Team:Heidelberg/Tyrocidine week20 ov
From 2013.igem.org
(Difference between revisions)
(Created page with " ==Primers ordered for Interspecies Fusion Experiments== {|class="wikitable" |- ! Identifier !! Order date !! Note !! Sequence |- | PW26:TycC5dC_fwd || 2013-09-04 || Amplificatio...") |
(→Primers ordered for Interspecies Fusion Experiments) |
||
Line 1: | Line 1: | ||
+ | |||
+ | ==GeneBank File of Tyrocidine Cluster== | ||
+ | [[File:Heidelberg Tyrocidine cluster.gb]] | ||
==Primers ordered for Interspecies Fusion Experiments== | ==Primers ordered for Interspecies Fusion Experiments== |
Latest revision as of 03:51, 5 October 2013
GeneBank File of Tyrocidine Cluster
File:Heidelberg Tyrocidine cluster.gb
Primers ordered for Interspecies Fusion Experiments
Identifier | Order date | Note | Sequence |
---|---|---|---|
PW26:TycC5dC_fwd | 2013-09-04 | Amplification of TycC5-module without C-domain from Brevibacillus parabrevis; no Gibson overhang, ATG added; for constructs A & B | ATGCTGCACAGCTTCCTCGCAACC |
PW27:TycC5dC-C(TycC4)_rev | 2013-09-04 | Amplification of TycC5-module without C-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4; for constructs A & B | CACATACGTCTCTTTTCCGCTCGT TTCGATGAACGCCGCCAGTTC |
PW28:TycC5dC-C(TycC4)_fwd | 2013-09-04 | Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC5-module without C-domain; for constructs A & B | GAACTGGCGGCGTTCATCGAA ACGAGCGGAAAAGAGACGTATGTG |
PW29:C(TycC4)-TycC4dC_rev | 2013-09-04 | Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC4-module without C-domain; for constructs A, B, C, E & G | GAATCGTCAGATCGCGCGGATA GGCAAACGTGTTGTTGAAATC |
PW30:C(TycC4)-TycC4dC_fwd | 2013-09-04 | Amplification of TycC4-module without C-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs A, B, C, E & G | GATTTCAACAACACGTTTGCC TATCCGCGCGATCTGACGATTC |
PW31:TycC4-C(TycC4)_rev | 2013-09-04 | Amplification of TycC4-module from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs B & C | CACATACGTCTCTTTTCCGCTCGT GGCAATATGCGCAGCCAACTCATG |
PW32:TycC4-C(TycC4)_fwd | 2013-09-04 | Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC4-module; for constructs B & C | CATGAGTTGGCTGCGCATATTGCC ACGAGCGGAAAAGAGACGTATGTG |
PW33:TycC6dTE-C(TycC2)_rev | 2013-09-04 | Amplification of TycC6-module without the TE-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC2-module; for constructs D & F | GGTGTACTCGGTTTTTTCCGA CGTGATGAAATCGGCCACCTTTTC |
PW34:TycC6dTE-C(TycC2)_fwd | 2013-09-04 | Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycC6-module without TE-domain; for constructs D & F | GAAAAGGTGGCCGATTTCATCACG TCGGAAAAAACCGAGTACACC |
PW35:TycC6dTE-C(TycC4)_rev | 2013-09-04 | Amplification of TycC6-module without the TE-domain from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC4-module; for constructs E & G | CACATACGTCTCTTTTCCGCTCGT CGTGATGAAATCGGCCACCTTTTC |
PW36:TycC6dTE-C(TycC4)_fwd | 2013-09-04 | Amplification of C-domain from TycC4-module from Brevibacillus parabrevis; Gibson overhang to TycC6-module without TE-domain; for constructs E & G | GAAAAGGTGGCCGATTTCATCACG ACGAGCGGAAAAGAGACGTATGTG |
PW37:pSB1C3-TycC5dC_rev | 2013-09-04 | Insertion of constructs A & B in pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC5-module without C-domain; for constructs A & B | GGTTGCGAGGAAGCTGTGCAGCAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG |