGTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG |
FS_24: DelAE_rv | 2013-07-13 | Amplification of DelAE from Delftia acidovorans Gibson Primer | CAGAAGAATTCCCAGAAGGAGATGTCGAAG |
FS_26: DelFG_rv | 2013-07-13 | Amplification of DelFG from Delftia acidovorans Gibson Primer | GAATTCATCCACGATGATCTGCATG |
Amplification of Del Genes from D. acidovorans DSM-39 genome
Goals
This week we will try to amplify the sequence region of DelF-G with several combinations of primers including both, the intial primers and the recently ordered ones beeing FS_20, FS_21, FS_22, FS_23, FS_24 and FS_26. Furthermore we will continue opimtizing our protocol for the amplification of DelO-P. To evaluate whether the very weak bands on the corresponding agarose gels represent the intended amplicons, we decided to carry out re PCR and test restriction digests.
Results
PCRs from D.acidovorans DSM-39 | ||||
---|---|---|---|---|
Gene(s) | Fragment | Primer combination | Successful? | |
DelA DelB DelC DelD DelE DelF DelG | DelA-E | Primer FS_02 and FS_03 | ||
DelE-G | Primer FS_04 and FS_07 | |||
DelF-G | Primer FS_20 and FS_07 | |||
Primer FS_20 and FS_09 | ||||
Primer FS_21 and FS_09 | ||||
DelG | Primer FS_08 and FS_09 | |||
Primer FS_08 and FS_11_short | ||||
DelO DelP DelL | DelO-P | Primer FS_22 and FS_13 | ||
Primer FS_22 and FS_13_short | ||||
DelL-P | Primer FS_13_short and FS_15_short |
Re-PCRs | ||||
---|---|---|---|---|
Gene(s) | Fragment | Primer combination | Successful? | |
DelE DelF DelG | DelE-G | Primer FS_04 and FS_07 | ||
DelF-G | Primer FS_06 and FS_09 | |||
Primer FS_21 and FS_09 | ||||
DelG | Primer FS_08 and FS_09 | |||
Primer FS_08 and FS_11_short | ||||
DelO DelP DelL | DelO-P | Primer FS_22 and FS_13 |