Team:Heidelberg/Tyrocidine week20 ov

From 2013.igem.org

(Difference between revisions)
(Created page with " ==Primers ordered for Interspecies Fusion Experiments== {|class="wikitable" |- ! Identifier !! Order date !! Note !! Sequence |- | PW26:TycC5dC_fwd || 2013-09-04 || Amplificatio...")
(Primers ordered for Interspecies Fusion Experiments)
 
Line 1: Line 1:
 +
 +
==GeneBank File of Tyrocidine Cluster==
 +
[[File:Heidelberg Tyrocidine cluster.gb]]
==Primers ordered for Interspecies Fusion Experiments==
==Primers ordered for Interspecies Fusion Experiments==

Latest revision as of 03:51, 5 October 2013

GeneBank File of Tyrocidine Cluster

File:Heidelberg Tyrocidine cluster.gb

Primers ordered for Interspecies Fusion Experiments

Identifier Order date Note Sequence
PW26:TycC5dC_fwd 2013-09-04 Amplification of TycC5-module without C-domain from Brevibacillus parabrevis; no Gibson overhang, ATG added; for constructs A & B ATGCTGCACAGCTTCCTCGCAACC
PW27:TycC5dC-C(TycC4)_rev 2013-09-04 Amplification of TycC5-module without C-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4; for constructs A & B CACATACGTCTCTTTTCCGCTCGT TTCGATGAACGCCGCCAGTTC
PW28:TycC5dC-C(TycC4)_fwd 2013-09-04 Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC5-module without C-domain; for constructs A & B GAACTGGCGGCGTTCATCGAA ACGAGCGGAAAAGAGACGTATGTG
PW29:C(TycC4)-TycC4dC_rev 2013-09-04 Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC4-module without C-domain; for constructs A, B, C, E & G GAATCGTCAGATCGCGCGGATA GGCAAACGTGTTGTTGAAATC
PW30:C(TycC4)-TycC4dC_fwd 2013-09-04 Amplification of TycC4-module without C-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs A, B, C, E & G GATTTCAACAACACGTTTGCC TATCCGCGCGATCTGACGATTC
PW31:TycC4-C(TycC4)_rev 2013-09-04 Amplification of TycC4-module from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs B & C CACATACGTCTCTTTTCCGCTCGT GGCAATATGCGCAGCCAACTCATG
PW32:TycC4-C(TycC4)_fwd 2013-09-04 Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC4-module; for constructs B & C CATGAGTTGGCTGCGCATATTGCC ACGAGCGGAAAAGAGACGTATGTG
PW33:TycC6dTE-C(TycC2)_rev 2013-09-04 Amplification of TycC6-module without the TE-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC2-module; for constructs D & F GGTGTACTCGGTTTTTTCCGA CGTGATGAAATCGGCCACCTTTTC
PW34:TycC6dTE-C(TycC2)_fwd 2013-09-04 Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycC6-module without TE-domain; for constructs D & F GAAAAGGTGGCCGATTTCATCACG TCGGAAAAAACCGAGTACACC
PW35:TycC6dTE-C(TycC4)_rev 2013-09-04 Amplification of TycC6-module without the TE-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs E & G CACATACGTCTCTTTTCCGCTCGT CGTGATGAAATCGGCCACCTTTTC
PW36:TycC6dTE-C(TycC4)_fwd 2013-09-04 Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC6-module without TE-domain; for constructs E & G GAAAAGGTGGCCGATTTCATCACG ACGAGCGGAAAAGAGACGTATGTG
PW37:pSB1C3-TycC5dC_rev 2013-09-04 Insertion of constructs A & B in pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC5-module without C-domain; for constructs A & B GGTTGCGAGGAAGCTGTGCAGCAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG