|
|
| (12 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| - | {{:Team:Paris_Bettencourt/Wiki}}
| |
| - | {{:Team:Paris_Bettencourt/Menu}}
| |
| - | <html>
| |
| | | | |
| - | <img src="https://static.igem.org/mediawiki/2013/3/3e/PB_notebookbanner.png"/>
| |
| - | <?php
| |
| - | header("X-XSS-Protection: 0");
| |
| - | ?>
| |
| - | <script type="text/javascript" src="https://2012.igem.org/Team:Paris_Bettencourt/js/RunOnLoad.js?action=raw&ctype=text/javascript"></script>
| |
| - | <script type="text/javascript" src="https://2012.igem.org/Team:Paris_Bettencourt/js/CollapsibleLists?action=raw&ctype=text/javascript"></script>
| |
| - | <script type="text/javascript">
| |
| - | runOnLoad(function(){ CollapsibleLists.apply(); });
| |
| - | </script>
| |
| - |
| |
| - | <style type="text/css">
| |
| - | #page {
| |
| - | font-size:15px;
| |
| - | }
| |
| - | #page p {
| |
| - | margin-bottom: 2px;
| |
| - | font-size:15px;
| |
| - | }
| |
| - | #page ul{
| |
| - | font-size:15px;
| |
| - | }
| |
| - | /* CSS Tree menu styles */
| |
| - | #page #leftscroll li::before, #page #leftscroll li li::before {
| |
| - | content: "";
| |
| - | }
| |
| - | #page #leftscroll li li {
| |
| - | padding-left:1.5em;
| |
| - | }
| |
| - | #page #leftscroll li {
| |
| - | margin:0;
| |
| - | padding:0;
| |
| - | cursor: auto;
| |
| - | }
| |
| - | .treeView{
| |
| - | -moz-user-select:none;
| |
| - | position:relative;
| |
| - | list-style-type: none;
| |
| - | text-decoration: none;
| |
| - | }
| |
| - | .treeView ul{
| |
| - | margin:0 0 0 -1.5em;
| |
| - | padding:0 0 0 1.5em;
| |
| - | }
| |
| - | .treeView ul ul{
| |
| - | }
| |
| - | .treeView li.lastChild > ul{
| |
| - | background-image:none;
| |
| - | }
| |
| - | .treeView li{
| |
| - | margin:0;
| |
| - | padding:0;
| |
| - | list-style-position:inside;
| |
| - | list-style-image:url('https://static.igem.org/mediawiki/2013/1/17/PB_CL_Button.png');
| |
| - | cursor:auto;
| |
| - | }
| |
| - | .treeView li.collapsibleListOpen{
| |
| - | list-style-image:url('https://static.igem.org/mediawiki/2013/4/4a/PB_CL_Button-open.png');
| |
| - | cursor:pointer;
| |
| - | }
| |
| - | .treeView li.collapsibleListClosed{
| |
| - | list-style-image:url('https://static.igem.org/mediawiki/2013/3/3b/PB_CL_Button-closed.png');
| |
| - | cursor:pointer;
| |
| - | }
| |
| - | .treeView li li{
| |
| - | padding-left:1.5em;
| |
| - | }
| |
| - | .treeView li.lastChild{
| |
| - | }
| |
| - | .treeView li.collapsibleListOpen{
| |
| - | }
| |
| - | .treeView li.collapsibleListOpen.lastChild{
| |
| - | }
| |
| - |
| |
| - | #leftscroll{
| |
| - | float: left;
| |
| - | width: 330px;;
| |
| - | height: 600px;
| |
| - | overflow-x: scroll;
| |
| - | overflow-y: scroll;
| |
| - | overflow: scroll;
| |
| - | display:display;
| |
| - | font-size:17px;
| |
| - | }
| |
| - |
| |
| - | #rightscroll{
| |
| - | /*display: inline;*/
| |
| - | margin-left:32%;
| |
| - | width: 748px;
| |
| - | height: 600px;
| |
| - | overflow-x: scroll;
| |
| - | overflow-y: scroll;
| |
| - | overflow: scroll;
| |
| - | }
| |
| - |
| |
| - | .tbnote {
| |
| - | width: 95%;
| |
| - | margin-left:2.5%;
| |
| - | }
| |
| - | .tbnote h2 {
| |
| - | float:left;
| |
| - | width: 87%;
| |
| - | }
| |
| - | .tbnotelogo {
| |
| - | float:right;
| |
| - | display:block;
| |
| - | height:60px;
| |
| - | width:60px;
| |
| - | text-indent:100%;
| |
| - | white-space:nowrap;
| |
| - | target:blank;
| |
| - | background-size:60px 60px;
| |
| - | }
| |
| - | .DSlogo {
| |
| - | background-image:url('https://static.igem.org/mediawiki/2013/1/11/PB_TargetIcon.gif');
| |
| - | }
| |
| - | .PSlogo {
| |
| - | width:40px;
| |
| - | background-size:40px 60px;
| |
| - | background-image:url('https://static.igem.org/mediawiki/2013/0/0b/PB_detecticon.gif');
| |
| - | }
| |
| - | .THlogo {
| |
| - | background-image:url('https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage');
| |
| - | }
| |
| - | .TClogo {
| |
| - | background-image:url('https://static.igem.org/mediawiki/2013/6/6c/PB_infiltrate.gif');
| |
| - | }
| |
| - | </style>
| |
| - |
| |
| - | <div id="page">
| |
| - | <div id="leftscroll">
| |
| - | <ul class="treeView">
| |
| - | <li>
| |
| - | DAY NOTES
| |
| - | <ul class=" collapsibleList">
| |
| - | <li class=" collapsibleListClosed">
| |
| - | DETECT
| |
| - | <ul style="display: none;">
| |
| - | <li class=" collapsibleList">
| |
| - | July
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#detect_Saturday_13th_July.html"> Saturday 13<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Sunday_14th_July.html"> Sunday 14<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Monday_15th_July.html"> Monday 15<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_16th_July.html"> Tuesday 16<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_17th_July.html"> Wednesday 17<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_18th_July.html"> Thursday 18<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Monday_22nd_July.html"> Monday 22<sup>nd</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_23rd_July.html"> Tuesday 23<sup>rd</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Monday_29th_July.html"> Monday 29<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_30th_July.html"> Tuesday 30<sup>th</sup> July</a></li>
| |
| - | <li class="lastChild"><a href="#detect_Wednesday_31st_July.html"> Wednesday 31<sup>st</sup> July</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | August
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#detect_Thursday_1st_August.html"> Thursday 1<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Friday_2nd_August.html"> Friday 2<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Monday_5th_August.html"> Monday 5<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_6th_August.html"> Tuesday 6<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_7th_August.html"> Wednesday 7<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_8th_August.html"> Thursday 8<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Friday_9th_August.html"> Friday 9<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Saturday_10th_August.html"> Saturday 10<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Sunday_11th_August.html"> Sunday 11<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Monday_12th_August.html"> Monday 12<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_13th_August.html"> Tuesday 13<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_14th_August.html"> Wednesday 14<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_15th_August.html"> Thursday 15<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Friday_16th_August.html"> Friday 16<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Monday_19th_August.html"> Monday 19<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_20th_August.html"> Tuesday 20<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_21st_August.html"> Wednesday 21<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_22nd_August.html"> Thursday 22<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Friday_23rd_August.html"> Friday 23<sup>rd</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Sunday_25th_August.html"> Sunday 25<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Monday_26th_August.html"> Monday 26<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_27th_August.html"> Tuesday 27<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_28th_August.html"> Wednesday 28<sup>th</sup> August</a></li>
| |
| - | <li class="lastChild"><a href="#detect_Friday_30th_August.html"> Friday 30<sup>th</sup> August</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | September
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#detect_Tuesday_3rd_September.html"> Tuesday 3<sup>rd</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_4th_September.html"> Wednesday 4<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_5th_September.html"> Thursday 5<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Friday_6th_September.html"> Friday 6<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Saturday_7th_September.html"> Saturday 7<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Sunday_8th_September.html"> Sunday 8<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Monday_16th_September.html"> Monday 16<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_17th_September.html"> Tuesday 17<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_18th_September.html"> Wednesday 18<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Sunday_22nd_September.html"> Sunday 22<sup>nd</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Monday_23rd_September.html"> Monday 23<sup>rd</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_24th_September.html"> Tuesday 24<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_25th_September.html"> Wednesday 25<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_26th_September.html"> Thursday 26<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Friday_27th_September.html"> Friday 27<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#detect_Saturday_28th_September.html"> Saturday 28<sup>th</sup> September</a></li>
| |
| - | <li class="lastChild"><a href="#detect_Monday_30th_September.html"> Monday 30<sup>th</sup> September</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | October
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#detect_Tuesday_1st_October.html"> Tuesday 1<sup>st</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_2nd_October.html"> Wednesday 2<sup>nd</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_3rd_October.html"> Thursday 3<sup>rd</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Monday_14th_October.html"> Monday 14<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_15th_October.html"> Tuesday 15<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Wednesday_16th_October.html"> Wednesday 16<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_17th_October.html"> Thursday 17<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Friday_18th_October.html"> Friday 18<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Saturday_19th_October.html"> Saturday 19<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Tuesday_22nd_October.html"> Tuesday 22<sup>nd</sup> October</a></li>
| |
| - | <li class=""><a href="#detect_Thursday_24th_October.html"> Thursday 24<sup>th</sup> October</a></li>
| |
| - | <li class="lastChild"><a href="#detect_Friday_25th_October.html"> Friday 25<sup>th</sup> October</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleListClosed">
| |
| - | TARGET
| |
| - | <ul style="display: none;">
| |
| - | <li class=" collapsibleList">
| |
| - | June
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#target_Monday_10th_June.html"> Monday 10<sup>th</sup> June</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_11th_June.html"> Tuesday 11<sup>th</sup> June</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_12th_June.html"> Wednesday 12<sup>th</sup> June</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_18th_June.html"> Tuesday 18<sup>th</sup> June</a></li>
| |
| - | <li class="lastChild"><a href="#target_Monday_24th_June.html"> Monday 24<sup>th</sup> June</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | July
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#target_Monday_1st_July.html"> Monday 1<sup>st</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_2nd_July.html"> Tuesday 2<sup>nd</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_3rd_July.html"> Wednesday 3<sup>rd</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Thursday_4th_July.html"> Thursday 4<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Friday_5th_July.html"> Friday 5<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_16th_July.html"> Tuesday 16<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_17th_July.html"> Wednesday 17<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Thursday_18th_July.html"> Thursday 18<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#target_Friday_19th_July.html"> Friday 19<sup>th</sup> July</a></li>
| |
| - | <li class="lastChild"><a href="#target_Wednesday_24th_July.html"> Wednesday 24<sup>th</sup> July</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | August
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#target_Monday_5th_August.html"> Monday 5<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_6th_August.html"> Tuesday 6<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Monday_19th_August.html"> Monday 19<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_20th_August.html"> Tuesday 20<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_21st_August.html"> Wednesday 21<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Thursday_22nd_August.html"> Thursday 22<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Friday_23rd_August.html"> Friday 23<sup>rd</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Saturday_24th_August.html"> Saturday 24<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Sunday_25th_August.html"> Sunday 25<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Monday_26th_August.html"> Monday 26<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_27th_August.html"> Tuesday 27<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_28th_August.html"> Wednesday 28<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#target_Thursday_29th_August.html"> Thursday 29<sup>th</sup> August</a></li>
| |
| - | <li class="lastChild"><a href="#target_Friday_30th_August.html"> Friday 30<sup>th</sup> August</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | September
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#target_Monday_9th_September.html"> Monday 9<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_10th_September.html"> Tuesday 10<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Monday_16th_September.html"> Monday 16<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Tuesday_17th_September.html"> Tuesday 17<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_18th_September.html"> Wednesday 18<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Thursday_19th_September.html"> Thursday 19<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Saturday_21st_September.html"> Saturday 21<sup>st</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Sunday_22nd_September.html"> Sunday 22<sup>nd</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Friday_27th_September.html"> Friday 27<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Saturday_28th_September.html"> Saturday 28<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#target_Sunday_29th_September.html"> Sunday 29<sup>th</sup> September</a></li>
| |
| - | <li class="lastChild"><a href="#target_Monday_30th_September.html"> Monday 30<sup>th</sup> September</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | October
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#target_Tuesday_1st_October.html"> Tuesday 1<sup>st</sup> October</a></li>
| |
| - | <li class=""><a href="#target_Wednesday_2nd_October.html"> Wednesday 2<sup>nd</sup> October</a></li>
| |
| - | <li class="lastChild"><a href="#target_Thursday_3rd_October.html"> Thursday 3<sup>rd</sup> October</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleListClosed">
| |
| - | INFILTRATE
| |
| - | <ul style="display: none;">
| |
| - | <li class=" collapsibleList">
| |
| - | July
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#infiltrate_Monday_22nd_July.html"> Monday 22<sup>nd</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_23rd_July.html"> Tuesday 23<sup>rd</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_24th_July.html"> Wednesday 24<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_25th_July.html"> Thursday 25<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_26th_July.html"> Friday 26<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_29th_July.html"> Monday 29<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_30th_July.html"> Tuesday 30<sup>th</sup> July</a></li>
| |
| - | <li class="lastChild"><a href="#infiltrate_Wednesday_31st_July.html"> Wednesday 31<sup>st</sup> July</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | August
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#infiltrate_Thursday_1st_August.html"> Thursday 1<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_2nd_August.html"> Friday 2<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_5th_August.html"> Monday 5<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_6th_August.html"> Tuesday 6<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_7th_August.html"> Wednesday 7<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_8th_August.html"> Thursday 8<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_12th_August.html"> Monday 12<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_13th_August.html"> Tuesday 13<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_14th_August.html"> Wednesday 14<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_15th_August.html"> Thursday 15<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_16th_August.html"> Friday 16<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Saturday_17th_August.html"> Saturday 17<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Sunday_18th_August.html"> Sunday 18<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_19th_August.html"> Monday 19<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_20th_August.html"> Tuesday 20<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_21st_August.html"> Wednesday 21<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_22nd_August.html"> Thursday 22<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_26th_August.html"> Monday 26<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_27th_August.html"> Tuesday 27<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_28th_August.html"> Wednesday 28<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_29th_August.html"> Thursday 29<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_30th_August.html"> Friday 30<sup>th</sup> August</a></li>
| |
| - | <li class="lastChild"><a href="#infiltrate_Saturday_31st_August.html"> Saturday 31<sup>st</sup> August</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | September
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#infiltrate_Monday_2nd_September.html"> Monday 2<sup>nd</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_3rd_September.html"> Tuesday 3<sup>rd</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_4th_September.html"> Wednesday 4<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_5th_September.html"> Thursday 5<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_6th_September.html"> Friday 6<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Saturday_7th_September.html"> Saturday 7<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_9th_September.html"> Monday 9<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_10th_September.html"> Tuesday 10<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_11th_September.html"> Wednesday 11<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_12th_September.html"> Thursday 12<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_13th_September.html"> Friday 13<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Saturday_14th_September.html"> Saturday 14<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Sunday_15th_September.html"> Sunday 15<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_16th_September.html"> Monday 16<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_17th_September.html"> Tuesday 17<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_18th_September.html"> Wednesday 18<sup>th</sup> September</a></li>
| |
| - | <li class="lastChild"><a href="#infiltrate_Friday_20th_September.html"> Friday 20<sup>th</sup> September</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | October
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#infiltrate_Tuesday_15th_October.html"> Tuesday 15<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Wednesday_16th_October.html"> Wednesday 16<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Thursday_17th_October.html"> Thursday 17<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Friday_18th_October.html"> Friday 18<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Saturday_19th_October.html"> Saturday 19<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Sunday_20th_October.html"> Sunday 20<sup>th</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Monday_21st_October.html"> Monday 21<sup>st</sup> October</a></li>
| |
| - | <li class=""><a href="#infiltrate_Tuesday_22nd_October.html"> Tuesday 22<sup>nd</sup> October</a></li>
| |
| - | <li class="lastChild"><a href="#infiltrate_Saturday_26th_October.html"> Saturday 26<sup>th</sup> October</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleListClosed">
| |
| - | SABOTAGE
| |
| - | <ul style="display: none;">
| |
| - | <li class=" collapsibleList">
| |
| - | June
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#sabotage_Monday_24th_June.html"> Monday 24<sup>th</sup> June</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_25th_June.html"> Tuesday 25<sup>th</sup> June</a></li>
| |
| - | <li class="lastChild"><a href="#sabotage_Friday_28th_June.html"> Friday 28<sup>th</sup> June</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | July
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#sabotage_Tuesday_2nd_July.html"> Tuesday 2<sup>nd</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_3rd_July.html"> Wednesday 3<sup>rd</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_4th_July.html"> Thursday 4<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Monday_15th_July.html"> Monday 15<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_16th_July.html"> Tuesday 16<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_17th_July.html"> Wednesday 17<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_18th_July.html"> Thursday 18<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Friday_19th_July.html"> Friday 19<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Saturday_20th_July.html"> Saturday 20<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Monday_22nd_July.html"> Monday 22<sup>nd</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_23rd_July.html"> Tuesday 23<sup>rd</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_24th_July.html"> Wednesday 24<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_25th_July.html"> Thursday 25<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Friday_26th_July.html"> Friday 26<sup>th</sup> July</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_30th_July.html"> Tuesday 30<sup>th</sup> July</a></li>
| |
| - | <li class="lastChild"><a href="#sabotage_Wednesday_31st_July.html"> Wednesday 31<sup>st</sup> July</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | August
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#sabotage_Thursday_1st_August.html"> Thursday 1<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Monday_12th_August.html"> Monday 12<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_13th_August.html"> Tuesday 13<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_14th_August.html"> Wednesday 14<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_15th_August.html"> Thursday 15<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Friday_16th_August.html"> Friday 16<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Saturday_17th_August.html"> Saturday 17<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Monday_19th_August.html"> Monday 19<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_20th_August.html"> Tuesday 20<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_21st_August.html"> Wednesday 21<sup>st</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_22nd_August.html"> Thursday 22<sup>nd</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Friday_23rd_August.html"> Friday 23<sup>rd</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Monday_26th_August.html"> Monday 26<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_27th_August.html"> Tuesday 27<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_28th_August.html"> Wednesday 28<sup>th</sup> August</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_29th_August.html"> Thursday 29<sup>th</sup> August</a></li>
| |
| - | <li class="lastChild"><a href="#sabotage_Friday_30th_August.html"> Friday 30<sup>th</sup> August</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | <li class=" collapsibleList">
| |
| - | September
| |
| - | <ul style="display: none;">
| |
| - | <li class=""><a href="#sabotage_Tuesday_3rd_September.html"> Tuesday 3<sup>rd</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_4th_September.html"> Wednesday 4<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Thursday_5th_September.html"> Thursday 5<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Saturday_7th_September.html"> Saturday 7<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Tuesday_10th_September.html"> Tuesday 10<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_11th_September.html"> Wednesday 11<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Saturday_14th_September.html"> Saturday 14<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Sunday_15th_September.html"> Sunday 15<sup>th</sup> September</a></li>
| |
| - | <li class=""><a href="#sabotage_Wednesday_18th_September.html"> Wednesday 18<sup>th</sup> September</a></li>
| |
| - | <li class="lastChild"><a href="#sabotage_Friday_20th_September.html"> Friday 20<sup>th</sup> September</a></li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </li>
| |
| - | </ul>
| |
| - | </div>
| |
| - | <div id="rightscroll">
| |
| - |
| |
| - | <html><div id="detect_Saturday_13th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 13<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR circular and linear, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert, Gel of PCR
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>PCR circular and linear, 40.5°C, 60°</b>
| |
| - | of pSB1A3, pSB1C3<br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD></TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37.25 ul</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10 ul</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1 ul</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 uM)</TD><TD>0.5 ul</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 uM)</TD><TD>0.5 ul</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25 ul</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5 ul</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50 ul</TD></TR>
| |
| - | </TABLE><br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Thermocycler Protocol: NEB Phusion</b></TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD>Temp</TD><TD>Time</TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Start</TD><TD>98°C</TD><TD>30 sec</TD><TD>Melt</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Cycle 1</TD><TD>98°C</TD><TD>5 sec</TD><TD>Melt</TD><TD> 35 cycles </TD></TR>
| |
| - | <TR><TD>Cycle 2</TD><TD>40.5°C / 60°C </TD><TD>25 sec</TD><TD>Anneal</TD><TD></TD></TR>
| |
| - | <TR><TD>Cycle 3</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Finish</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD>Store</TD><TD>10°C</TD><TD>Forever</TD><TD>Store</TD><TD> </TD></TR>
| |
| - | </TABLE><br>
| |
| - | <br>
| |
| - |
| |
| - | <b>Conjugation of XL-10 (with sSP011)</b><br>
| |
| - | 1) From O/N cultures Dilute strains 1/100 in LB<br>
| |
| - | 2) Wait for OD to reach O,2<br>
| |
| - | 3) Prepare tube (in BD tubes) :<br>
| |
| - | - Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)<br>
| |
| - | 4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)<br>
| |
| - | 5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)<br>
| |
| - | 6) Incubate overnight at 37°C<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Patches</b><br>
| |
| - | check and make new ones<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Digestion M13 backbone, RFP insert</b><br>
| |
| - | for Backbone (M13mp18 plasmid): 3ug<br>
| |
| - | 7,58 ul plasmid (c=395ng/ul)<br>
| |
| - | 3 ul EcoRI<br>
| |
| - | 3 ul PstI<br>
| |
| - | 3ul 10x Fast Digest<br>
| |
| - | 13,42 ul H20<br>
| |
| - | incubate for 12 min on 37°<br>
| |
| - | heat inactivation: 80° 5 min<br>
| |
| - | for insert (BBa_J04450): 5ug<br>
| |
| - | 31,4 ul plasmid<br>
| |
| - | 5 ul EcoRi<br>
| |
| - | 5 ul PstI<br>
| |
| - | 3,6 ul H20<br>
| |
| - | incubate for 20 min at 37°<br>
| |
| - | heat inactivation: 80° 5min<br>
| |
| - | <br>
| |
| - | <b>Gel of PCR </b> (Amp 40.5 circ, lin, Chl 60° lin, circ)<br>
| |
| - | 100V, 20 min 1% gel<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Sunday_14th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 14<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of PCR, Gel Extraction, DpnI digest of PCR products and PCR purification
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel of PCR</b> (Amp 60° circ, lin, Chl 40.5 circ, lin)<br>
| |
| - | 100V, 20 min 1% gel<br>
| |
| - | <br>
| |
| - | <b>Gel of Digest</b><br>
| |
| - | 100V, 20 min 1% gel<br>
| |
| - | <br>
| |
| - | <b>Gel Extraction</b><br>
| |
| - | Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.<br>
| |
| - | Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.
| |
| - | After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).<br>
| |
| - | Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.<br>
| |
| - | Discard flow-through and place QIAquick column back in the same collection tube.<br>
| |
| - | To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.<br>
| |
| - | 11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
| |
| - | 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>DpnI digest of PCR products</b>:<br>
| |
| - | SPCR4 (40ul) - add 1 ul DpnI<br>
| |
| - | SPCR 7 (150ul) - add 3 ul of DpnI<br>
| |
| - | SPCR8 (60 ul) - add 3 ul of DpnI<br>
| |
| - | SPCR 9 (150ul) - add 3 ul of DpnI<br>
| |
| - | SPCR10 (110ul) - add 3 ul of DpnI<br>
| |
| - | Incubate for 15 min at 37°C<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>PCR purification</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Monday_15th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 15<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Plating and control of antibiotic resistance.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We made a 1:1000 dilution of KAN (stand.c) in an LB solid media.<br>
| |
| - | <br>
| |
| - | Pouring the plates. Around 20 mL/plate<br>
| |
| - | 1. KEIOΔPYR KANR Growth<br>
| |
| - | 2. ME1655 KANR No growth<br>
| |
| - | <br>
| |
| - | Conclusion : <br>
| |
| - | <br>
| |
| - | The KEIOΔPYRF growed as expected. Negative control did not growth.<br>
| |
| - | Plates have KAN antibiotic<br>
| |
| - | KEIO has KAN R.<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_16th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | We prepared a colony PCR to send the KAN for sequencing, to know exactly the sequence of the KAN.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | KEIOΔMPYRF has a deletion of PYRF to be replaced by KAN<br>
| |
| - | We pitched 4 singles colonies into 50µL of H2O<br>
| |
| - | Boil 5 minutes at 95°C<br>
| |
| - | 1,5 µL of this can be used directly for PCR<br>
| |
| - | <br>
| |
| - | PCR reaction<br>
| |
| - | Keep all the regents at 4°C while preparing the mixture<br>
| |
| - | <br>
| |
| - | <table border>
| |
| - | <TR><TD>Reagent</TD><TD>Volume</TD></TR>
| |
| - | <TR><TD>JW 182 (10 uM)<br>
| |
| - | JW 183 (10 uM)<br>
| |
| - | Template DNA<br>
| |
| - | Quick-load Tag 2x Master Mix<br>
| |
| - | Nuclease free water</TD><TD>0,5 µL<br>
| |
| - | 0,5 µL<br>
| |
| - | 1,5 µL<br>
| |
| - | 12,5 µL<br>
| |
| - | 10 µL</TD></TR>
| |
| - | <TR><TD>Total volume</TD><TD>25 µL</TD></TR>
| |
| - | </TABLE><br>
| |
| - | <br>
| |
| - | Thermocycler Protocol : NEB Quick-Load<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> Temperature </td>
| |
| - | <td> Time </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start<br>
| |
| - | <br>
| |
| - | Cycle1<br>
| |
| - | Cycle 2<br>
| |
| - | Cycle 3<br>
| |
| - | <br>
| |
| - | Finish<br>
| |
| - | Store</td>
| |
| - | <td>95°C<br>
| |
| - | <br>
| |
| - | 95°C<br>
| |
| - | 50°C<br>
| |
| - | 68°C<br>
| |
| - | <br>
| |
| - | 68°C<br>
| |
| - | 10°C</td>
| |
| - | <td>30 seconds<br>
| |
| - | <br>
| |
| - | 15 seconds<br>
| |
| - | 30 seconds<br>
| |
| - | 1 minute/kB<br>
| |
| - | <br>
| |
| - | 5 minutes<br>
| |
| - | Forever</td>
| |
| - | <td>melt<br>
| |
| - | <br>
| |
| - | melt<br>
| |
| - | anneal<br>
| |
| - | extend - 35 cycles<br>
| |
| - | <br>
| |
| - | extend<br>
| |
| - | store</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | Gel electrophoresis<br>
| |
| - | <br>
| |
| - | We do it to prove that our colony PCR was successful. We expect a band at about 800 base pairs.<br>
| |
| - | Our gel is 1%, therefore we used 0,5g agarose in 100µL TAE buffer.<br>
| |
| - | As a ladder, we used a 1kB plus gene ruler of fermentor. <br>
| |
| - | We l the gel with 5 µL sample ans we kept the sample at 4°C.<br>
| |
| - | <br>
| |
| - | PICTURE<br>
| |
| - | <br>
| |
| - | We see that the band are as expected. THis is an indicator that KAN is at the right place. The sequence has then been sent for sequencing<br>
| |
| - | <br>
| |
| - | Transformation of PAUC 18 into a NEBΔturbo clearing cells<br>
| |
| - | We are transforming PAUC 18 that consist in a low ORI and ampicillin resistance<br>
| |
| - | We will use commercialized NEB turbo competent cells as well as freshly made chemical competent cells<br>
| |
| - | We did this to check the competency of our fresh competent cells<br>
| |
| - | <br>
| |
| - | NOTE : EVERYTHING HAS TO BE KEPT ON ICE AND NO VORTEX<br>
| |
| - | <br>
| |
| - | Throw competent cells on ice. Those can be prepared using the CaCl2 protocol<br>
| |
| - | Place 20 µL of cells in a pre-chilled Eppendorf tube<br>
| |
| - | For an intert vector, add 0,5 µL or less to the chilled cells<br>
| |
| - | For a ligation product, add 2-3 µL to the chilled cells<br>
| |
| - | Mix gently by flicking the tube<br>
| |
| - | Chill on ice for 10 minutes - this step is optional but can improve yields when transforming a ligation product<br>
| |
| - | Heat shock at 42°C for 30 seconds<br>
| |
| - | Return on ice for 2 minutes<br>
| |
| - | Add 200µL LB medium and recover the cells by shaking at 37°C<br>
| |
| - | Another rich medium can substitute for the recovery. The recovery time varies with the antibiotic selection<br>
| |
| - | Ampicillin : 15 - 30 minutes<br>
| |
| - | <br>
| |
| - | Place out the cells on selective LB<br>
| |
| - | Use glass beads to spread the cells. The volume of cells plated depends on what is being transformed<br>
| |
| - | <br>
| |
| - | For an intact vector<br>
| |
| - | High transformation efficiencies are expected. Plating out 10 µL of recovered cells should produce many colonies.<br>
| |
| - | <br>
| |
| - | Note : 200 µL is the maximum volume of liquid that an LB plate can absorb<br>
| |
| - | Incubate at 37°C. Transformants should appear within 12 hours<br>
| |
| - | <br>
| |
| - | Conclusion<br>
| |
| - | The BL 21 DE3 strain showed IP colonies<br>
| |
| - | For the new NEB turbo cells, we see no colony<br>
| |
| - | The old NEB turbo cells worked fine<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_17th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 17<sup>th</sup> of July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR purification
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We are purifying the colony PCR from yesterday to send it away for sequencing<br>
| |
| - | <br>
| |
| - | Procedure<br>
| |
| - | Add 1.1 volume and Binding Buffer<br>
| |
| - | Transfer up to 800 µL. Centrifuge for 30-60 seconds. Descend the flow through<br>
| |
| - | Add 700 µL of washed Buffer. Centrifuge for 30-60 seconds<br>
| |
| - | + 1 min centrifuge to completely remove any residual wash buffer<br>
| |
| - | Add 50 µL of Elution Buffer to the center of the Gene JT purification column membrane and centrifuge for 1 minute<br>
| |
| - | Discard the Gene JET purification column and store the purified DNA at -20°C. <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_18th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 18<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Calculating the transformation efficiency for the E.coli NEB and E.coli NNEB strains.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | · 20 µL of cell culture was inoculated in 200 µL of LB, where 0.5 µL of DNA sample (?) was added, giving the total volume of 220.5 µL.<br>
| |
| - | · After the heat shock transformation 10 µL of the culture was diluted in 90 µL of LB, giving the 10-1 dilution (d); then 10 µL of this dilution was transferred in 90 µL of LB, giving the 10-2 dilution. 10 µL of each dilution (v) was plated on ampicillin media and left for incubation (24 h, 37 ̊C).<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | · After incubation, colonies were counted:
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> NEB </td>
| |
| - | <td> NNEB </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> 10<sup>-¹</sup> </td>
| |
| - | <td> 0 </td>
| |
| - | <td> 433 </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> 0 </td>
| |
| - | <td> 368 </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Average </td>
| |
| - | <td> 0 </td>
| |
| - | <td> <b>400.5<b> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> 10<sup>-¹</sup> </td>
| |
| - | <td> 0 </td>
| |
| - | <td> 62 </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> 0 </td>
| |
| - | <td> 40 </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Average </td>
| |
| - | <td> 0 </td>
| |
| - | <td> <b>51<b> </td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | Obviously, NEB strain was not transformed and only NNEB was included in further calculations.<br>
| |
| - | · The number of the transformed colony forming units per mL of the culture was calculated following the formula: colony number / d*v.<br>
| |
| - | <br>
| |
| - | Calculation from the 10-1 dilution: 0.4 * 109 CFU/mL<br>
| |
| - | Calculation from the 10-2 dilution: 0.51 * 109 CFU/mL<br>
| |
| - | <br>
| |
| - | · The transformation efficiency was calculated by dividing the number of transformed colony forming units (CFU) by the amount of the DNA used (mDNA).<br>
| |
| - | <br>
| |
| - | CFU1 = 0.4 * 109 CFU/mL * 0.22 mL (total V of the transformation culture) = 0.088*109 CFU<br>
| |
| - | CFU2 = 0.51 * 109 CFU/mL * 0.22 mL = 0.1122*109 CFU<br>
| |
| - | <br>
| |
| - | The concentration of the DNA solution which was used was 0.323 µg/µL, while the total DNA mass which was added to the transformation culture was: 0.323 µg/µL * 0.5 µL = 0.1615 µg.<br>
| |
| - | <br>
| |
| - | So the transformation efficiency, calculated from the 10 times diluted (TE1) and 100 times diluted (TE2) cultures is:<br>
| |
| - | <br>
| |
| - | TE1 = CFU1/mDNA = 0.55 * 109 CFU/µg<br>
| |
| - | TE2 = CFU2/mDNA = 0.69 * 109 CFU/µg<br>
| |
| - | <br>
| |
| - | TE1 and TE2 are almost the same<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Monday_22nd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 22<sup>nd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Culture purification by streak plate method and preparing the glycerol stock for the sSP001 (TN 57) and sSP002 (NEC) strains.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your note here
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_23rd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 23<sup>rd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Colony PCR
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | · Strain: Keio ΔpyrF<br>
| |
| - | · Primers: JW182 and JW183<br>
| |
| - | · Amplified region: kanamycine resistance gene<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b3/13%EF%80%A207%EF%80%A224_first_run_KanR.jpg"heigh=150><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/9/91/13%EF%80%A207%EF%80%A224_second_run_KanR.jpg"heigh=200><br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Monday_29th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 29<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid culture of:<br>
| |
| - | pCOLA DUET (from glycerol stock of Sabotage Group) - 20 ml culture<br>
| |
| - | pSSB1 (from plate) - 5 ml culture<br>
| |
| - | pSSB2 (from plate ) - 5 ml culture<br>
| |
| - | <br>
| |
| - | Plating of addgene bacteria containing the plasmids we want:<br>
| |
| - | streak out bacteria from addgene to get single colonies:<br>
| |
| - | pBAC-BA-lacZ<br>
| |
| - | pCRISPR<br>
| |
| - | pCas9<br>
| |
| - | pCRIPSR::rpsL<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_30th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 30<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid culture, Miniprep and Glycerol stock
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Liquid culture of:</b><br>
| |
| - | pCOLA DUET (from liquid culture (29.07.13)) - 20 ml culture<br>
| |
| - | pSSB1 (from liquid culture (29.07.13)) - 5ml culture<br>
| |
| - | pSSB2 (from liquid culture (29.07.13)) - 5 ml culture<br>
| |
| - | pBAC-BA-lacZ (from plate ) - 5 ml culture<br>
| |
| - | pCRISPR (from plate ) - 5 ml culture<br>
| |
| - | pCas9 (from plate ) - 5 ml culture<br>
| |
| - | pCRIPSR::rpsL (from plate ) - 5 ml culture<br>
| |
| - | F+ strain - (from glycerol stock Sabotage) - 10 ml culture<br>
| |
| - | Keio Keio delta pyrF (from plate ) - 10 ml culture<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Miniprep (pCOLA-DUET = sSP007) using the Thermo Scientific Miniprep Kit</b> <br>
| |
| - | <br>
| |
| - | 1) Pellet 2x9 ml of liquid culture (4000 rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250 µL of resuspension solution<br>
| |
| - | 4) add 250 µL of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350 µL of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5 ml tube<br>
| |
| - | 11) add 50 µL of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | pSP001= pCOLA-DUET: 65 ng/ul<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Glycerol Stock</b> <br>
| |
| - | from overnight culture of MG1655-pCOLA-DUET (sSP007)<br>
| |
| - | Centrifuge 4000 rpm, 10 minutes,<br>
| |
| - | take out liquid<br>
| |
| - | resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB<br>
| |
| - | freeze in -80°C<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_31st_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 31<sup>st</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Conjugation, Miniprep addgene plasmids,Glycerol Stock of addgene plasmids
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br><br>
| |
| - | <b>Conjugation</b><br>
| |
| - | <br>
| |
| - | sSP001, SP002, keio Delta PyrF<br>
| |
| - | F+ comes from XL1 Blue (glycerol stock Sabotage) => F+ is tetR<br>
| |
| - | <br>
| |
| - | Protocol :<br>
| |
| - | 1) From O/N cultures Dilute strains 1/100 in LB<br>
| |
| - | 2) Wait for OD to reach O,2<br>
| |
| - | 3) Prepare 4 tubes (in BD tubes) :<br>
| |
| - | - Tube 1 = 0,5 mL LB with Strain 1 (sSP001) ,5 mL LB = control<br>
| |
| - | - Tube 2 = 0,5 mL LB with Strain 2 (sP001) + 0,5 mL LB = control<br>
| |
| - | - Tube 3 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB = control<br>
| |
| - | - Tube 4 = 0,5 mL LB with Strain 4 (XL1) + 0,5 mL LB = control<br>
| |
| - | - Tube 5 = 0,5 mL LB with Strain 1 (sSP001) + 0,5 mL LB with Strain 4 (XL1)<br>
| |
| - | - Tube 6 = 0,5 mL LB with Strain 2 (sSP002) + 0,5 mL LB with Strain 4 (XL1)<br>
| |
| - | - Tube 7 = 0,5 mL LB with Strain 3 (keio Delta pyrF) + 0,5 mL LB with Strain 4 (XL1)<br>
| |
| - | 4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)<br>
| |
| - | 5) Plate 10ul for controls, 100uL, 10ul for mixed tubes on LB antibiotics (Tube 5: Chl + Tet, Tube 6: Chl + Tet, Tube 7: Kan + Tet)<br>
| |
| - | 6) Incubate overnight at 37°C<br>
| |
| - | <br>
| |
| - | <b>Miniprep addgene plasmids</b><br>
| |
| - | 1) Pellet 4 ml of liquid culture (4000 rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250 µL of resuspension solution<br>
| |
| - | 4) add 250 µL of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350 µL of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 µL wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove leftover liquid<br>
| |
| - | 10) transfer the column on a 1.5 ml tube<br>
| |
| - | 11) add 50 µL of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | See Database for plasmid reference<br>
| |
| - | pCas9: <br>
| |
| - | pCRISPR:<br>
| |
| - | pBac-LacZ:<br>
| |
| - | pCRISPR::rpsL:<br>
| |
| - | <br>
| |
| - | <b>Glycerol Stock of addgene plasmids</b><br> (see Database for strain reference)<br>
| |
| - | from overnight culture<br>
| |
| - | Centrifuge 4000 rpm, 10 minutes,<br>
| |
| - | take out liquid<br>
| |
| - | resuspend cells in 0,5 mL glycerol (60%) , 2 mL LB<br>
| |
| - | freeze in -80°C<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_1st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 1<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR (gradient + usual) of SPCR1, SPCR7, SPCR8, SPCR10, SPCR9, SPCR4
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37.25 µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10 µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1 µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5 µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5 µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25 µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5 µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50 µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | Gradient:<br>
| |
| - | Pos 1: 40°<br>
| |
| - | Pos 2: 40,2°<br>
| |
| - | Pos 3: 41,3°<br>
| |
| - | Pos 4: 43,1°<br>
| |
| - | Pos 5: 45,4°<br>
| |
| - | Pos 6: 48°<br>
| |
| - | Pos 7: 50,7°<br>
| |
| - | Pos 8: 53,5°<br>
| |
| - | Pos 9: 56,0°<br>
| |
| - | Pos 10: 58,1°<br>
| |
| - | Pos 11: 59,8°C<br>
| |
| - | (Pos 12: 60,6°)<br>
| |
| - | <br>
| |
| - | Usual PCR: 52°<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_2nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 2<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gels with PCR products: 1% Agar<br>
| |
| - | 100V 20 Min<br>
| |
| - | 10 min staining in BET<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d7/13%EF%80%A208%EF%80%A202_SCPR1_iS008_iS009.jpg">
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/3/3e/13%EF%80%A208%EF%80%A202_SPCR4_iS0018_iS019.jpg">
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f4/13%EF%80%A208%EF%80%A202_SPCR7_iS010_iS011.jpg">
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/0/01/13%EF%80%A208%EF%80%A202_SPCR8_iS012_iS013_2.jpg">
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f9/13%EF%80%A208%EF%80%A202_SPCR9_iS016_iS017.jpg">
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/fd/13%EF%80%A208%EF%80%A202_SPCR10_iS014_iS015.jpg">
| |
| - | <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Saturday_3rd_August.html"</div></html>
| |
| - | <html><div id="detect_Sunday_4th_August.html"</div></html>
| |
| - | <html><div id="detect_Monday_5th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 5<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>5ml liquid culture with proper antibiotics of:</b><br>
| |
| - | SSp001 + F+<br>
| |
| - | sSP002 + F+<br>
| |
| - | keio delta pyrF + F+<br>
| |
| - | <br>
| |
| - | <b>Gelelectrophoresis:</b>
| |
| - | 1% Agar, 100 V 20 min<br>
| |
| - | <br>
| |
| - | <img src= "https://static.igem.org/mediawiki/2013/c/cf/13%EF%80%A208%EF%80%A205_SPCR7_1%2C2%2C10_SPCR4_1%2C2%2C4%2C10%2C11_SCPR10_1%2C4%2C5%2C6%2C11.jpg">
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_6th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 6<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid cultures of sSP008-sSP0011
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_7th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 7<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Glycerol Stock of sSP008-sSP0011, M13 Test, Single Colonies, Liquid cultures, PCR and Transformation
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br><b>Glycerol Stock of sSP008-sSP0011</b><br>
| |
| - | Take 1.5ml of ON culture + 500ul Glycerol (60%)<br>
| |
| - | Freeze at -80°C<br>
| |
| - | <br>
| |
| - | <b>M13 Test</b><br>
| |
| - | Plate from ON culture:<br>
| |
| - | 1) 1:1000 - sSP012: sSP009 (plate 200ul)<br>
| |
| - | 2) 200 ul sSP012<br>
| |
| - | 3) 200ul sSp009<br>
| |
| - | <br>
| |
| - | <b>Single Colonies</b><br>
| |
| - | streak out ON culture of sSP012 to get single colonies<br>
| |
| - | <br>
| |
| - | <b>Liquid cultures</b> of pir+ E.coli and pKD13 from Jake<br>
| |
| - | <br>
| |
| - | <b>PCR of SPCR4, SPCR7, SPCR8, SPCR9, SPCR10 from circuar backbone, directly taken from Biobrick plate</b><br><br>
| |
| - | Protocol<br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37,25µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - |
| |
| - | <TABLE BORDER>
| |
| - |
| |
| - | <TR><TD><b>Thermocycler Protocol: NEB Phusion</b></TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD>Temp</TD><TD>Time</TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Start</TD><TD>98°C</TD><TD>30 sec</TD><TD>Melt</TD><TD></TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Cycle 1</TD><TD>98°C</TD><TD>5 sec</TD><TD>Melt</TD><TD>35 cycles</TD></TR>
| |
| - | <TR><TD>Cycle 2</TD><TD>40.5°C / 60°C</TD><TD>25 sec</TD><TD>Anneal</TD><TD></TD></TR>
| |
| - | <TR><TD>Cycle 3</TD><TD>72°C</TD><TD>30 sec per kb</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Finish</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - |
| |
| - | <TR><TD>Store</TD><TD>10°C</TD><TD>Forever</TD><TD>Store</TD><TD></TD></TR>
| |
| - |
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | <b>Transformation</b> Biobricks BBa_K649304 (with pSB1C3 backbone) and BBa_J04450 (with pSB1A3 backbone) into NEB Turbo (heat shock trafo)<br>
| |
| - | <br>
| |
| - | 1) Thaw competent cells on ice.<br>
| |
| - | 2) Place 20 ul of cells in a pre-chilled Eppendorf tube.<br>
| |
| - | 3) Add 2.5 ul of plasmid (from Biobrick stock)<br>
| |
| - | 4) Mix gently by flicking the tube.<br>
| |
| - | 5) Chill on ice for 10 minutes.<br>
| |
| - | 4) Heat shock at 42 °C for 30 seconds <br>
| |
| - | 5) Return to ice for 2 minutes.<br>
| |
| - | 6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.<br>
| |
| - | Ampicillin: 15-30 minutes<br>
| |
| - | Chloramphenicol: 60-120 minutes<br>
| |
| - | 7) Plate out the cells on selective LB (10ul)<br>
| |
| - | 8) Incubate at 37 °C. Transformants should appear within 12 hrs.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Result</b>: BBa_J04450: many colonies, BBa_K649304 no colonies, plate rest<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_8th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 8<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid culture of FR-433 (M13)
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of PCR products. 100V 20min 1%<br>
| |
| - | <br>
| |
| - | 4-7-8-9-10 (40.5°C)- 4-7-8-9-10 (60°C)<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/fc/13%EF%80%A208%EF%80%A208_SPCR4_SPR7_SPCR8_SCPR9_SPCR10.jpg"<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_9th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 9<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid culture, Gel,
| |
| - | Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo, Glycerol Stock, Making electro competent cells of pir+ E.coli, Transforming pKD13 into pir+ E.coli, Miniprep NEB turbo with BBa-J04450:, Liquid culture and Patch plates.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br><b>Liquid culture</b><br>
| |
| - | 1:1000 from liquid: FR-433 (M13), 10 ml<br>
| |
| - | pir+ E.coli: from plate, 25 ml<br>
| |
| - | XL10: from plate 10 ml<br>
| |
| - | <br>
| |
| - | <b>Gel</b>: rest of circular backbone PCR product, 1% Agar, 100V, 20 min<br>
| |
| - | SPCR4-7-8-9-10 (40.5) SPCR4-7-8-9-10 (60.5)<br>
| |
| - | Gel picture: <br>
| |
| - | didn’t work<br>
| |
| - | <br>
| |
| - | <b>Trafo of BBa_E1010 (pSB1C3 backbone) into NEB turbo</b><br>
| |
| - | 1) Thaw competent cells on ice.<br>
| |
| - | 2) Place 20 µl of cells in a pre-chilled Eppendorf tube.<br>
| |
| - | 3) Add 2.5 µl of plasmid (from Biobrick stock)<br>
| |
| - | 4) Mix gently by flicking the tube.<br>
| |
| - | 5) Chill on ice for 10 minutes.<br>
| |
| - | 4) Heat shock at 42 °C for 30 seconds <br>
| |
| - | 5) Return to ice for 2 minutes.<br>
| |
| - | 6) Add 200 µl LB medium and recover the cells by shaking at 37 °C.<br>
| |
| - | Chloramphenicol: 60-120 minutes<br>
| |
| - | 7) Plate out the cells on selective LB (10ul)<br>
| |
| - | 8) Incubate at 37 °C. Transformants should appear within 12 hrs.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Glycerol Stock FR-433 (M13) -> sSP012</b><br>
| |
| - | Glycerol Stock pir+ -> sSP013<br>
| |
| - | Glycerol Stock pKD13 -> sSP014<br>
| |
| - | Glycerol Stock NEB turbo with BBa-J04450 -> sSP015<br>
| |
| - | Take 1.5 ml of ON culture + 500ul Glycerol (60%)<br>
| |
| - | Freeze at -80°C<br>
| |
| - | <br>
| |
| - | <b>Making electro competent cells of pir+ E.coli</b><br>
| |
| - | Preparation of Electrocompetent Cells<br>
| |
| - | Note: Competent cells should never be vortexed, as this will cause them to lyse and release salts into the media. Resuspend cells by pipetting up and down with a large pasteur pipet. Once they are chilled, cells should be continuously cold.<br>
| |
| - | <br>
| |
| - | 1) The night before the transformation, start an overnight culture of cells.<br>
| |
| - | pir+ E.coli<br>
| |
| - | 2) The day of the transformation, dilute the cells 100X.<br>
| |
| - | 100 ml LB<br>
| |
| - | Grow at 30°C for about 90 minutes. <br>
| |
| - | 3) When the cells reach an OD600 of 0.2. <br>
| |
| - | 4) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8.<br>
| |
| - | Split the culture into 2x 50 ml falcon tubes, on ice.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 5) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 2x 25 ml of ice cold water.<br>
| |
| - | Combine the volumes in a single 50 ml falcon tube.<br>
| |
| - | 6) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.<br>
| |
| - | 7) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 µl of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <b>Transforming pKD13 into pir+ E.coli</b><br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 100 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br><br>
| |
| - | <b>Miniprep NEB turbo with BBa-J04450:</b><br>
| |
| - | 1) Pellet 2x 9 ml of liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250 µl of resuspension solution<br>
| |
| - | 4) add 250 µl of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350 µl of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 µl wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5 ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | J04450: 0ng/ul<br>
| |
| - | <br>
| |
| - |
| |
| - | <b>Liquid culture of:</b>
| |
| - | sSP012<br>
| |
| - | sSP008<br>
| |
| - | sSP009<br>
| |
| - | sSP010<br>
| |
| - | sSP011<br>
| |
| - | sSP001<br>
| |
| - | sSP002<br>
| |
| - | XL-10 = sSP016<br>
| |
| - | sSP017= Litmus<br>
| |
| - | <br>
| |
| - | <b>Patch plates of:</b><br>
| |
| - | sSP010<br>
| |
| - | sSP013<br>
| |
| - | sSP009s<br>
| |
| - | sSP014<br>
| |
| - | sSP012<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Saturday_10th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 10<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Test of M13 and Liquid culture
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Test of M13</b><br>
| |
| - | <br>
| |
| - | 1) 100 μ l of plating bacteria per tube<br>
| |
| - | 2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB<br>
| |
| - | 3) Put 10 μ l/ 100 μ l of each dilution to the bacteria<br>
| |
| - | 4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.<br>
| |
| - | 5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes<br>
| |
| - | 6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds<br>
| |
| - | 7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 <br>
| |
| - | 8) Swirl the plate gently to ensure an even distribution of bacteria and agar.<br>
| |
| - | 9) Incubate them at 37°C.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Liquid culture:</b><br>
| |
| - | E1010<br>
| |
| - | J04550<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Sunday_11th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 11<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Patches of sSP001-sSP008, sSP015-18 and Stress experiment (Plate reader)
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Patches of sSP001-sSP008, sSP015-18</b><br>
| |
| - | <br>
| |
| - | <b>Stress experiment (Plate reader)</b><br>
| |
| - | sSP001, sSP002, sSP010, sSP011, sSP012 (M13)<br>
| |
| - | 1:1000 bacteria in M9 Glucose<br>
| |
| - | Mitomycin C concentrations: 3,3*10^-3, 1,6*10°-3, 6,6*10°-4, 3,3*10°-4<br>
| |
| - | Quadruplets of bacteria (+phage), Triplets of MMC<br>
| |
| - | <br>
| |
| - | See also pipetting scheme in folder Experiments on Dropbox<br>
| |
| - | <br>
| |
| - | <b>On culture of FR-433, XL-10, delta pyrF </b><br>
| |
| - | 1:1000 culture at 30°<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Monday_12th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 12<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Glycerol Stock, Miniprep, M13 plate test, Patches
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Glycerol Stock</b>
| |
| - | sSP018 - NEB with E1010<br>
| |
| - | sSP017<br>
| |
| - | sSP016<br>
| |
| - | Take 1.5ml of ON culture + 500ul Glycerol (60%)<br>
| |
| - | Freeze at -80°C<br>
| |
| - | <br>
| |
| - | <b>Miniprep</b><br>
| |
| - | E1010<br>
| |
| - | J04450<br>
| |
| - | <br>
| |
| - | 1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | J04450: ng/ul<br>
| |
| - | E1010: ng/ul<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>M13 plate test</b><br>
| |
| - | 1) 100 μ l of plating bacteria per tube<br>
| |
| - | 2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB<br>
| |
| - | 3) Put 10 μ l/ 100 μ l of each dilution to the bacteria<br>
| |
| - | 4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.<br>
| |
| - | 5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes<br>
| |
| - | 6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds<br>
| |
| - | 7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 <br>
| |
| - | 8) Swirl the plate gently to ensure an even distribution of bacteria and agar.<br>
| |
| - | 9) Incubate them at 37°C.<br>
| |
| - | <br>
| |
| - | <b>Patches</b><br>
| |
| - | check them and prepare new ones of those that haven’t been done yet<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_13th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 13<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR circular and linear 40.5°C/ 60°C, Conjugation of XL-10 (with sSP011), Patches, Digestion M13 backbone, RFP insert and Gel of PCR
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>PCR circular and linear, 40.5°C, 60°</b>
| |
| - | of pSB1A3, pSB1C3<br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37,25µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - |
| |
| - | <TABLE BORDER>
| |
| - |
| |
| - | <TR><TD><b>Thermocycler Protocol: NEB Phusion</b></TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD>Temp</TD><TD>Time</TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Start</TD><TD>98°C</TD><TD>30 sec</TD><TD>Melt</TD><TD></TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Cycle 1</TD><TD>98°C</TD><TD>5 sec</TD><TD>Melt</TD><TD>35 cycles</TD></TR>
| |
| - | <TR><TD>Cycle 2</TD><TD>40.5°C / 60°C</TD><TD>25 sec</TD><TD>Anneal</TD><TD></TD></TR>
| |
| - | <TR><TD>Cycle 3</TD><TD>72°C</TD><TD>30 sec per kb</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Finish</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - |
| |
| - | <TR><TD>Store</TD><TD>10°C</TD><TD>Forever</TD><TD>Store</TD><TD></TD></TR>
| |
| - |
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | <b>Conjugation of XL-10 (with sSP011)</b><br>
| |
| - | 1) From O/N cultures Dilute strains 1/100 in LB<br>
| |
| - | 2) Wait for OD to reach O,2<br>
| |
| - | 3) Prepare tube (in BD tubes) :<br>
| |
| - | - Tube = 0,5mL LB with Strain (sSP011) + 0,5mL LB with Strain (XL-10 Kan)<br>
| |
| - | 4) Incubate 2 hours at 37°C (actually not in the shaker, but we accidently kept them in the shaker...)<br>
| |
| - | 5) Plate 20ul for mixed tube on LB antiobiotics (Tet, Kan)<br>
| |
| - | 6) Incubate overnight at 37°C<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Patches</b><br>
| |
| - | check and make new ones<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Digestion M13 backbone, RFP insert</b><br>
| |
| - | for Backbone (M13mp18 plasmid): 3ug<br>
| |
| - | 7,58 ul plasmid (c=395ng/ul)<br>
| |
| - | 3 ul EcoRI<br>
| |
| - | 3 ul PstI<br>
| |
| - | 3ul 10x Fast Digest<br>
| |
| - | 13,42 ul H20<br>
| |
| - | incubate for 12 min on 37°<br>
| |
| - | heat inactivation: 80° 5 min<br>
| |
| - | for insert (BBa_J04450): 5ug<br>
| |
| - | 31,4 ul plasmid<br>
| |
| - | 5 ul EcoRi<br>
| |
| - | 5 ul PstI<br>
| |
| - | 3,6 ul H20<br>
| |
| - | incubate for 20 min at 37°<br>
| |
| - | heat inactivation: 80° 5min<br>
| |
| - | <br>
| |
| - | <b>Gel of PCR (Amp 40.5 circ, lin, Chl 60° lin, circ)</b><br>
| |
| - | 100V, 20 min 1% gel<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/5d/13%EF%80%A208%EF%80%A213_SPCR_AmpR_backbones_40.5%C2%B0_60%C2%B0_circular_linear_4%2C7%2C8%2C9%2C10.jpg"height="300"><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/2/27/13%EF%80%A208%EF%80%A213_SPCRs_ChlR_backbones_40.5%C2%B0_60%C2%B0_circular_linear_4%2C7%2C8%2C9%2C10.jpg"height="330"><br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_14th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 14<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of PCR, Gel of Digest, Gel Extraction, DpnI digest of PCR products, PCR purification
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Gel of PCR</b> (Amp 60° circ, lin, Chl 40.5 circ, lin)
| |
| - | 100V, 20 min 1% gel<br>
| |
| - | <br>
| |
| - | <b>Gel of Digest</b><br>
| |
| - | 100V, 20 min 1% gel<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/1a/13%EF%80%A208%EF%80%A214_SPCR_AmpR_backbones_40.5%C2%B0_60%C2%B0_circular_linear_4%2C7%2C8%2C9%2C10.jpg"><br>
| |
| - | <br>
| |
| - | <b>Gel Extraction</b><br>
| |
| - | Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.<br>
| |
| - | Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.<br>
| |
| - | After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).<br>
| |
| - | Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.<br>
| |
| - | Discard flow-through and place QIAquick column back in the same collection tube.<br>
| |
| - | To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.<br>
| |
| - | 11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
| |
| - | 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>DpnI digest of PCR products:</b><br>
| |
| - | SPCR4 (40ul) - add 1 ul DpnI<br>
| |
| - | SPCR 7 (150ul) - add 3 ul of DpnI<br>
| |
| - | SPCR8 (60 ul) - add 3 ul of DpnI<br>
| |
| - | SPCR 9 (150ul) - add 3 ul of DpnI<br>
| |
| - | SPCR10 (110ul) - add 3 ul of DpnI<br>
| |
| - | Incubate for 15 min at 37°C<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>PCR purification</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_15th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 15<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid cultures
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Liquid cultures</b>:<br>
| |
| - | sSp009<br>
| |
| - | sSP012<br>
| |
| - | sSP016<br>
| |
| - | sSp020<br>
| |
| - | Xgal Bacteria from Aude<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_16th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 16<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid M13 Test, Glycerol Stock, Miniprep
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Liquid M13 Test</b><br>
| |
| - | <br>
| |
| - | OD (sSP020=XL10 KanR with F+)=0,557<br>
| |
| - | OD (sSP016=XL10 KanR)=0,515<br>
| |
| - | OD (sSP009= delta pyrF with F+)=0,561<br>
| |
| - | OD(sSP012=FR-433=M13)=0,695<br>
| |
| - | <br>
| |
| - | Prepare Falcons containing 500ul of each strain, adding 500ul of 10^-6 dilution of FR-433<br>
| |
| - | add 1ul of IPTG and 1ul of Xgal<br>
| |
| - | Incubate at 37° on shaker<br>
| |
| - | <br>
| |
| - | <b>Glycerol Stock</b>
| |
| - | sSP019 (pir+ E.coli transformed with pKD13)<br>
| |
| - | sSP020 (XL10 KanR with F+)<br>
| |
| - | <br>
| |
| - | <b>Miniprep</b><br>
| |
| - | sSP019<br>
| |
| - | sSP017<br>
| |
| - | <br>
| |
| - | 1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | pKD13: 311ng/ul<br>
| |
| - | Litmus 28i: 93ng/ul<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Monday_19th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 19<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Restreak XL-1 Blue Litmus28i, PCR, PCR purification Backbone (M13mp18), Ligation (RFP into M13mp18 backbone), Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo and Test Xgal
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Restreak XL-1 Blue Litmus28i</b><br>
| |
| - | <br>
| |
| - | <b>PCR</b><br>
| |
| - | <br>
| |
| - | SPCR5, SPCR6, 49,3°C<br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37,25µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - |
| |
| - | <TABLE BORDER>
| |
| - |
| |
| - | <TR><TD><b>Thermocycler Protocol: NEB Phusion</b></TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD>Temp</TD><TD>Time</TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Start</TD><TD>98°C</TD><TD>30 sec</TD><TD>Melt</TD><TD></TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Cycle 1</TD><TD>98°C</TD><TD>5 sec</TD><TD>Melt</TD><TD>35 cycles</TD></TR>
| |
| - | <TR><TD>Cycle 2</TD><TD>40.5°C / 60°C</TD><TD>25 sec</TD><TD>Anneal</TD><TD></TD></TR>
| |
| - | <TR><TD>Cycle 3</TD><TD>72°C</TD><TD>30 sec per kb</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Finish</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - |
| |
| - | <TR><TD>Store</TD><TD>10°C</TD><TD>Forever</TD><TD>Store</TD><TD></TD></TR>
| |
| - |
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | <b>PCR purification Backbone (M13mp18)</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <b>Ligation (RFP into M13mp18 backbone)</b><br>
| |
| - | 3ul Backbone<br>
| |
| - | 14 ul Insert<br>
| |
| - | 2ul 10x T4 DNA Ligase HC Buffer<br>
| |
| - | 1 ul T4 DNA Ligase<br>
| |
| - | <br>
| |
| - | Incubate for at least 10min at 22°C<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Trafo of Ligation product (RFP in M13mp18 plasmid) into NEB turbo</b><br>
| |
| - | 1) Thaw competent cells on ice.<br>
| |
| - | 2) Place 20 ul of cells in a pre-chilled Eppendorf tube.<br>
| |
| - | 3) Add 3 ul of plasmid (from Biobrick stock)<br>
| |
| - | 4) Mix gently by flicking the tube.<br>
| |
| - | 5) Chill on ice for 10 minutes.<br>
| |
| - | 4) Heat shock at 42 °C for 30 seconds <br>
| |
| - | 5) Return to ice for 2 minutes.<br>
| |
| - | 6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.<br>
| |
| - | 7) Plate out the cells on LB (200ul)<br>
| |
| - | 8. Incubate at 37 °C. Transformants should appear within 12 hrs.<br>
| |
| - | <br>
| |
| - | <b>Test Xgal</b><br>
| |
| - | 3ml of Liquid culture with <br>
| |
| - | 1) Xgal from iGEM 2012 (Jake) (+IPTG)<br>
| |
| - | 2) Xgal from last week (in DMF) (+IPTG)<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_20th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 20<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of PCR and Xgal Test
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel of PCR</b><br>
| |
| - | <br>
| |
| - | 1%, 100V, 20min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/a/a2/13%EF%80%A208%EF%80%A220_at_49.3C_SPCR5_iS005_iS007_SPCR6_iS005_iS006.jpg"height="400"><br>
| |
| - | <br>
| |
| - | Result: PCR didn’t work<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Xgal Test</b><br>
| |
| - | <br>
| |
| - | MG1655 (of Jake) in liquid culture with Xgal of iGEM 2012, Aude and new one (Anne)<br>
| |
| - | <br>
| |
| - | Result:<br>
| |
| - | All cultures turn blue (Aude, less blue)<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_21st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 21<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gradient PCR SPCR5, SPCR6, M13 Test, Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i), Transformation
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gradient PCR SPCR5, SPCR6</b><br>
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37,25µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | Gradient:<br>
| |
| - | Pos 1: 40.1°<br>
| |
| - | Pos 2: 40,8°<br>
| |
| - | Pos 3: 42.2°<br>
| |
| - | Pos 4: 44.2°<br>
| |
| - | Pos 5: 46.7°<br>
| |
| - | Pos 6: 49.4°<br>
| |
| - | Pos 7: 52.1°<br>
| |
| - | Pos 8: 54.7°<br>
| |
| - | Pos 9: 57.1°<br>
| |
| - | Pos 10: 59.0°<br>
| |
| - | Pos 11: 60.2°C<br>
| |
| - | <br>
| |
| - | <b>M13 Test</b><br>
| |
| - | Liquid cultures of sSP012 and sSP020<br>
| |
| - | 1) 100 μ l of plating bacteria per tube<br>
| |
| - | 2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB<br>
| |
| - | 3) Put 10 μ l/ 100 μ l of each dilution to the bacteria<br>
| |
| - | 4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.<br>
| |
| - | 5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes<br>
| |
| - | 6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds<br>
| |
| - | 7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 <br>
| |
| - | 8) Swirl the plate gently to ensure an even distribution of bacteria and agar.<br>
| |
| - | 9) Incubate them at 37°C.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Electrocompetent Cells (sSP017-XL-1 Blue, Litmus 28i)</b><br>
| |
| - | 1) The night before the transformation, start an overnight culture of cells.<br>
| |
| - | sSP017 (XL1 Blue Litmus 28i)<br>
| |
| - | 2) The day of the transformation, dilute the cells 100X.<br>
| |
| - | 100 ml LB Amp.<br>
| |
| - | Grow at 30°C for about 90 minutes. <br>
| |
| - | 3) When the cells reach an OD600 of 0.2. <br>
| |
| - | 4) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)<br>
| |
| - | Split the culture into 2x 50 ml falcon tubes, on ice.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 5) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 2x 25 ml of ice cold water.<br>
| |
| - | Combine the volumes in a single 50 ml falcon tube.<br>
| |
| - | 6) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.<br>
| |
| - | 7) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 ul of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <b>Transforming pKD13 into pir+ E.coli</b><br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 100 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_22nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 22<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | Gel of gradient PCR product (Pictures 6,5,5), PCR purification and pooling, Digestion M13 backbone, RFP insert, Test Digestion in Gel, Gel Extraction, Liquid culture, Purification of Backbone Cloning and Miniprep sSP015.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br>
| |
| - | <b>Gel of gradient PCR product </b><br>
| |
| - | 1%, 100V, 20 min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/56/13%EF%80%A208%EF%80%A222_Degest_BBaJ%294550_with_EcoRI_PstI.jpg"><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/e8/13%EF%80%A208%EF%80%A222_SPCR_6_iS005_iS006.jpg"><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d3/13%EF%80%A208%EF%80%A222_SPCR5_iS005_iS007.jpg"><br>
| |
| - | <br>
| |
| - | <b>PCR purification and pooling</b><br>
| |
| - | Pool all samples that worked<br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | c(SPCR5)= ng/ul<br>
| |
| - | c(SPCR6)= ng/ul<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Digestion M13 backbone, RFP insert</b><br>
| |
| - | <br>
| |
| - | Backbone/Insert (double the amount)<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td>Regent</td><td>Volume</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified Plasmid</td><td>20 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td><td>65 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td><td>10 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1 (EcoRI)</td><td>2,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2 (PstI)</td><td>2,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastAP Phosphatase</td><td>0 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td><td><b>100ul</b></td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | Digest for 2.5 hours at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Test Digestion in Gel</b><br>
| |
| - | 1%, 100V, 20 min<br>
| |
| - | <br>
| |
| - | <b>Gel Extraction</b><br>
| |
| - | Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.<br>
| |
| - | Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.<br>
| |
| - | After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).<br>
| |
| - | Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.<br>
| |
| - | Discard flow-through and place QIAquick column back in the same collection tube.<br>
| |
| - | To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.<br>
| |
| - | 11. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).
| |
| - | 12. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.<br>
| |
| - | <br>
| |
| - | c=13,6ng/ul<br>
| |
| - | <br>
| |
| - | Liquid culture<br>
| |
| - | sSP015<br>
| |
| - | <br>
| |
| - | <b>Purification of Backbone Cloning</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <b>Miniprep sSP015</b><br>
| |
| - | 1) Pellet 2x 2ml of liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension solution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_23rd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 23<sup>rd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC), Microscope, Gradient PCR of SPCR2, Digestion of SPCR 5 and SPCR7 and Purification of Digestion.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Stress Experiment (sSP001, sSP002, sSP010, sSP011, M13, MMC)</b><br>
| |
| - | Dilute ON culture 1:100<br>
| |
| - | Centrifuge (1 min, 10rpm)<br>
| |
| - | Wash 1x with 70% of Volume M9 Glucose<br>
| |
| - | Centrifuge again<br>
| |
| - | Take up in 70% of the VOlume M9 Gluo<br>
| |
| - | 100ul in each 96 well plate (see pipetting file)<br>
| |
| - | Add MMC 10ug/ml in corresponding wells and incubate in the plate reader<br>
| |
| - | After 90 min add phages into correscponding wells<br>
| |
| - | put back on the plate reader<br>
| |
| - | <br>
| |
| - | <b>Microscope</b><br>
| |
| - | look at the shape and fluorescence at t=0 of sSP001<br>
| |
| - | look at the shape and fluorescence at=90 mi of sSP001 + 10ug/ml MMC<br>
| |
| - | take photos<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gradient PCR of SPCR2</b><br>
| |
| - | iSP001 (gblock) and iS002<br>
| |
| - |
| |
| - | <br>
| |
| - | <TABLE BORDER>
| |
| - | <TR><TD><b>Reagent</b></TD><TD><b>Volume</b></TD></TR>
| |
| - | <TR><TD> </TD><TD><b>1x</b></TD></TR>
| |
| - | <TR><TD>Nuclease-free water</TD><TD>37,25µL</TD></TR>
| |
| - | <TR><TD>5x Phusion HF Buffer</TD><TD>10µL</TD></TR>
| |
| - | <TR><TD>10 mM dNTPs</TD><TD>1µL</TD></TR>
| |
| - | <TR><TD>Forward Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Reverse Primer (10 µM)</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD>Template Plasmid</TD><TD>0.25µL</TD></TR>
| |
| - | <TR><TD>Phusion DNA Polymerase</TD><TD>0.5µL</TD></TR>
| |
| - | <TR><TD><b>Total Volume</b></TD><TD>50µL</TD></TR>
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - |
| |
| - | <TABLE BORDER>
| |
| - |
| |
| - | <TR><TD><b>Thermocycler Protocol: NEB Phusion</b></TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD>Temp</TD><TD>Time</TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Start</TD><TD>98°C</TD><TD>30 sec</TD><TD>Melt</TD><TD></TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Cycle 1</TD><TD>98°C</TD><TD>5 sec</TD><TD>Melt</TD><TD>35 cycles</TD></TR>
| |
| - | <TR><TD>Cycle 2</TD><TD>40.5°C / 60°C</TD><TD>25 sec</TD><TD>Anneal</TD><TD></TD></TR>
| |
| - | <TR><TD>Cycle 3</TD><TD>72°C</TD><TD>30 sec per kb</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - | <TR><TD> </TD><TD> </TD><TD> </TD><TD> </TD><TD> </TD></TR>
| |
| - | <TR><TD>Finish</TD><TD>72°C</TD><TD>5 min</TD><TD>Extend</TD><TD> </TD></TR>
| |
| - |
| |
| - | <TR><TD>Store</TD><TD>10°C</TD><TD>Forever</TD><TD>Store</TD><TD></TD></TR>
| |
| - |
| |
| - | </TABLE>
| |
| - | <br><br>
| |
| - | <b>Digestion of SPCR 5 and SPCR7</b>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td><td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified PCR Product</td><td>16 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td><td>0 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td><td>2 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td><td>1 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2</td><td>1 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td><td><b>20 ul</b></td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | Incubate at 37°C for 1h shaking<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Purification of Digestion</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Sunday_25th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 25<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of Gradient PCR, Liquid Cultures, Ligation M13 + RFP, Ligation SPCR5, SPCR7, Electrocompetent cells, Gibson Assembly, Transformation (Gibson)and Transformation (Gibson, Ligations.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Gel of Gradient PCR</b><br>
| |
| - | 1%, 100V, 20min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/bd/13%EF%80%A208%EF%80%A225_SPCR2_iS001_iS002.jpg"><br>
| |
| - | <br>
| |
| - | <b>Liquid Cultures</b><br>
| |
| - | NEB Turbo<br>
| |
| - | XL10<br>
| |
| - | <br>
| |
| - | <b>Ligation</b><br>
| |
| - | <br>
| |
| - | <b>Ligation M13 + RFP</b><br>
| |
| - | 0.5ul Vector (M13)<br>
| |
| - | 2.6ul Insert (RFP)<br>
| |
| - | 5.4ul H20<br>
| |
| - | 1.0ul T4 buffer<br>
| |
| - | 0.5ul T4 Ligase<br>
| |
| - | <br>
| |
| - | <b>Ligation SPCR5, SPCR7</b><br>
| |
| - | 1.0ul Vector (SPCR5)<br>
| |
| - | 1.5ul Insert (SPCR7)<br>
| |
| - | 6.0ul H20<br>
| |
| - | 1.0ul T4 buffer<br>
| |
| - | 0.5ul T4 Ligase<br>
| |
| - | <br>
| |
| - | Incubate ~30min at 37 C<br>
| |
| - | <br>
| |
| - | <b>Electrocompetent cells</b><br>
| |
| - | 1) Start Culture<br>
| |
| - | 2) When the cells reach an OD600 of 0.2. <br>
| |
| - | 3) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 4) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 25 ml of ice cold water<br>
| |
| - | 5) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.
| |
| - | 6) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 ul of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <b>Gibson Assembly</b><br>
| |
| - | <br>
| |
| - | Amount per Reaction<br>
| |
| - | Positive Control**<br>
| |
| - | <br>
| |
| - | PCR Fragment(s)<br>
| |
| - | + linearized vector<br>
| |
| - | 2-10 μl (0.02–0.5 pmols)*<br>
| |
| - | <br>
| |
| - | Gibson<br>
| |
| - | Assembly Master<br>
| |
| - | Mix (2X)<br>
| |
| - | 10 μl<br>
| |
| - | <br>
| |
| - | Deionized H2O<br>
| |
| - | XX μl<br>
| |
| - | <br>
| |
| - | Total Volume<br>
| |
| - | 20 μl<br>
| |
| - | <br>
| |
| - | Incubate samples in a thermocycler at 50°C for 15 minutes. After incubation, store the samples on ice or at -20°C for subsequent transformation<br>
| |
| - | Note: Extended incubation up to 60 minutes may help to improve assembly efficiency in some cases (for further details see FAQ section).<br>
| |
| - | Transform NEB 5-alpha Competent E. coli cells (provided with the kit) with 2 μl of the assembly reaction, following the transformation protocol.<br>
| |
| - | <br>
| |
| - | <b>Transformation (Gibson)</b><br>
| |
| - | Thaw competent cells on ice.<br>
| |
| - | Add 2 μl of the chilled assembly product to the competent cells. Mix gently by pipetting up and down or by flicking the tube 4–5 times. Do not vortex.<br>
| |
| - | Place the mixture on ice for 30 minutes. Do not mix.<br>
| |
| - | Heat shock at 42°C for 30 seconds. Do not mix.<br>
| |
| - | Transfer tubes to ice for 2 minutes.<br>
| |
| - | Add 950 μl of room-temperature SOC media to the tube.<br>
| |
| - | Incubate the tube at 37°C for 60 minutes. Shake vigorously (250 rpm) or rotate.<br>
| |
| - | Warm selection plates to 37°C.<br>
| |
| - | Spread 100 μl of the cells onto the selection plates. Use Amp plates for positive control sample.<br>
| |
| - | Incubate overnight at 37°C.<br>
| |
| - | <br>
| |
| - | <b>Transformation (Gibson, Ligations)</b><br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 100 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Monday_26th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 26<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Picking colonies (Trafo Gibson, BBC SPCR5/7)</b><br>
| |
| - | chosing 5-7 colonies and start liquid cultures
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_27th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 27<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Starting liquid cultures and Miniprep of pS.005 and pS.006.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Starting liquid cultures</b><br>
| |
| - | sSP001, sSP002, sSP010, sSP011, sSP012, sSP020<br>
| |
| - | <br>
| |
| - | <b>Miniprep of pS.005 and pS.006</b><br>
| |
| - | 1) Pellet 2x 9ml of liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension solution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | <b>Colony PCR</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td><td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td><td>0,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td><td>0,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (Miniprep)</td><td>0,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td><td>12,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td><td>10,0 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total volume</b></td><td>25 ul</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: Dream Taq Green</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C</td>
| |
| - | <td>30 sec1</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>15 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> 35 cycles </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Cycle 2</td>
| |
| - | <td>46,8°C </td>
| |
| - | <td> 30 sec </td>
| |
| - | <td> Anneal </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Cycle 3</td>
| |
| - | <td> 68°C </td>
| |
| - | <td> 1 min per kb </td>
| |
| - | <td>Extend</td>
| |
| - | <td>cellule 2</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Finish</td>
| |
| - | <td> 68°C </td>
| |
| - | <td> 5 min </td>
| |
| - | <td> Extend </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Store</td>
| |
| - | <td> 10°C </td>
| |
| - | <td>Forever </td>
| |
| - | <td>Store </td>
| |
| - | <td></td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_28th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 28<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel Colony PCR, Liquid Cultures (1:100), Analytical Digest, Gel Ligation/Gibson, Gel Analytical digest, DpnI digest of SPCR5, SPCR6, SPCR7, Gel DpnI digest, PCR purification of DpnI digested SPCR5, SPCR6, SPCR7, Stress test microscope and M13 Test.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Gel Colony PCR</b><br>
| |
| - | pS005 (C1-C5) - pS006 (C1-C7)<br>
| |
| - | 1% 100V 20 min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b8/13%EF%80%A208%EF%80%A228_pS005_pS006_Colony_PCR_iS029_iS030.jpg"<br>
| |
| - | <br>
| |
| - | <b>Liquid Cultures (1:100)</b><br>
| |
| - | sSP001, sSP002, sSP010, sSP011, sSP012, sSP020<br>
| |
| - | <br>
| |
| - | <b>Analytical Digest</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td><td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> Plasmid Miniprep </td><td>5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td><td>12 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>c10x FastDigest Buffer</td><td>2ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td><td>0,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2</td><td>0,5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td><td> 20,0 ul</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | Digest for 15 minutes at 37 °C with shaking<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gel Ligation/Gibson</b><br>
| |
| - | pS005 - pS006 - M13/RFP<br>
| |
| - | 1% 100V 20min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/7d/13%EF%80%A208%EF%80%A228_pS005_pS006_M13%EF%80%A2RFP_Ligation%EF%80%A2Gibson_products.jpg"><br>
| |
| - | <br>
| |
| - | <b>Gel Analytical digest</b><br>
| |
| - | pS005 (C1-C5)-pS006 (C1-C7)<br>
| |
| - | 1% 100V 20min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/1b/13%EF%80%A208%EF%80%A228_pS005_%28C1-C5%29_digested_with_XbaI%EF%80%A2SpeI_pS006_%28C1-C7%29_digested_with_XbaI%EF%80%A2SpeI.jpg"><br>
| |
| - | <br>
| |
| - | <b>DpnI digest of SPCR5, SPCR6, SPCR7</b><br>
| |
| - | add 4ul of DpnI into each tube, mix and incubate for 1h at 37°C<br>
| |
| - | <br>
| |
| - | <b>Gel DpnI digest</b><br>
| |
| - | let each 5ul run on a gel<br>
| |
| - | 1%, 100V 20min<br>
| |
| - | <br>
| |
| - | <b>PCR purification of DpnI digested SPCR5, SPCR6, SPCR7</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <b>Stress test microscope</b><br>
| |
| - | Dilute ON cultures of sSP001, sSP002, sSP010, sSP011, sSP012 1:100 and incubate up to an OD of 0.3<br>
| |
| - | Take out 2ml of sSP001, sSP002, sSP010, sSP011<br>
| |
| - | add:<br>
| |
| - | sSP001: 10ug/ml MMC<br>
| |
| - | sSP002: 10ug/ml MMC<br>
| |
| - | sSP010: 20ul sSP012 supernatant<br>
| |
| - | sSP011: 20ul sSP012 supernatant<br>
| |
| - | <br>
| |
| - | incubate for 90 min<br>
| |
| - | <br>
| |
| - | take pictures under the microscope (trans and YFP) of (un-)treated samples<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>M13 Test</b><br>
| |
| - | Liquid cultures of sSP012 and sSP020<br>
| |
| - | 1) 100 μ l of plating bacteria per tube (OD 0.6)<br>
| |
| - | 2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB<br>
| |
| - | 3) Put 10 μ l/ 100 μ l of each dilution to the bacteria<br>
| |
| - | 4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.<br>
| |
| - | 5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes<br>
| |
| - | 6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds<br>
| |
| - | 7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal<br>
| |
| - | 8) Swirl the plate gently to ensure an even distribution of bacteria and agar.<br>
| |
| - | 9) Incubate them at 37°C.<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Friday_30th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 30<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | M13 test, DpnI digest (SPCR5,6,7), Gel SPCR5,6,7 and PCR purification of DpnI digested SPCR5, SPCR6, SPCR7
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>M13 test</b><br>
| |
| - | dilute ON cultures (NEB turbo, FR-433) 1: 100, grow up to an OD of ~0.6<br>
| |
| - | 1) 100 μ l of plating bacteria per tube (OD 0.6)<br>
| |
| - | 2) Prepare tenfold serial dilutions (10-6 to 10-9 ) of the bacteriophage stock in LB<br>
| |
| - | 3) Put 10 μ l/ 100 μ l of each dilution to the bacteria<br>
| |
| - | 4) Mix the bacteriophage particles with the bacterial culture by vortexing gently.<br>
| |
| - | 5) Add 40 μ l of X-gal solution (working conc) and IPTG (working conc) solution to each of the tubes<br>
| |
| - | 6) Add 3ml of Agar to each tube and gently vortexing for 3 seconds<br>
| |
| - | 7) Pour the mixture onto plates containing LB medium supplemented with 5 mM MgCl2 and 2x IPTG and Xgal<br>
| |
| - | 8) Swirl the plate gently to ensure an even distribution of bacteria and agar.<br>
| |
| - | 9) Incubate them at 37°C.<br>
| |
| - | <br>
| |
| - | <b>DpnI digest (SPCR5,6,7)</b><br>
| |
| - | add 8ul DpnI per tube and digest for 1h at 37°, shaking<br>
| |
| - | <br>
| |
| - | <b>Gel SPCR5,6,7</b><br>
| |
| - | 1%, 100V, 20min<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/72/13%EF%80%A208%EF%80%A230_sPCR5_SPCR6_sPCR7_after_DpnI_digest.jpg"height="330"<br>
| |
| - | <br>
| |
| - | <b>PCR purification of DpnI digested SPCR5, SPCR6, SPCR7</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Tuesday_3rd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Day Number<sup>suffix</sup> Month</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your note here
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_4th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 4<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Starting Liquid culture, PCRs, Gel, DpnI digest, Digestion of SPCR5,7, Purification of Digestion, Ligation of SPCR5,7, Gibson Assembly, Making Electrocompetent Cells, Transformation, Redo SPCR12/13 ,
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Starting Liquid culture</b><br>
| |
| - | NEB turbo, grow up to an OD of 0.6<br>
| |
| - | <br>
| |
| - | <b>PCRs</b><br>
| |
| - | SPCR1, SPCR2, SPCR4, SPCR12, SPCR13<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagant</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>1x (SPCR2)</b></td>
| |
| - | <td><b>11x (SPCR12)</b></td>
| |
| - | <td><b>11x (SPCR13)</b></td>
| |
| - | <td><b>8x (SPCR1)</b></td>
| |
| - | <td><b>8x (SPCR4)</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | <td>447 µl</td>
| |
| - | <td>447 µl</td>
| |
| - | <td>335,25µl</td>
| |
| - | <td>335,25µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | <td>120 µl</td>
| |
| - | <td>120 µl</td>
| |
| - | <td>90 µl</td>
| |
| - | <td>90 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | <td>12 µl</td>
| |
| - | <td>12 µl</td>
| |
| - | <td>9 µl</td>
| |
| - | <td>9 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>0.25 µl</td>
| |
| - | <td>3 µl</td>
| |
| - | <td>3 µl</td>
| |
| - | <td>2.25 µl</td>
| |
| - | <td>2.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>4,5 µl</td>
| |
| - | <td>4,5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Total Volume</td>
| |
| - | <td>50 µl</td>
| |
| - | <td>600 µl</td>
| |
| - | <td>600 µl</td>
| |
| - | <td>450 µl</td>
| |
| - | <td>450 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | for SPCR 12/13 gradient, 2,5 min<br>
| |
| - | for SPCR3, SPCR11 51°, 45s<br>
| |
| - | for SPCR 1, SPCR2, 48,8°, 2 min<br>
| |
| - | for SPCR4, 40,8°, 1 min<br>
| |
| - | <br>
| |
| - | <b>Gel</b><br>
| |
| - | 1%, 100V, 20 min<br>
| |
| - | <br>
| |
| - | 1.small gel (SPCR1,2,3,4,11)<br>
| |
| - | 2. big gel (SPCR12)<br>
| |
| - | 3. big Gel (SPCR13)<br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b9/13%EF%80%A209%EF%80%A204_SPCR1%2C2%2C3%2C4%2C11_with_corresponding_primers.jpg"height="320"><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/13/13%EF%80%A209%EF%80%A204_SPCR12_gradient_wrong_programmed_corresponding_primers.jpg"><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/6b/13%EF%80%A209%EF%80%A204_SPCR13_gradient_wrong_programmed_corresponding_primers.jpg"><br>
| |
| - | <br>
| |
| - | <b>DpnI digest</b><br>
| |
| - | SPCR 1: add 10ul DpnI<br>
| |
| - | SPCR4: add 10ul DpnI<br>
| |
| - | SPCR2,3,11: add 1 ul DpnI<br>
| |
| - | <br>
| |
| - | incubate for 1h at 37°<br>
| |
| - | <br>
| |
| - | <b>Digestion of SPCR5,7</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified PCR Product</td>
| |
| - | <td>16 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>XbaI</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SpeI</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>20.0 µl</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | Incubate for 1h at 37°, shaking<br>
| |
| - | <br>
| |
| - | <b>Purification of Digestion</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 30 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <b>Ligation of SPCR5,7</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Vector</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Insert</td>
| |
| - | <td>3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | Incubate at room temperature for ~1h<br>
| |
| - | <br>
| |
| - | <b>Gibson Assembly</b><br>
| |
| - | <br>
| |
| - | <b>Amount per Reaction :</b> Positive Control**<br>
| |
| - | <br>
| |
| - | <b>PCR Fragment(s)+ linearized vector :</b> 2-10 μl (0.02–0.5 pmols)*<br>
| |
| - | <br>
| |
| - | <b>Gibson Assembly Master Mix (2X):</b> 10 μl<br>
| |
| - | <br>
| |
| - | <b>Deionized H2O :</b> XX μl<br>
| |
| - | <br>
| |
| - | <b>Total Volume :</b> 20 μl<br>
| |
| - | <br>
| |
| - | Incubate samples in a thermocycler at 50°C for 15 minutes. <br>
| |
| - | Put on Ice<br>
| |
| - | Insert: 2,4 ul<br>
| |
| - | Vector: 0,6 ul<br>
| |
| - | <br>
| |
| - | <b>Making Electrocompetent Cells</b><br>
| |
| - | <br>
| |
| - | 1) Start a liquid culture of cells.
| |
| - | NEB turbo<br>
| |
| - | 2) dilute the cells 100X.<br>
| |
| - | 100 ml LB.<br>
| |
| - | Grow at 30°C for about 90 minutes. <br>
| |
| - | 3) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8<br>
| |
| - | Split the culture into 2x 50 ml falcon tubes, on ice.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 5) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 2x 25 ml of ice cold water.<br>
| |
| - | Combine the volumes in a single 50 ml falcon tube.<br>
| |
| - | 6) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.<br>
| |
| - | 7) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 ul of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <b>Transformation</b><br>
| |
| - | pS005, pS006, SPCR3 (IDT plasmid) M13mp18<br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 10/200 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br>
| |
| - | <b>Redo SPCR12/13</b>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>11x (SPCR12)</b></td>
| |
| - | <td><b>11x (SPCR13)</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>447 µl</td>
| |
| - | <td>447 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>120 µl</td>
| |
| - | <td>120 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>12 µl</td>
| |
| - | <td>12 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>3 µl</td>
| |
| - | <td>3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>6 µl</td>
| |
| - | <td>6 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>600 µl</td>
| |
| - | <td>600 µl</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | <br>Cycling protocol as usual + gradient + topdown<br>
| |
| - | <br>
| |
| - | <IMG SRC="https://static.igem.org/mediawiki/2013/b/b6/Cycler_protocol_4.9.13.JPG" WIDTH=400>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_5th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 5<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel, Colony PCR, Topdown PCR and gels
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel</b><br>
| |
| - | SPCR12, SPCR13<br>
| |
| - | 1%, 100V, 20 min<br>
| |
| - | <br>
| |
| - | Pictures: 13/09/05_SPCR12_corresponding primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/72/3-09-05_SPCR12_corresponding_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/05_SPCR13_corresponding primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/3/32/13-09-05_SPCR13_corresponding_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Colony PCR</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)/td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (from above)</td>
| |
| - | <td>1.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td>
| |
| - | <td>12.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>25 ul</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: DreamTaq Green PCR MM</b></td>
| |
| - | <td><b> </b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C</td>
| |
| - | <td>1 min </td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cyle 2</td>
| |
| - | <td>52.6/46.8 °C</td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C </td>
| |
| - | <td>1 min per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72°C</td>
| |
| - | <td>10 min</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | <b>Topdown PCR</b><br>
| |
| - | SPCR 1,4,12,13<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1>/b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br>
| |
| - | increases every cycle 1°C, starting from 40°<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gels</b><br>
| |
| - | 1%, 100V, 20+ Min<br>
| |
| - | <br>
| |
| - | Pictures:<br>
| |
| - | 13/09/05_colony PCR_pS005_C1-C8_BB verification primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/6b/13-09-05_colony_PCR_pS005_C1-C8_BB_verification_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/05_colony PCR_pS005_C9-C16_BB verification primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/50/13-09-05_colony_PCR_pS005_C9-C16_BB_verification_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/05_colony PCR_pS006_C1-C8_BB verification primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/be/3-09-05_colony_PCR_pS006_C1-C8_BB_verification_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/05_colony PCR_pS006_C9-C16_BB verification primers<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/0/05/3-09-05_colony_PCR_pS006_C9-C16_BB_verification_primers.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/05_top down PCR_SPCR1,4,12,13<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/19/13-09-05_top_down_PCR_SPCR1%2C4%2C12%2C13.png" width="400"/><br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_6th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 6<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Digestions: linearized pSB1C3, linearized pSB1A3, SPCR2, SPCR3, SPCR11<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified PCR Product</td>
| |
| - | <td>16 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2OH2O</td>
| |
| - | <td>0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>cFastDigest Enzyme 2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>4 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR5, pSB1C3: XbaI/SpeI<br>
| |
| - | SPCR11, pSB1A3, pSB1C3: EcoRI/PstI<br>
| |
| - | SPCR13, pSB1A3, pSB1C3: EcoRI/PstI<br>
| |
| - | SPCR2, pSB1A3, pSB1C3: EcoRI/PstI<br>
| |
| - | <br>
| |
| - | 1h at 37° shaking<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Saturday_7th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 7<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligation, Making Electrocompetent Cells, Gibson Assembly, Transformation, Liquid culture of E1010
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Ligation</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Vector</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Insert</td>
| |
| - | <td>3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR5, pSB1C3<br>
| |
| - | SPCR11, pSB1A3, pSB1C3<br>
| |
| - | SPCR13, pSB1A3, pSB1C3<br>
| |
| - | SPCR2, pSB1A3, pSB1C3<br>
| |
| - | <br>
| |
| - | Incubate at room temperature for 10 minutes.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Making Electrocompetent Cells</b><br>
| |
| - | 1) Start a liquid culture of cells.<br>
| |
| - | NEB turbo<br>
| |
| - | 2) dilute the cells 100X.<br>
| |
| - | 100 ml LB.<br>
| |
| - | Grow at 30°C for about 90 minutes. <br>
| |
| - | 3) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8<br>
| |
| - | Split the culture into 2x 50 ml falcon tubes, on ice.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 5) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 2x 25 ml of ice cold water.<br>
| |
| - | Combine the volumes in a single 50 ml falcon tube.<br>
| |
| - | 6) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.<br>
| |
| - | 7) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 ul of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gibson Assembly</b><br>
| |
| - | <br>
| |
| - | Amount per Reaction<br>
| |
| - | Positive Control**<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | PCR Fragment(s)<br>
| |
| - | + linearized vector<br>
| |
| - | 2-10 μl (0.02–0.5 pmols)*<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | Gibson<br>
| |
| - | Assembly Master<br>
| |
| - | Mix (2X)<br>
| |
| - | 10 μl<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | Deionized H2O<br>
| |
| - | XX μl
| |
| - | <br>
| |
| - | <br>
| |
| - | Total Volume<br>
| |
| - | 20 μl<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <br>
| |
| - | Incubate samples in a thermocycler at 50°C for 15 minutes. <br>
| |
| - | Put on Ice<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Transformation</b>
| |
| - | pS002 (Chl), pS002 (Amp), pS003 (Amp), pS004 (Chl), pS004 (Amp), pS005 (Chl), pS006-7 (Chl), pS007 (Chl), pS008 (Amp), pS009 (Chl), pS012 (Amp), pS013 (Chl), pS013 (Amp) <br>
| |
| - | <br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 1/2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 10/200 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br>
| |
| - | <b>Liquid culture of E1010</b><br>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Sunday_8th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 8<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Replating of transformation and Miniprep of E1010
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Replating of Transformation</b><br>
| |
| - | <br>
| |
| - | <b>Miniprep of E1010</b><br>
| |
| - | 1) Pellet liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Monday_16th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 16<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Result Cloning, Protocol: E. coli Colony PCR, Extraction of DNA, PCR Reaction and Gels
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Result Cloning:</b><br>
| |
| - | Colonies?<br>
| |
| - | pS002 (Chl): no<br>
| |
| - | pS002 (Amp): yes<br>
| |
| - | pS003 (Amp):yes<br>
| |
| - | pS004 (Chl): no<br>
| |
| - | pS004 (Amp): yes<br>
| |
| - | pS005 (Chl): yes<br>
| |
| - | pS006-7 (Chl): yes<br>
| |
| - | pS006 (Chl): no<br>
| |
| - | pS007 (Chl): yes<br>
| |
| - | pS008 (Amp): yes<br>
| |
| - | pS009 (Chl): yes<br>
| |
| - | pS012 (Amp): yes<br>
| |
| - | pS013 (Chl): no<br>
| |
| - | pS013 (Amp): yes<br>
| |
| - | <br>
| |
| - | <b>Protocol: E. coli Colony PCR</b><br>
| |
| - | Using the Dream Taq Master Mix<br>
| |
| - | <br>
| |
| - | <b>Extraction of DNA</b><br>
| |
| - | <br>
| |
| - | 1) Pick a single colony into 50 ul of H20.<br>
| |
| - | <br>
| |
| - | 2) Boil for 5 minutes.<br>
| |
| - |
| |
| - | <br>
| |
| - | <b>PCR Reaction (pS002 (Chl-Lig), pS005 (Chl-G), pS006-7 (Chl-Lig), pS007 (Chl-G), pS008 (Amp-G), pS009 (Chl-G))</b><br>
| |
| - | <br>
| |
| - | Keep all the reagents at 4 °C while preparing the mixture.<br>
| |
| - | Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (from above)</td>
| |
| - | <td>1.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td>
| |
| - | <td>12.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>10 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>25 ul</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: NEB Quick-Load</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>15 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td>45.8 °C</td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>1 min per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>15 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gels</b><br>
| |
| - | 100V, 25-30 min, 1%<br>
| |
| - | <br>
| |
| - | Pictures: <br>
| |
| - | 13/09/16_colony PCR_ps007.BMP<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/50/13-09-16_colony_PCR_ps007.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/16_colony PCR_pS006-7.BMP<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/8/8d/13-09-16_colony_PCR_pS006-7.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/16_colony PCR_ps005.BMP<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/a/a6/13-09-16_colony_PCR_ps005.png" width="400"/><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | Result: didn’t work<br>
| |
| - | <br>
| |
| - | </table>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_17th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 17<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>PCR Reaction (pS003 (Amp-G), pS004 (Amp-Lig), pS012 (Amp-G), pS013 (Chl-Lig))</b><br>
| |
| - | <br>
| |
| - | Keep all the reagents at 4 °C while preparing the mixture.<br>
| |
| - | Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (from above)</td>
| |
| - | <td>1.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td>
| |
| - | <td>12.5 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>10 ul</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>25 ul</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: NEB Quick-Load</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>15 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td>45.8 °C</td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>1 min per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>15 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gels</b><br>
| |
| - | 100V, 30 min, 1%<br>
| |
| - | <br>
| |
| - | <b>Pictures:</b>
| |
| - | 13/09/17_colony PCR_pS009.JPG<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b5/13-09-17_colony_PCR_pS013.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/17_colony PCR_pS008_pS002.jpg<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/c0/13-09-17_colony_PCR_pS008_pS002.jpg" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/17_colony PCR_pS003.JPG<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/fb/13-09-17_colony_PCR_pS003.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/17_colony PCR_pS004.JPG<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/a/a4/13-09-17_colony_PCR_pS004.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/17_colony PCR_pS012.JPG<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/19/13-09-17_colony_PCR_pS012.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/17_colony PCR_pS013.JPG<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f7/13-09-17_colony_PCR_pS013.2.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Result: </b><br>
| |
| - | pS003: row 3,5 might have worked -> analytical digest<br>
| |
| - | pS004: all might have worked -> analytical digest<br>
| |
| - | pS013: all might have worked -> analytical digest<br>
| |
| - | pS012: row 3,4,5 might have workes -> analytical digest<br>
| |
| - | <br>
| |
| - | <b>Sequencing</b><br>
| |
| - | Bringing primers/plasmids away for sequencin<br>
| |
| - | Bacbbone, SPCR2 with iS002, iS032, iS028, iS029, iS030<br>
| |
| - | <br>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_18th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 16<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligations
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - |
| |
| - | <b>Ligation</b><br>
| |
| - | <br>
| |
| - | SPCR2 - Chl <br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Chl</td>
| |
| - | <td>2,95 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>4.55 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR2 - Amp<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Amp</td>
| |
| - | <td>3.4 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>4.1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR3 - Chl<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR3</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Amp</td>
| |
| - | <td>1.79 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>5.71 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR3 - Amp7
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Amp</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR 3</td>
| |
| - | <td>1.56 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>5.94 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR5 - Chl<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR 5</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Chl</td>
| |
| - | <td>4.55 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>3.45 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR11 - Chl<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Chl</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR11</td>
| |
| - | <td>1.3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>6.2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR2 - Amp<br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Amp</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR11</td>
| |
| - | <td>1.13 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>6.37 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1.0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzyme</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | at 16° for 1h<br>
| |
| - | <br>
| |
| - | <b>Transformation</b><br>
| |
| - | 1) Thaw competent cells on ice (Gibson Kit competent cells)<br>
| |
| - | 2) Place 20 ul of cells in a pre-chilled Eppendorf tube.<br>
| |
| - | 3) Add 2.5 ul of plasmid (from Biobrick stock)<br>
| |
| - | 4) Mix gently by flicking the tube.<br>
| |
| - | 5) Chill on ice for 10 minutes.<br>
| |
| - | 4) Heat shock at 42 °C for 30 seconds <br>
| |
| - | 5) Return to ice for 2 minutes.<br>
| |
| - | 6) Add 200 ul LB medium and recover the cells by shaking at 37 °C.<br>
| |
| - | Ampicillin: 15-30 minutes<br>
| |
| - | Chloramphenicol: 60-120 minutes<br>
| |
| - | 7) Plate out the cells on selective LB (10ul)<br>
| |
| - | 8. Incubate at 37 °C. Transformants should appear within 12 hrs.<br>
| |
| - | <br>
| |
| - | <b>Gel of Ligation products</b><br>
| |
| - | 1%, 100V, 40 min<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Sunday_22nd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 22<sup>nd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR and Gels
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>PCR</b><br>
| |
| - | M13 backbone<br>
| |
| - | <br>
| |
| - | SPCR16,17<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | Protocol see fotos<br>
| |
| - | <br>
| |
| - | <b>Gel</b>
| |
| - | 100V, 1%, 1,5h<br>
| |
| - | <br>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Monday_23rd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 23<sup>rd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gels and PCR
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Gel</b><br>
| |
| - | 100V, 1%, 1,5h<br>
| |
| - | <br>
| |
| - | Picture: 13/09/23_SPCR16_17_corresponding primers - PCRs didn't worked<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/0/0e/13-09-23_SPCR16_17_corresponding_primers.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | <b>PCR</b><br>
| |
| - | SPCR 16 (normal phusion at 48°C)<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: NEB Phusion</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>98°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>98°C</td>
| |
| - | <td>5 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>5 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br><br>
| |
| - | <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_24th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 24<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Overlap PCR, PCR of Overlap, Digestion, Gel extraction, Gels, PCR Purification, PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3) and liquid culture
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Overlap PCR</b><br>
| |
| - | SPCR5-SPCR2<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid(10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid (10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/8/8b/PB_labbooksensor01.JPG" width="300"><br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/6b/PB_labbooksensor02.JPG" width="300"><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>PCR of Overlap</b><br>
| |
| - | <br>
| |
| - | <b>Digestion</b><br>
| |
| - | M13 (EcoRI, PstI), pSB1C3 (EcoRI, PstI), psB1C3 (XbaI, SpeI)<br>
| |
| - | <br>
| |
| - |
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified Plasmid</td>
| |
| - | <td>20 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>63 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td>
| |
| - | <td>2.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2</td>
| |
| - | <td>2.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastAP Phosphatase</td>
| |
| - | <td>2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>100 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI)<br>
| |
| - | <br>
| |
| - |
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified PCR Product</td>
| |
| - | <td>16 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>20 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Gel</b><br>
| |
| - | pSB1C3<br>
| |
| - | 1%, 100V, 1h<br>
| |
| - | Picture: 13/09/24_pSB1C3 digest_EcoRI/PstI_XbaI/SpeI - digest worked<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/ec/13-09-24_pSB1C3_digest_EcoRI-PstI_XbaI-SpeI.JPG" width="400"/><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Gel extraction</b><br>
| |
| - | 1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.<br>
| |
| - | 2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 μl). To help dissolve gel, mix by vortexing the tube every 2–3 min during the incubation.<br>
| |
| - | 3. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).<br>
| |
| - | 4. Add 1 gel volume of isopropanol to the sample and mix (actually only needed for very small products or very big products)
| |
| - | 5. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min.<br>
| |
| - | 6. Discard flow-through and place QIAquick column back in the same collection tube.<br>
| |
| - | 7. To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.<br>
| |
| - | 8. Discard the flow-through and centrifuge the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).<br>
| |
| - | 9. Place QIAquick column into a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | 10. To elute DNA, add 30 μl elution buffer to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min.<br>
| |
| - | <br>
| |
| - | <b>Gel</b><br>
| |
| - | PCR Overlap<br>
| |
| - | 1%, 100V, 1h<br>
| |
| - | Picture: 13/09/24_Overlap PCR PCR SCPR5_SPCR2 - PCR didn't work<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/e8/13-09-24_Overlap_PCR_PCR_SCPR5_SPCR2.png" width="400"/><br>
| |
| - | <br>
| |
| - | <b>PCR Purification (M13 (EcoRI, PstI), SPCR2 (EcoRI, PstI), SPCR5 (XbaI, SpeI))</b><br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - | <br>
| |
| - | <b>PCR (SPCR2, SPCR3, SPCR5, SPCR6, SPCR7, SPCR8, SPCR9, SPCR10, SPCR11, linearize pSB1C3)</b><br>
| |
| - | each 8x<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td></td>
| |
| - | <td><b>1x</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <table border="1"><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <tr>
| |
| - | <td><b>Thermocycler Protocol: Fermentas Phusion</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>98°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>98°C</td>
| |
| - | <td>5 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td> </td>
| |
| - | <td>25 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>5 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Liquid culture</b><br>
| |
| - | NEB, sSP004, Fr-433<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_25th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 25<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel of PCR, PCR (SPCR5,6) and Miniprep Cas9, M13mp18
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel of PCR</b><br>
| |
| - | 1%, 100V, 1h<br>
| |
| - | <br>
| |
| - | Picture: 13/09/25_SPCR2-11 - SPCR2: worked, SPCR3: worked, SPCR5: didn't work, SPCR6: didn't work, SPCR7: didn't work, SPCR8: didn't work, SPCR9: didn't work, SPCR10: didn't work, SCPR11: worked <br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/ca/13-09-25_SPCR2-10.png" width="400"/><br>
| |
| - | <br>
| |
| - | <b>PCR (SPCR5,6)</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid)</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <td><b>Thermocycler Protocol: Fermentas Phusion</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>98°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>98°C</td>
| |
| - | <td>5 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td> </td>
| |
| - | <td>25 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>5 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Miniprep Cas9, M13mp18</b><br>
| |
| - | 1) Pellet liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_26th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 26<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel PCR 5,6, Digestion, PCR (SPCR7-10) and PCR purification
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel PCR 5,6</b>
| |
| - | 1%, 100V, 1h<br>
| |
| - | <br>
| |
| - | Picture: 13/09/26_SPCR5_6 - PCR didn't work<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b2/13-09-26_SPCR5_6.png"><br>
| |
| - | <br>
| |
| - | <b>Digestions: SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Purified PCR Product</td>
| |
| - | <td>16 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>0 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 1</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>FastDigest Enzyme 2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>20 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>PCR (SPCR7-10)</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td><b>x1</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid)</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <td><b>Thermocycler Protocol: Fermentas Phusion</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>98°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>98°C</td>
| |
| - | <td>5 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td> </td>
| |
| - | <td>25 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>5 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>PCR Purification: (SPCR2 (EcoRI, PstI), SPCR3 (EcoRI, PstI), SPCR4 (EcoRI, PstI), SPCR11 (EcoRI, PstI), lin pSB1C3 (EcoRI, PstI), lin pSB1A3 (EcoRI, PstI), SPCR5 (XbaI, SpeI), SPCR7 (XbaI, SpeI), lin pSB1C3 (XbaI, SpeI), in pSB1A3 (XbaI, SpeI)</b><br>
| |
| - | <br>
| |
| - | Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix.<br>
| |
| - | To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through. Place the QIAquick column back into the same tube<br>
| |
| - | To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.<br>
| |
| - | Discard flow-through and place the QIAquick column back in the same tube.<br>
| |
| - | Centrifuge the column for an additional 1 min.<br>
| |
| - | Place QIAquick column in a clean 1.5 ml microcentrifuge tube.<br>
| |
| - | To elute DNA, add 50 μl Buffer EB to the center of the QIAquick membrane and centrifuge the column for 1 min.<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_27th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 27<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Gel SPCR7-10, NEB liquid culture, Ligation, Electrocompetent cells and transformation
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Gel SPCR7-10</b><br>
| |
| - | 1%, 100V, 1h<br>
| |
| - | <br>
| |
| - | Picture: 13/09/27_SPCR7_8_9_10 - PCRs worked<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/9/91/13-09-27_SPCR7_8_9_10.png" width="400"/><br>
| |
| - | <br>
| |
| - | <b>NEB liquid culture</b><br>
| |
| - | 1:1000 of ON culture<br>
| |
| - | <br>
| |
| - | <b>Ligation</b><br>
| |
| - | <br>
| |
| - | pS006<br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR5</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR7</td>
| |
| - | <td>0,28 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.22 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS006’
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR5</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1C3 (XbaI/SpeI)</td>
| |
| - | <td>0,47 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.03 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS006*
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR5</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1A3 (XbaI/SpeI)</td>
| |
| - | <td>0,67 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>6.83 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS013
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR4</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR11</td>
| |
| - | <td>0,24 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.26 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS013'
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1C3 (EcoRI, SpeI)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR11</td>
| |
| - | <td>0,28 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.22 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS013*
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1A3 (EcoRI, PstI))</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR11</td>
| |
| - | <td>0,3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS004
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR4</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR3</td>
| |
| - | <td>0,2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS004'
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1C3 (EcoRI, PstI)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR3</td>
| |
| - | <td>0,3 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.2 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS004*
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1A3 (EcoRI, PstI)</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR3</td>
| |
| - | <td>0,27 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>7.23 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS002'
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1C3 (EcoRI, PstI)</td>
| |
| - | <td>0,8 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>6.7 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | pS002*
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>SPCR2</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>lin pSB1A3 (EcoRI, PstI)</td>
| |
| - | <td>0,6 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>H2O</td>
| |
| - | <td>6.9 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Buffer</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Fermentas T4 Ligase Enzime</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | 45min at 22°, 15 min at 16°<br>
| |
| - | <br>
| |
| - | <b>Electrocompetent cells</b><br>
| |
| - | 1) Start Culture<br>
| |
| - | 2) When the cells reach an OD600 of 0.2. <br>
| |
| - | 3) Harvest the cells.<br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | 4) Wash and combine the cells.<br>
| |
| - | Remove the supernatant.<br>
| |
| - | Resuspend the cells in 25 ml of ice cold water<br>
| |
| - | 5) Wash the cells 2 more times.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 50 ml of ice cold water.<br>
| |
| - | Repeat.<br>
| |
| - | 6) Wash and concentrate the cells for electroporation.<br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.<br>
| |
| - | Resuspend in 1-2 ml of ice cold water.<br>
| |
| - | We will use 200 ul of washed cells per transformation.<br>
| |
| - | <br>
| |
| - | <b>Transformation</b><br>
| |
| - | pS006, pS006’, pS006*, pS013, pS013’, pS013*, pS004, pS004’, pS004*, pS002’, pS002*<br>
| |
| - | <br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)<br>
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.<br>
| |
| - | Add 200 ul of washed cells to a cuvette.<br>
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.<br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.<br>
| |
| - | Keep the cuvette on ice until just before the electroporation.<br>
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.<br>
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.<br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.<br>
| |
| - | Use the EC2 setting.<br>
| |
| - | <br>
| |
| - | 6) Listen for arcing.<br>
| |
| - | A cracking sound means all the cells are dead.<br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.<br>
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.<br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.<br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.<br>
| |
| - | <br>
| |
| - | 8) Incubate 1/2 h at 37 °C with shaking.<br>
| |
| - | <br>
| |
| - | 9) Plate 10/200 ul of recovered cells on selective plates.<br>
| |
| - | Use antibiotic appropriate to the part being integrated.<br>
| |
| - | Let the other 900 ul rest overnight at room temperature.<br>
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells<br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.<br>
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.<br>
| |
| - | Colonies should appear 24-48 h after plating.<br>
| |
| - | <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Saturday_28th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 28<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Extraction of Genomic DNA, PCR Reaction and Restreak plates
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Protocol: E. coli Colony PCR (pS006’, pS006*, pS013, pS004, pS004*, pS002*)</b><br>
| |
| - | <br>
| |
| - | <b>Extraction of Genomic DNA</b><br>
| |
| - | <br>
| |
| - | 1) Pick a single colony into 50 ul of H20.<br>
| |
| - | Fresh colonies (grown that day) work best, but they can also come from 4 C.<br>
| |
| - | Pipet 2ul onto plates to have C1-C8<br>
| |
| - | Pipet 2 ul into 5ml Media with antibiotics to make liquid cultures<br>
| |
| - | <br>
| |
| - | 2) Boil for 5 minutes.<br>
| |
| - | 1.5 ul of this can be used directly for PCR.<br>
| |
| - | Best if used directly, but can also be stored at 4 C for a few days.<br>
| |
| - | <br>
| |
| - | <b>PCR Reaction</b><br>
| |
| - | <br>
| |
| - | Keep all the reagents at 4 °C while preparing the mixture.<br>
| |
| - | Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | <td><b>9x Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (from above)</td>
| |
| - | <td>1.5 µl</td>
| |
| - | <td>13.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td>
| |
| - | <td>12.5 µl</td>
| |
| - | <td>112.5 µl9x Volume</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>10 µl</td>
| |
| - | <td>90 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>25 µl</td>
| |
| - | <td>125 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <td><b>Thermocycler Protocol: Green Dream Taq</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>15 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td>46.8°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>1 min per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>10 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Restreak plates</b><br>
| |
| - | Some of the plates were too full grown -> Rstreak for single colonies<br>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Sunday_29th_September.html"</div></html>
| |
| - | <html><div id="detect_Monday_30th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 30<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Extraction of Genomic DNA, PCR reaction, Gels, Miniprep, PCR: SPCR5, SPCR6 and Liquid culture of pS004’ and pS013’
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Protocol: E. coli Colony PCR (pS006, pS013’,pS013*, pS004’, pS002’)</b><br>
| |
| - | <br>
| |
| - | <b>Extraction of Genomic DNA</b><br>
| |
| - | <br>
| |
| - | 1) Pick a single colony into 50 ul of H20.<br>
| |
| - | Fresh colonies (grown that day) work best, but they can also come from 4 C.<br>
| |
| - | Pipet 2ul onto plates to have C1-C8<br>
| |
| - | <br>
| |
| - | 2) Boil for 5 minutes.<br>
| |
| - | 1.5 ul of this can be used directly for PCR.<br>
| |
| - | Best if used directly, but can also be stored at 4 C for a few days.<br>
| |
| - | <br>
| |
| - | <b>PCR Reaction</b><br>
| |
| - | <br>
| |
| - | Keep all the reagents at 4 °C while preparing the mixture.<br>
| |
| - | Pre-heat the thermocycler to 95 °C and transfer your reaction directly from 4 °C.<br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | <td><b>9x Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | <td>4.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template DNA (from above)</td>
| |
| - | <td>1.5 µl</td>
| |
| - | <td>13.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Quick-Load® Taq 2X Master Mix</td>
| |
| - | <td>12.5 µl</td>
| |
| - | <td>112.5 µl9x Volume</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>10 µl</td>
| |
| - | <td>90 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>25 µl</td>
| |
| - | <td>125 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <td><b>Thermocycler Protocol: Green Dream Taq</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>95°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>95°C</td>
| |
| - | <td>15 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td>46.8°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>1 min per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>10 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Gels</b><br>
| |
| - | 1%, 100V, 45 min<br>
| |
| - | <br>
| |
| - |
| |
| - | Pictures + Results<br>
| |
| - | 13/09/30_colony pcr_pS004_pS013 - 1-8: pS004 (gRNA - Amp), 9-16: pS013 (crRNA - Amp) - seems to have worked beside pS013 C7<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/c5/13-09-30_colony_pcr_pS004_pS013.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/30_colony PCR_pS004*_pS002* - 1-8: pS004* (gRNA - Amp), 9-16: pS002 (reporter - Amp) - pS004* seems to have worked (C1, C2, C3, C6)<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/2/20/3-09-30_colony_PCR_pS004%2A_pS002%2A.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/30_colony PCR_pS006'_pS006* - 1-8: pS006' (Cas9 - Chl), 9-16: pS006* (Cas9 - Amp) - didn’t work<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/4/44/13-09-30_colony_PCR_pS006%27_pS006%2A.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/30_Colony PCR_pS013'_pS013* - 1-8: pS013' (crRNA - Chl), 9-16: pS013* (crRNA - Amp) - Seems to have worked beside 13’ C7, C8<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/ca/13-09-30_Colony_PCR_pS013%27_pS013%2A.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/30_colony PCR_pS004'_pS002' - 1-8: pS004' (gRNA - Chl), 9-16: pS002' (reporter - Chl) - pS004' seems to have worked beside C6<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/9/9f/13-09-30_colony_PCR_pS004%27_pS002%27.png" width="400"/><br>
| |
| - | <br>
| |
| - | 13/09/30_Colony PCR_pS006 - didn’t work<br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/bf/13-09-30_Colony_PCR_pS006.png" width="400"/><br>
| |
| - | <br>
| |
| - | other gel images that proof that the reporter as well as the Cas9 construct worked will follow soon!
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Miniprep</b><br>
| |
| - | pS013, pS004<br>
| |
| - | 1) Pellet liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <br>
| |
| - | <b>PCR: SPCR5, SPCR6 (gradient + touch down 55-75, -1°/cycle)</b><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td><b>Reagent</b></td>
| |
| - | <td><b>Volume</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td></td>
| |
| - | <td><b>11x</b></td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Nuclease-free water</td>
| |
| - | <td>37.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>5x Phusion HF Buffer</td>
| |
| - | <td>10 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>10 mM dNTPs</td>
| |
| - | <td>1 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Forward Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Reverse Primer (10 uM)</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Template Plasmid)</td>
| |
| - | <td>0.25 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Phusion DNA Polymerase</td>
| |
| - | <td>0.5 µl</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td><b>Total Volume</b></td>
| |
| - | <td>50 µl</td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <table border="1">
| |
| - | <td><b>Thermocycler Protocol: Fermentas Phusion</b></td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td>Temp</td>
| |
| - | <td>Time</td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Start</td>
| |
| - | <td>98°C </td>
| |
| - | <td>30 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 1</td>
| |
| - | <td>98°C</td>
| |
| - | <td>5 sec</td>
| |
| - | <td>Melt</td>
| |
| - | <td>35 cycles</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 2</td>
| |
| - | <td> </td>
| |
| - | <td>25 sec</td>
| |
| - | <td>Anneal</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Cycle 3</td>
| |
| - | <td>72°C</td>
| |
| - | <td>30 sec per kb</td>
| |
| - | <td>Extend</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Finish</td>
| |
| - | <td>72 °C</td>
| |
| - | <td>5 min</td>
| |
| - | <td>Extand</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Store</td>
| |
| - | <td>10°C</td>
| |
| - | <td>Forever</td>
| |
| - | <td>Store</td>
| |
| - | <td> </td>
| |
| - | </tr>
| |
| - | </table><br>
| |
| - | <br>
| |
| - | <b>Liquid culture of pS004’ and pS013’</b>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_1st_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 1<sup>st</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Miniprep
| |
| - | pS013’, pS004’
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | 1) Pellet liquid culture (4000rpm, 10 min)<br>
| |
| - | 2) Discard supernatant<br>
| |
| - | 3) resuspend the cells in 250ul of resuspension olution<br>
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times<br>
| |
| - | 5) add 350ul of neutralization solution<br>
| |
| - | 4) centrifuge for 5 min<br>
| |
| - | 5) transfer supernatant to spin column<br>
| |
| - | 6) centrifuge for 1 min<br>
| |
| - | 7) discard flow through<br>
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)<br>
| |
| - | 9) centrifuge for 1 min to remove left over liquid<br>
| |
| - | 10) transfer the column on a 1.5ml tube<br>
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min<br>
| |
| - | 12) centrifuge for 2 min<br>
| |
| - | 13) Nanodrop the concentration and freeze at -20°<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_2nd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3> Wednesday 2<sup>nd</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Preparation killing assay
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <br>
| |
| - | <b>Liquid cultures</b><br>
| |
| - | R16, R26, R26f, delta PyrF, parental delta PyrF, NEB, M13, Litmus + Helper, Litmus GFP + helper
| |
| - | <html><div id="detect_Thursday_3rd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wedsnesday 3<sup>rd</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Killing assay to test specifity of CRISPR Cas
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <b>Electrocompetent cells (delta PyrF, parental, NEB)</b>
| |
| - | <br>
| |
| - | 1) Start Culture
| |
| - | <br>
| |
| - | 2) When the cells reach an OD600 of 0.2.
| |
| - | <br>
| |
| - | 3) Harvest the cells.
| |
| - | <br>
| |
| - | When the cells reach an OD600 of between 0.6 and 0.8 (OD: 0,683)
| |
| - | <br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.
| |
| - | <br>
| |
| - | 4) Wash and combine the cells.
| |
| - | <br>
| |
| - | Remove the supernatant.
| |
| - | <br>
| |
| - | Resuspend the cells in 25 ml of ice cold water
| |
| - | <br>
| |
| - | 5) Wash the cells 2 more times.
| |
| - | <br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.
| |
| - | <br>
| |
| - | Resuspend in 50 ml of ice cold water.
| |
| - | <br>
| |
| - | Repeat.
| |
| - | <br>
| |
| - | 6) Wash and concentrate the cells for electroporation.
| |
| - | <br>
| |
| - | Centrifuge at 4 °C for 10 min at 4000 rpm.
| |
| - | <br>
| |
| - | Resuspend in 1-2 ml of ice cold water.
| |
| - | <br>
| |
| - | We will use 200 ul of washed cells per transformation.
| |
| - | <br>
| |
| - | <br>
| |
| - | <b>Transformation </b>
| |
| - | <br>
| |
| - | Cotransform into parental/keio delta pyRF: pS006* (Cas9 in Amp BB) + pS004'(gRNA in Chl BB).<br>
| |
| - | 1) Prepare BD tubes with a pipette filled with LB at the interior of each tube (pipette supplied with the electroporation cuvette)
| |
| - | <br>
| |
| - | 2) Test the purity of the electrocompetent cells.
| |
| - | <br>
| |
| - | Add 200 ul of washed cells to a cuvette.
| |
| - | <br>
| |
| - | 3) Mix the cells and DNA in a cuvette.
| |
| - | <br>
| |
| - | 200 ul of washed cells with 200 ng of PCR product.
| |
| - | <br>
| |
| - | Keep the cuvette on ice until just before the electroporation.
| |
| - | <br>
| |
| - | 4) Preload a pipette with 1 ml of LB.
| |
| - | <br>
| |
| - | 5) Pulse the cuvette with voltage.
| |
| - | <br>
| |
| - | Dry the electrodes with a kimwipe prior to loading.
| |
| - | <br>
| |
| - | Use the EC2 setting.
| |
| - | <br>
| |
| - | 6) Listen for arcing.
| |
| - | <br>
| |
| - | A cracking sound means all the cells are dead.
| |
| - | <br>
| |
| - | Note the time constant: 5 is good, 5.8 is great.
| |
| - | <br>
| |
| - | 7) Immediately recover the cells.
| |
| - | <br>
| |
| - | Add the 1 ml of preloaded LB and pipet up and down to mix.
| |
| - | <br>
| |
| - | Collect 1 ml of cells, some volume is lost in the cuvette.
| |
| - | <br>
| |
| - | 8) Incubate 1/2 h at 37 °C with shaking.
| |
| - | <br>
| |
| - | 9) Plate 10/200 ul of recovered cells on selective plates.
| |
| - | <br>
| |
| - | Use antibiotic appropriate to the part being integrated.
| |
| - | <br>
| |
| - | Let the other 900 ul rest overnight at room temperature.
| |
| - | <br>
| |
| - | 10) Concentrate and plate the remaining cells
| |
| - | <br>
| |
| - | Spin down quickly and resuspend in 100 ul LB before plating.
| |
| - | <br>
| |
| - | Transformed cells should be incubated at 37 °C.
| |
| - | <br>
| |
| - | Colonies should appear 24-48 h after plating.
| |
| - | <br>
| |
| - |
| |
| - | <br>
| |
| - | <br>
| |
| - | Plating of 10/100ul on <br>
| |
| - | 1. Amp plates -> selection for only Cas9<br>
| |
| - | 2. Chl plates -> selection for only gRNA<br>
| |
| - | 3. Amp/Chl plates -> selection for theoretically functional system<br>
| |
| - |
| |
| - | <html><div id="detect_Monday_14th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 14<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid cultures sSP008, sSP009, R16, R26, R26f, sT007, sSP021, SCPR2-A3, SPCE2-C3
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Tuesday_15th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 15<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Digestion Reporter and SPCR3
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | BB: SpeI, PstI<br>
| |
| - | SPCR: XbaI, PstI<br>
| |
| - | 2h 37°, heat inactivation<br>
| |
| - | <br>
| |
| - | Electrocompetent cells: sSP008, sSP009<br>
| |
| - | Transform SPCR2-A3/C3 both into sSP008/9<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Wednesday_16th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 16<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Miniprep of pS002, pS002’, pS006*
| |
| - | Liquid culture sSP017, pS004, pS004’
| |
| - | Glycerols
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Thursday_17th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 17<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Miniprep sSP017, pS004, pS004’<br>
| |
| - | <br>
| |
| - | Digest Litmus pS018 EcoRI/PstI, EcoRI/XbaI 2h 37° shaking<br>
| |
| - | <br>
| |
| - | PCR purify<br>
| |
| - | <br>
| |
| - | Ligation:<br>
| |
| - | 1. gRNA+phagmid (10,4+6)<br>
| |
| - | 2.phagemid+gRNA+reporter (9,6+1,86+2)<br>
| |
| - | 3.phagemid+gRNA+Cas9 (10,2+2,04+3)<br>
| |
| - | <br>
| |
| - | 1h at 22°<br>
| |
| - | <br>
| |
| - | Transform<br>
| |
| - | Heat shock, cells matt<br>
| |
| - | Recover, plate<br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_18th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 18<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Miller assay and Liquid phagemid
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your note here
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Saturday_19th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 19<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Miller<br>
| |
| - | Miniprerp phagemid<br>
| |
| - | Digest phagemid E/P, E/X, SPCR3 E,P<br></b>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Tuesday_22nd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 22<sup>nd</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid for Miller and Digest&purify SPCR3 E,P
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="detect_Thursday_24th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 24<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Digest phagemid E/P</b><br>
| |
| - | Purify it<br>
| |
| - | <br>
| |
| - | <b>Ligation:</b><br>
| |
| - | 1. SPCR3 E/P + phagemid E/P<br>
| |
| - | 2. SPCR3 E/P + SPCR5 P/X+ phagemid E/X<br>
| |
| - | 2. SPCR3 E/P + SPCR2 P/X+ phagemid E/X<br>
| |
| - | <br>
| |
| - | <b>trafo Ligations<br>
| |
| - | <br>
| |
| - | electrocmpetent cells parental+sSP009+pS002’<br>
| |
| - | trafo:</b><br>
| |
| - | 1. parental+pS002<br>
| |
| - | 2. parental+pS002’<br>
| |
| - | 3. parental+pS006*<br>
| |
| - | 4. parental+pS002’+pS006*<br>
| |
| - | 5. sSP009 pS002’ + pS006*<br>
| |
| - | <br>
| |
| - | trafo helper into NEB<br>
| |
| - | <br>
| |
| - | liquid cultures: sSP009, pRECA strains Ariel, sSP008+pS002, sSP008+pS002’
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="detect_Friday_25th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Detect</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Detect" target="_blank" class="tbnotelogo PSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 25<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Colony PCR<br>
| |
| - | Liquid Cloning</b><br>
| |
| - | <br>
| |
| - | Liquid: NEB helper, parental pS002, parental pS006*, sSP008+pS002, sSP008+pS002’<br>
| |
| - | <br>
| |
| - | Trafo: NEB helper+phageid-gRNA, parental ps006*+pS002’, pyrfF F+ pS002’+pS006*<br>
| |
| - | <br>
| |
| - | conjugation of parental pS006* with pS009<br>
| |
| - | <br>
| |
| - | Miniprep phagemid gRNA<br>
| |
| - | <br>
| |
| - | Liquid library<br>
| |
| - | Restreak for library<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | 1) sSP008+pS002/pS002’ +Xgal<br>
| |
| - | 2) sSP008+pS002/pS002’ +Xgal + MMC<br>
| |
| - | 3) sSP008+pS002/pS002’ +MMC<br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_10th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 10<sup>th</sup> June</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Design of SirA genes for synthesis
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>SirA</b>
| |
| - | <p><em>Mycobacterium tuberculosis</em>
| |
| - | <br>Reference: Pinto et al. 2007. Sulfite Reduction in Mycobacteria doi: 10.1128/JB.00487-07
| |
| - | <br>Primers:
| |
| - | <br>TBsirA F GGAATTCCATATGTCCGCGAAGGAGAACCCC
| |
| - | <br>TBsirA R AAGGAAAAAAGCGGCCGCTCATCGCAGGTCGTCCTCCTCGGCCCGGAT <br>
| |
| - | We blasted the above primers used to clone sirA from M. tuberculosis into E. coli. We then extracted the sequence from genbank to retrieve the following sequence which includes the restriction sites introduced by Pinto et al.</p>
| |
| - | <p style="font-family: courier">ggaattccat atgtccgcga aggagaaccc ccaaatgacc actgcacgtc <br>ccgccaaggc tcgaaatgag
| |
| - | ggccagtggg cgctgggaca tcgcgagcca <br>ctcaacgcca acgaagagct gaagaaggcc
| |
| - | ggcaacccgc tcgacgtgcg <br>ggagcgcatc gaaaacatct acgccaaaca gggtttcgac
| |
| - | agcatcgaca <br>agaccgacct gcgagggcgc tttcgctggt ggggcctgta cacccagcgt
| |
| - | <br>gagcagggct acgacggcac ctggaccggt gacgacaaca tcgacaagct <br>cgaggccaaa
| |
| - | tacttcatga tgcgggtgcg ttgcgacggc ggcgcgctct <br>cggctgccgc gctgcgcacg
| |
| - | ctgggccaga tctcgacgga gttcgcgcgc <br>gataccgccg atatctccga ccggcagaac
| |
| - | gtgcaatacc actggatcga <br>agtggaaaac gtccctgaaa tctggcgacg gttagacgat
| |
| - | gtcggactgc <br>agaccaccga ggcgtgcggt gactgcccgc gggtagtgct gggctcgccg
| |
| - | <br>ttggccggcg agtcgctcga cgaagtgctc gacccgacct gggcgatcga <br>ggagatcgtg
| |
| - | cgtcgctaca tcggcaagcc cgacttcgcc gacttgccgc <br>gcaagtacaa gaccgccatc
| |
| - | tctggcctgc aggacgtcgc gcacgagatc <br>aacgacgtcg ccttcatcgg cgtcaaccat
| |
| - | cccgagcacg gaccaggcct <br>ggatctgtgg gtgggcggtg gactgtcgac caacccgatg
| |
| - | ctggcccagc <br>gggtcggcgc ctgggttcca ctgggcgaag tgcccgaggt gtgggcggcg
| |
| - | <br>gtcacctcgg tgtttcgcga ctacggctac cggcgactgc gcgccaaggc <br>ccggctgaaa
| |
| - | tttctgatca aagactgggg catagcgaag ttccgcgaag <br>tgctcgaaac cgagtacctc
| |
| - | aagcgtccgc tgatcgacgg tccggccccc <br>gaaccggtca agcatccgat cgaccacgtc
| |
| - | ggggtgcaac gactcaagaa <br>cgggctcaac gccgtcggag tcgcccccat cgccgggcgg
| |
| - | gtatcgggca <br>ccatcctcac ggcggtcgcc gacctgatgg cgcgggccgg ttccgaccgg
| |
| - | <br>atccggttca ccccctacca gaagctggtc atcctcgaca ttccggacgc <br>cttgctcgac
| |
| - | gacttgatcg ccggtctgga cgcgctgggg ctgcagtcgc <br>gcccgtcgca ttggcgccgg
| |
| - | aacttgatgg cgtgcagcgg gattgagttc <br>tgcaagttgt cattcgccga aacccgggtt
| |
| - | cgagcacagc atttggtgcc <br>cgagctggaa cgccggcttg aggacatcaa ctcgcagctc
| |
| - | gacgtaccga <br>tcaccgtcaa catcaacggc tgcccgaact catgtgcgcg aattcaaatc
| |
| - | <br>gccgacatcg gattcaaggg acagatgatc gacgacggac acggcggctc <br>cgtcgaaggc
| |
| - | ttccaggtgc atctgggcgg acacctcggc ctggatgccg <br>gattcggccg caaactgcgc
| |
| - | cagcacaagg tcaccagtga cgaactcggc <br>gactacatcg accgggtggt gcgcaacttc
| |
| - | gtcaaacacc gcagcgaagg <br>tgaacgcttc gcgcagtggg tcatccgggc cgaggaggac
| |
| - | gacctgcgat <br>gagcggccgc ttttttcctt</p>
| |
| - | <p>This sequence was then inserted into Geneious. The PstI and EcoRI sites were manually removed and replaced with silent mutations. A NcoI site was inserted at the start codon and an extra glycine was added after the start codon for the NcoI site to function properly. We chose glycine as it is small an unlikely to interfere with either polar or non-polar domains within the protein. We used GGC as the codon as it is the highest used glycine codon in e. coli. We also added an AvrII site on the 3’ end of the site. We then added biobrick restriction sites on the ends of the sequence (EcoRI, XbaI, SpeI, PstI). This will allow us to clone into our expression vector pACYCDuet-1 with NcoI and AvrII enzymes and into a biobrick registry with EcoRI and PstI. The insertion into pACYCDuet-1 removes both protein tags and cuts out the second MCS resulting in vector pACYCDuet-TBsirA. The resulting sequence for TB SirA follows:</p>
| |
| - | <p style="font-family: courier">catggaattc tagaccatgg gctccgcgaa ggagaacccc caaatgacca <br>ctgcacgtcc cgccaaggct cgaaatgagg gccagtgggc gctgggacat <br>cgcgagccac tcaacgccaa cgaagagctg aagaaggccg gcaacccgct <br>cgacgtgcgg gagcgcatcg aaaacatcta cgccaaacag ggtttcgaca <br>gcatcgacaa gaccgacctg cgagggcgct ttcgctggtg gggcctgtac <br>acccagcgtg agcagggcta cgacggcacc tggaccggtg acgacaacat <br>cgacaagctc gaggccaaat acttcatgat gcgggtgcgt tgcgacggcg <br>gcgcgctctc ggctgccgcg ctgcgcacgc tgggccagat ctcgacggag <br>ttcgcgcgcg ataccgccga tatctccgac cggcagaacg tgcaatacca <br>ctggatcgaa gtggaaaacg tccctgaaat ctggcgacgg ttagacgatg <br>tcggacttca gaccaccgag gcgtgcggtg actgcccgcg ggtagtgctg <br>ggctcgccgt tggccggcga gtcgctcgac gaagtgctcg acccgacctg <br>ggcgatcgag gagatcgtgc gtcgctacat cggcaagccc gacttcgccg <br>acttgccgcg caagtacaag accgccatct ctggccttca ggacgtcgcg <br>cacgagatca acgacgtcgc cttcatcggc gtcaaccatc ccgagcacgg <br>accaggcctg gatctgtggg tgggcggtgg actgtcgacc aacccgatgc <br>tggcccagcg ggtcggcgcc tgggttccac tgggcgaagt gcccgaggtg <br>tgggcggcgg tcacctcggt gtttcgcgac tacggctacc ggcgactgcg <br>cgccaaggcc cggctgaaat ttctgatcaa agactggggc atagcgaagt <br>tccgcgaagt gctcgaaacc gagtacctca agcgtccgct gatcgacggt <br>ccggcccccg aaccggtcaa gcatccgatc gaccacgtcg gggtgcaacg <br>actcaagaac gggctcaacg ccgtcggagt cgcccccatc gccgggcggg <br>tatcgggcac catcctcacg gcggtcgccg acctgatggc gcgggccggt <br>tccgaccgga tccggttcac cccctaccag aagctggtca tcctcgacat <br>tccggacgcc ttgctcgacg acttgatcgc cggtctggac gcgctggggc <br>ttcagtcgcg cccgtcgcat tggcgccgga acttgatggc gtgcagcggg <br>attgagttct gcaagttgtc attcgccgaa acccgggttc gagcacagca <br>tttggtgccc gagctggaac gccggcttga ggacatcaac tcgcagctcg <br>acgtaccgat caccgtcaac atcaacggct gcccgaactc atgtgcgcga <br>gttcaaatcg ccgacatcgg attcaaggga cagatgatcg acgacggaca <br>cggcggctcc gtcgaaggct tccaggtgca tctgggcgga cacctcggcc <br>tggatgccgg attcggccgc aaactgcgcc agcacaaggt caccagtgac <br>gaactcggcg actacatcga ccgggtggtg cgcaacttcg tcaaacaccg <br>cagcgaaggt gaacgcttcg cgcagtgggt catccgggcc gaggaggacg <br>acctgcgatg agcggccgcc taggactact agtctgcagt ttttcctt</p>
| |
| - | <p><em>Mycobacterium smegmatis</em>
| |
| - | <br>This reference also contains the cloning of sirA from T. smegmatis. We used the primers below taken from Pinto et al, blasted against the T. smegmatis genome and extracted the sirA sequence from genbank as above.
| |
| - | <br>Primers: <br>smegsirA F TACAGCTGATGCTCGAAGACGAGTACTTCAT
| |
| - | <br>smegsirA R CCCAAGCTTTCACGTTGCCTACCTCAAATCCGCTTCGTC</p>
| |
| - | <p style="font-family: courier">
| |
| - | tacagctgat gctcgaagac gagtacttca tgctgcgcgt gcgctgcgat
| |
| - | <br>ggtggcgcgc tgaccactgc agcgctgcgc acgctcggcg gcatctcgac
| |
| - | <br>cgagttcgcg cgcgacaccg ccgacatctc cgaccgcgag aacgtccagt
| |
| - | <br>accactggat ccaggtcgag aacatgcccg agatctggaa gcgcctcgac
| |
| - | <br>gccgtcggcc tgcagaccac cgaggcgtgc ggcgactgcc cgcgtgtggt
| |
| - | <br>cctcggctcg ccgctggccg gtgagtccct cgacgaggtg atcgacggga
| |
| - | <br>cccccgcgat cgacgagatc gtgcgccgct acatcggcaa gcccgagtac
| |
| - | <br>tcgaacctgc cgcgcaagtt caagaccgcg atctcggggc ttcaggacgt
| |
| - | <br>ggtccacgag gtcaacgacg tcgcgttcat cggcgtcaac caccccgagc
| |
| - | <br>acggcccggg cttcgacctg tgggtcggtg gcggcctgtc gaccaacccg
| |
| - | <br>atgctggccc agcgcgtcgg ggtgtgggtg ccgctcgacg aggtgcccga
| |
| - | <br>cgtctgggag ggcgtcgtca gcatcttccg cgactacggt taccggcgtc
| |
| - | <br>tgcggtcgaa ggcgcggctg aagttcctga tcaaggactg gggcgtcgaa
| |
| - | <br>aagttcaggg aagtgctgga aaccgagtac ctcaagcgcc ccctgatcga
| |
| - | <br>cggcccggca cccgaaccgg tgacccgccc catcgaccac gtcggtgtgc
| |
| - | <br>agaagctcaa gaacggcctc aacgccgtgg gcgtcgcccc gatcgcgggt
| |
| - | <br>cgcgtctcgg gcacgatcct gaccaaggtg gccgatctcg ccgaggccgc
| |
| - | <br>cgggtccgac cggatccgct tcacgccgta ccagaagctg atcatcctcg
| |
| - | <br>acgtgcccga cgacaagatc gacgaactgc gcgctggcct cgacgcgctc
| |
| - | <br>ggactgccgt cgacgccgtc gcactggcgc cgcaacctca tggcgtgcac
| |
| - | <br>gggtatcgag ttctgcaagc tgagcttcgc cgagacccgc aagcgtgccc
| |
| - | <br>aggtgctggt tcccgagctg gagaaacggc tcgacgacat caacgcccag
| |
| - | <br>ctcgacgtgc ccatcacggt caacatcaac ggctgcccca actcgtgcgc
| |
| - | <br>ccgtatccag gtcgccgaca tcgggttcaa gggccagatg gtcgacgatg
| |
| - | <br>gcaacggccc cgaggagggt ttccaggtgc atctgggcgg cagcctgggc
| |
| - | <br>ctggacagcg ggttcggccg caagctgcgc cagcacaagg tgctctcgtc
| |
| - | <br>cgagctcggc gactacatcg agcgcgtcgt gcgcaacttc gtgaaacaac
| |
| - | <br>gcgaggacgg cgagcgtttc gcccagtggg ccgtgcgggc cgacgaagcg
| |
| - | <br>gatttgaggt aggcaacgtg aaagcttggg</p>
| |
| - | <p>As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. This resulted in the following sequence for synthesis:</p>
| |
| - | <p style="font-family: courier">
| |
| - | tacagaattc tagaccatgg gcctcgaaga cgagtacttc atgctgcgcg
| |
| - | <br>tgcgctgcga tggtggcgcg ctgaccacta cagcgctgcg cacgctcggc
| |
| - | <br>ggcatctcga ccgagttcgc gcgcgacacc gccgacatct ccgaccgcga
| |
| - | <br>gaacgtccag taccactgga tccaggtcga gaacatgccc gagatctgga
| |
| - | <br>agcgcctcga cgccgtcggc ctacagacca ccgaggcgtg cggcgactgc
| |
| - | <br>ccgcgtgtgg tcctcggctc gccgctggcc ggtgagtccc tcgacgaggt
| |
| - | <br>gatcgacggg acccccgcga tcgacgagat cgtgcgccgc tacatcggca
| |
| - | <br>agcccgagta ctcgaacctg ccgcgcaagt tcaagaccgc gatctcgggg
| |
| - | <br>cttcaggacg tggtccacga ggtcaacgac gtcgcgttca tcggcgtcaa
| |
| - | <br>ccaccccgag cacggcccgg gcttcgacct gtgggtcggt ggcggcctgt
| |
| - | <br>cgaccaaccc gatgctggcc cagcgcgtcg gggtgtgggt gccgctcgac
| |
| - | <br>gaggtgcccg acgtctggga gggcgtcgtc agcatcttcc gcgactacgg
| |
| - | <br>ttaccggcgt ctgcggtcga aggcgcggct gaagttcctg atcaaggact
| |
| - | <br>ggggcgtcga aaagttcagg gaagtgctgg aaaccgagta cctcaagcgc
| |
| - | <br>cccctgatcg acggcccggc acccgaaccg gtgacccgcc ccatcgacca
| |
| - | <br>cgtcggtgtg cagaagctca agaacggcct caacgccgtg ggcgtcgccc
| |
| - | <br>cgatcgcggg tcgcgtctcg ggcacgatcc tgaccaaggt ggccgatctc
| |
| - | <br>gccgaggccg ccgggtccga ccggatccgc ttcacgccgt accagaagct
| |
| - | <br>gatcatcctc gacgtgcccg acgacaagat cgacgaactg cgcgctggcc
| |
| - | <br>tcgacgcgct cggactgccg tcgacgccgt cgcactggcg ccgcaacctc
| |
| - | <br>atggcgtgca cgggtatcga gttctgcaag ctgagcttcg ccgagacccg
| |
| - | <br>caagcgtgcc caggtgctgg ttcccgagct ggagaaacgg ctcgacgaca
| |
| - | <br>tcaacgccca gctcgacgtg cccatcacgg tcaacatcaa cggctgcccc
| |
| - | <br>aactcgtgcg cccgtatcca ggtcgccgac atcgggttca agggccagat
| |
| - | <br>ggtcgacgat ggcaacggcc ccgaggaggg tttccaggtg catctgggcg
| |
| - | <br>gcagcctggg cctggacagc gggttcggcc gcaagctgcg ccagcacaag
| |
| - | <br>gtgctctcgt ccgagctcgg cgactacatc gagcgcgtcg tgcgcaactt
| |
| - | <br>cgtgaaacaa cgcgaggacg gcgagcgttt cgcccagtgg gccgtgcggg
| |
| - | <br>ccgacgaagc ggatttgagg taggcaacgt gaaagcctag gtactagtct
| |
| - | <br>gcagtggg
| |
| - | </p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_11th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 11<sup>th</sup> June</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Design of FdrA genes for synthesis
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>FdrA</b>
| |
| - | <p><em>Mycobacterium tuberculosis</em>
| |
| - | <br>Reference: McLean et al. 2003. Kinetic, spectroscopic and thermodynamic characterization of the Mycobacterium tuberculosis adrenodoxin reductase homologue FprA. doi: 10.1042/BJ20021692
| |
| - | <br>Primers: <br>MtbfdrA F TATGACTCATATGCGTCCCTATTACATCGCCATCG
| |
| - | <br>MtbfdrA R ATCCGGGATCCTCAGCCGAGCCCAATCCGCAACAGC
| |
| - | <br>The above primers were blasted to retrieve sequence of FprA from genebank resulting in the following sequence:</p>
| |
| - | <p style="font-family: courier">
| |
| - | <br>tatgactcat atgcgtccct attacatcgc catcgtgggc tccgggccgt
| |
| - | <br>cggcgttctt cgccgcggca tccttgctga aggccgccga cacgaccgag
| |
| - | <br>gacctcgaca tggccgtcga catgctggag atgttgccga ctccctgggg
| |
| - | <br>gctggtgcgc tccggggtcg cgccggatca ccccaagatc aagtcgatca
| |
| - | <br>gcaagcaatt cgaaaagacg gccgaggacc cccgcttccg cttcttcggc
| |
| - | <br>aatgtggtcg tcggcgaaca cgtccagccc ggcgagctct ccgagcgcta
| |
| - | <br>cgacgccgtg atctacgccg tcggcgcgca gtccgatcgc atgttgaaca
| |
| - | <br>tccccggtga ggacctgccg ggcagtatcg ccgccgtcga tttcgtcggc
| |
| - | <br>tggtacaacg cacatccaca cttcgagcag gtatcacccg atctgtcggg
| |
| - | <br>cgcccgggcc gtagttatcg gcaatggaaa cgtcgcgcta gacgtggcac
| |
| - | <br>ggattctgct caccgatccc gacgtgttgg cacgcaccga tatcgccgat
| |
| - | <br>cacgctttgg aatcgctacg cccacgcggt atccaggagg tggtgatcgt
| |
| - | <br>cgggcgccga ggtccgctgc aggccgcgtt caccacgttg gagttgcgcg
| |
| - | <br>agctggccga cctcgacggg gttgacgtgg tgatcgatcc ggcggagctg
| |
| - | <br>gacggcatta ccgacgagga cgcggccgcg gtgggcaagg tctgcaagca
| |
| - | <br>gaacatcaag gtgctgcgtg gctatgcgga ccgcgaaccc cgcccgggac
| |
| - | <br>accgccgcat ggtgttccgg ttcttgacct ctccgatcga gatcaagggc
| |
| - | <br>aagcgcaaag tggagcggat cgtgctgggc cgcaacgagc tggtctccga
| |
| - | <br>cggcagcggg cgagtggcgg ccaaggacac cggcgagcgc gaggagctgc
| |
| - | <br>cagctcagct ggtcgtgcgg tcggtcggct accgcggggt gcccacgccc
| |
| - | <br>gggctgccgt tcgacgacca gagcgggacc atccccaacg tcggcggccg
| |
| - | <br>aatcaacggc agccccaacg aatacgtcgt cgggtggatc aagcgcgggc
| |
| - | <br>cgaccggggt gatcgggacc aacaagaagg acgcccaaga caccgtcgac
| |
| - | <br>accttgatca agaatcttgg caacgccaag gagggcgccg agtgcaagag
| |
| - | <br>ctttccggaa gatcatgccg accaggtggc cgactggcta gcagcacgcc
| |
| - | <br>agccgaagct ggtcacgtcg gcccactggc aggtgatcga cgctttcgag
| |
| - | <br>cgggccgccg gcgagccgca cgggcgtccc cgggtcaagt tggccagcct
| |
| - | <br>ggccgagctg ttgcggattg ggctcggctg aggatcccgg at</p>
| |
| - | <p>As previously, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. However, in the case of FdrA, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:</p>
| |
| - | <p style="font-family: courier">
| |
| - | tatgaattct agatcatatg cgtccctatt acatcgccat cgtgggctcc
| |
| - | <br>gggccgtcgg cgttcttcgc cgcggcatcc ttgctgaagg ccgccgacac
| |
| - | <br>gaccgaggac ctcgacatgg ccgtcgacat gctggagatg ttgccgactc
| |
| - | <br>cctgggggct ggtgcgctcc ggggtcgcgc cggatcaccc caagatcaag
| |
| - | <br>tcgatcagca agcaattcga aaagacggcc gaggaccccc gcttccgctt
| |
| - | <br>cttcggcaat gtggtcgtcg gcgaacacgt ccagcccggc gagctctccg
| |
| - | <br>agcgctacga cgccgtgatc tacgccgtcg gcgcgcagtc cgatcgcatg
| |
| - | <br>ttgaacatcc ccggtgagga cctgccgggc agtatcgccg ccgtcgattt
| |
| - | <br>cgtcggctgg tacaacgcac atccacactt cgagcaggta tcacccgatc
| |
| - | <br>tgtcgggcgc ccgggccgta gttatcggca atggaaacgt cgcgctagac
| |
| - | <br>gtggcacgga ttctgctcac cgatcccgac gtgttggcac gcaccgatat
| |
| - | <br>cgccgatcac gctttggaat cgctacgccc acgcggtatc caggaggtgg
| |
| - | <br>tgatcgtcgg gcgccgaggt ccgcttcagg ccgcgttcac cacgttggag
| |
| - | <br>ttgcgcgagc tggccgacct cgacggggtt gacgtggtga tcgatccggc
| |
| - | <br>ggagctggac ggcattaccg acgaggacgc ggccgcggtg ggcaaggtct
| |
| - | <br>gcaagcagaa catcaaggtg ctgcgtggct atgcggaccg cgaaccccgc
| |
| - | <br>ccgggacacc gccgcatggt gttccggttc ttgacctctc cgatcgagat
| |
| - | <br>caagggcaag cgcaaagtgg agcggatcgt gctgggccgc aacgagctgg
| |
| - | <br>tctccgacgg cagcgggcga gtggcggcca aggacaccgg cgagcgcgag
| |
| - | <br>gagctgccag ctcagctggt cgtgcggtcg gtcggctacc gcggggtgcc
| |
| - | <br>cacgcccggg ctgccgttcg acgaccagag cgggaccatc cccaacgtcg
| |
| - | <br>gcggccgaat caacggcagc cccaacgaat acgtcgtcgg gtggatcaag
| |
| - | <br>cgcgggccga ccggggtgat cgggaccaac aagaaggacg cccaagacac
| |
| - | <br>cgtcgacacc ttgatcaaga atcttggcaa cgccaaggag ggcgccgagt
| |
| - | <br>gcaagagctt tccggaagat catgccgacc aggtggccga ctggctagca
| |
| - | <br>gcacgccagc cgaagctggt cacgtcggcc cactggcagg tgatcgacgc
| |
| - | <br>tttcgagcgg gccgccggcg agccgcacgg gcgtccccgg gtcaagttgg
| |
| - | <br>ccagcctggc cgagctgttg cggattgggc tcggctgagg atccctagga
| |
| - | <br>ctagtctgca gttacg</p>
| |
| - | <p><em>Mycobacterium smegmatis</em>
| |
| - | <br>We didn't find a reference of M. Smegmatis FprA being cloned into E. coli so we used the following sequenced data:</p>
| |
| - | <p style="font-family: courier">
| |
| - | <br>atgcgcccgt accacgtagc gatcgtcggc tcaggaccct ccggattctt
| |
| - | <br>tgctgccgca tcgctgctga agtttgccga ctctcaaccc gaccgcgatg
| |
| - | <br>tccgcgtgga catgctcgag atgctgccga ccccgtgggg tctggtgcgc
| |
| - | <br>tccggcgtcg ctcccgacca tccgaagatc aagtcgatca gcgcccagtt
| |
| - | <br>cgagaagacc gcggccgacc cccgcttccg gttcttcggc aacgtccggg
| |
| - | <br>tcggtgagca cgtccaaccg ggcgaactcg ccgaacgcta cgacgccgtc
| |
| - | <br>gtctacgcca ccggcgcaca gtccgaccgc gcgctgaaca tccccggcga
| |
| - | <br>ggagctgccg ggcagcgtcg cggccgtcga cttcgtgggt tggtacaacg
| |
| - | <br>cgcatccgca tttccgcgag atggcgcccg atctctccgg cgggcgcgcc
| |
| - | <br>gtggtggtcg gcaacggcaa cgtcgcactc gatgtcgcac gcatcctggt
| |
| - | <br>cagcgatccg aaggcgttgg ccaacaccga cattgccgac catgcgctgg
| |
| - | <br>acaagctgga cacgcgcggt gtggacgagg tcgtggtgct cggccggcgt
| |
| - | <br>ggtccgctgc aggcgacgtt caccacgctg gagttgcgtg aactcggcga
| |
| - | <br>catggagggc ctcggcgacg tcgacgtgat cctggatccg gccgatttcg
| |
| - | <br>ccgacatcac cgacgaggat ctcgaagccg cgggcaagac cgtcaagcag
| |
| - | <br>aacatcaagg tgctgcgcgg ttacgccgag cgggaaccgc gaggcgccaa
| |
| - | <br>gcggcgcatc gtgttccggt tcttcacctc accgatcgag ctgcgcggcg
| |
| - | <br>aggaccgcgt ggaatcgatc gtgttgggac gcaacgaact cgtgcgcggc
| |
| - | <br>gccgacggca ggatggtggc caaggacacc ggtgagcgcg aagaactgcc
| |
| - | <br>ggcacagctg gtggtgcgtg cggtcggata ccgcggcgtg ccgactccag
| |
| - | <br>gcctgccgtt cgacgagcgt tcgggcacca tcccgcacac cgacggccgc
| |
| - | <br>gtcgagggca gcgccaacga gtacgtggtg ggctggatca agcgcggacc
| |
| - | <br>gtccggcgtc atcggcagca acaagaagga ctcacaggac accgtcaaca
| |
| - | <br>ccctgctcga cgacctcgcc gcggcccggc tgccccagcg cgggcccgac
| |
| - | <br>cactccgaga agctcgcggc gtggttgctg gaacgtcagc ccaaggtggt
| |
| - | <br>cacgggcgag cactggaagc tgatcgacga ctacgagcgc gccgcgggcg
| |
| - | <br>aaccgaccgg ccgaccccgg gtgaagctgg cgagcgtggc tgaactgctg
| |
| - | <br>cgcgtgggcc acggctga</p>
| |
| - | <p>As above, the sequence was imported into geneious, the biobrick restriction sites were manually removed from the sequence and restriction sites were added to the 5’ and 3’ ends in the same fashion as TB sirA. Again, the restriction sites added for cloning into the vector pCOLAduet-1 were NdeI and AvrII. As a result, there was no need to add an additional glycine after the start codon. The resulting sequence is as follows:</p>
| |
| - | <p style="font-family: courier">
| |
| - | <br>tatgaattct agatcatatg cgcccgtacc acgtagcgat cgtcggctca
| |
| - | <br>ggaccctccg gattctttgc tgccgcatcg ctgctgaagt ttgccgactc
| |
| - | <br>tcaacccgac cgcgatgtcc gcgtggacat gctcgagatg ctgccgaccc
| |
| - | <br>cgtggggtct ggtgcgctcc ggcgtcgctc ccgaccatcc gaagatcaag
| |
| - | <br>tcgatcagcg cccagttcga gaagaccgcg gccgaccccc gcttccggtt
| |
| - | <br>cttcggcaac gtccgggtcg gtgagcacgt ccaaccgggc gaactcgccg
| |
| - | <br>aacgctacga cgccgtcgtc tacgccaccg gcgcacagtc cgaccgcgcg
| |
| - | <br>ctgaacatcc ccggcgagga gctgccgggc agcgtcgcgg ccgtcgactt
| |
| - | <br>cgtgggttgg tacaacgcgc atccgcattt ccgcgagatg gcgcccgatc
| |
| - | <br>tctccggcgg gcgcgccgtg gtggtcggca acggcaacgt cgcactcgat
| |
| - | <br>gtcgcacgca tcctggtcag cgatccgaag gcgttggcca acaccgacat
| |
| - | <br>tgccgaccat gcgctggaca agctggacac gcgcggtgtg gacgaggtcg
| |
| - | <br>tggtgctcgg ccggcgtggt ccgcttcagg cgacgttcac cacgctggag
| |
| - | <br>ttgcgtgaac tcggcgacat ggagggcctc ggcgacgtcg acgtgatcct
| |
| - | <br>ggatccggcc gatttcgccg acatcaccga cgaggatctc gaagccgcgg
| |
| - | <br>gcaagaccgt caagcagaac atcaaggtgc tgcgcggtta cgccgagcgg
| |
| - | <br>gaaccgcgag gcgccaagcg gcgcatcgtg ttccggttct tcacctcacc
| |
| - | <br>gatcgagctg cgcggcgagg accgcgtgga atcgatcgtg ttgggacgca
| |
| - | <br>acgaactcgt gcgcggcgcc gacggcagga tggtggccaa ggacaccggt
| |
| - | <br>gagcgcgaag aactgccggc acagctggtg gtgcgtgcgg tcggataccg
| |
| - | <br>cggcgtgccg actccaggcc tgccgttcga cgagcgttcg ggcaccatcc
| |
| - | <br>cgcacaccga cggccgcgtc gagggcagcg ccaacgagta cgtggtgggc
| |
| - | <br>tggatcaagc gcggaccgtc cggcgtcatc ggcagcaaca agaaggactc
| |
| - | <br>acaggacacc gtcaacaccc tgctcgacga cctcgccgcg gcccggctgc
| |
| - | <br>cccagcgcgg gcccgaccac tccgagaagc tcgcggcgtg gttgctggaa
| |
| - | <br>cgtcagccca aggtggtcac gggcgagcac tggaagctga tcgacgacta
| |
| - | <br>cgagcgcgcc gcgggcgaac cgaccggccg accccgggtg aagctggcga
| |
| - | <br>gcgtggctga actgctgcgc gtgggccacg gctgacctag gactagtctg
| |
| - | <br>cagttacg
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_12th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 12<sup>th</sup> June</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Design of FdxC and FdxA genes for synthesis
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>FdxC</b>
| |
| - | <p><em>Mycobacterium tuberculosis</em>
| |
| - | <br>Reference: Cole, S.T. et al. 1998. Deciphering the biology of Mycobacterium tuber-
| |
| - | culosis from the complete genome sequence. doi:10.1038/31159.
| |
| - |
| |
| - | <br>We couldn’t find a reference of FdxC being cloned into E. coli and so we took the sequence data from genbank which is as follows:</p>
| |
| - | <p style="font-family: courier">
| |
| - | gtgacgtaca cgatcgccga accctgtgtc gacatcaagg acaaggcatg
| |
| - | <br>cattgaggag tgcccggtcg attgcatcta cgagggcgcc cggatgctgt
| |
| - | <br>atatccaccc cgacgaatgc gtcgactgtg gggcttgcga gccggtctgc
| |
| - | <br>cccgttgaag ctatcttcta cgaagacgat gtgcccgaac agtggagcca
| |
| - | <br>ttacacccag atcaacgccg atttcttcgc cgagctggga tcgccgggcg
| |
| - | <br>gtgcggccaa ggttggcatg accgagaacg acccgcaagc ggtcaaggat
| |
| - | <br>ctggcgccgc agagcgagga cgcctga</p>
| |
| - | <p>The Gtg was replaced with the NcoI cut site and a glycine codon (ccatgggc) and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:</p>
| |
| - | <p style="font-family: courier">
| |
| - | cttagaattc tagaccatgg gcacgtacac gatcgccgaa ccctgtgtcg
| |
| - | <br>acatcaagga caaggcatgc attgaggagt gcccggtcga ttgcatctac
| |
| - | <br>gagggcgccc ggatgctgta tatccacccc gacgaatgcg tcgactgtgg
| |
| - | <br>ggcttgcgag ccggtctgcc ccgttgaagc tatcttctac gaagacgatg
| |
| - | <br>tgcccgaaca gtggagccat tacacccaga tcaacgccga tttcttcgcc
| |
| - | <br>gagctgggat cgccgggcgg tgcggccaag gttggcatga ccgagaacga
| |
| - | <br>cccgcaagcg gtcaaggatc tggcgccgca gagcgaggac gcctgaagct
| |
| - | <br>tgactagtct gcagaaatg</p>
| |
| - | <b>FdxA</b>
| |
| - | <p><em>Mycobacterium smegmatis</em>
| |
| - | <br>Reference: Ricagno S. et al. 2008. The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis. http://dx.doi.org/10.1016/j.bbrc.2007.06.013
| |
| - | http://www.metacyc.org/MSME246196/NEW-IMAGE?type=GENE-IN-MAP&object=GJ4Y-1124
| |
| - | <br>Sequence:</p>
| |
| - | <p style="font-family: courier">
| |
| - | atgacatacg tgatcggccg gccgtgcgtg gacgtcaaag accgcgcatg
| |
| - | <br>cgtggatgag tgcccggtcg actgcatcta cgagggcgcg cggatgctct
| |
| - | <br>acatccaccc cgacgaatgt gtcgactgtg gcgcgtgtga acccgtgtgc
| |
| - | <br>ccggtggagg cgatctacta cgaggacgac ctgcccgagg atctgcagcc
| |
| - | <br>gtaccaggag gagaacgcga agttcttcac cgatgtcctg cccgggcgtg
| |
| - | <br>cccaaccgct cggatcaccg ggcggtgccg cgaaactcgg tgtcgtggac
| |
| - | <br>gccgatacgc ccatggttgc ggagctaccg ccgcaggggg attga</p>
| |
| - | <p>The NcoI cut site and a glycine codon (ccatgggc) replaced the atg in green and a HindIII site was added to the end of the sequence. The biobrick restriction sites were then added to the ends of the sequence resulting in the following sequence:</p>
| |
| - | <p style="font-family: courier">
| |
| - | cttagaattc tagaccatgg gcacatacgt gatcggccgg ccgtgcgtgg
| |
| - | <br>acgtcaaaga ccgcgcatgc gtggatgagt gcccggtcga ctgcatctac
| |
| - | <br>gagggcgcgc ggatgctcta catccacccc gacgaatgtg tcgactgtgg
| |
| - | <br>cgcgtgtgaa cccgtgtgcc cggtggaggc gatctactac gaggacgacc
| |
| - | <br>tgcccgagga tcttcagccg taccaggagg agaacgcgaa gttcttcacc
| |
| - | <br>gatgtcctgc ccgggcgtgc ccaaccgctc ggatcaccgg gcggtgccgc
| |
| - | <br>gaaactcggt gtcgtggacg ccgatacgcc catggttgcg gagctaccgc
| |
| - | <br>cgcaggggga ttgagcctag gtactagtct gcagtggg</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Tuesday_18th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 18<sup>th</sup> June</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | In Silico Cloning
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We used geneious to perform in silico cloning on our constructed gene sequences to ensure that they were properly made. SirA and pACYCDuet-1 were both cut with NcoI and AvrII and then the large fragments were extracted and ligated together to form vector pD001. FdxA and pETDuet-1 were both cut with NcoI and HindIII and the large fragments were extracted and ligated together to form vector pD002. FprA and pD002 were both cut with NdeI and AvrII and the large fragments were extracted and ligated together to form vector pD003. Please see Geneious files on Google Drive (or send request for files) for exact sequences.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_24th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>24<sup>th</sup> June</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Codon Optimization
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | The ORF of M. Smegmatis SirA, FprA, and FdxA were codon optimized for E. coli K-12 using JCat (www.jcat.de) with options to avoid using rho-independent terminators, prokaryotic RBS, and restriction sites used in vector construction (AvrII, HindIII, NdeI, NcoI) and Biobrick restriction sites (EcoRI, PstI, SpeI, XbaI). The optimization charts are shown below:
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_1st_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 1<sup>st</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Media was made, Strains sD001-sD004 were received, inoculated, and put into stock and catalog.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>
| |
| - | 4 strains were received from Jake:
| |
| - | <ul>
| |
| - | <li>E. coli: BL21 (DE3) ko20 ΔcysI, Δfpr, ΔydbK
| |
| - | <li>E. coli: NEBTurbo zmSIR Chloramphenicol
| |
| - | <li>E. coli: NEBTurbo zmFNR Spectinomycin
| |
| - | <li>E. coli: NEBTurbo soFD, zmSIR Chloramphenicol
| |
| - | </ul>
| |
| - | <h5>Media and Glycerol stock were prepared</h5>
| |
| - | </p>
| |
| - | <p> <h6>Media Preparation</h6>
| |
| - | 3 500ml bottles of LB broth and LB agar were prepared by standard methods. <br> 12.5g/500ml powder/water for broth and 20g/500ml powder/water for agar. <br>Bottles were autoclaved. Additionally 1 flask of 500ml of LB broth was made in the same fashion.
| |
| - | </p>
| |
| - | <p>
| |
| - | <h6>Glycerol Stocks</h6>
| |
| - | Single colonies from agar plates were picked and used to innoculate 5ml LB broth overnight.<br> 750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube. <br> Two sets of Glycerol stocks were used for each of sD001, sD002, sD003, sD004; one set was frozen at -20ºC and the other set was frozen at -80ºC.
| |
| - | </p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_2nd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday<sup>2nd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | MiniPrep: Plasmids pD004, pD005 and pD006 were extracted from NEBturbo vectors
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Plasmid Extraction<br>
| |
| - | Plasmids pD004 (pCDF.ew12 zmFNR Spectinomycin), pD005 (pACYC.ew13 soFD, zmSIR Chloramphenicol), pD006 (pACYC.ew17 zmSIR Chloramphenicol) were extracted from NEBTurbo cells using a Thermo Scientific GeneJet Plasmid mini prep kit as described in protocol (). Lacking Resuspention solution we used some from a different mini prep upstairs. Plasmids were eluted in 100ul of nanopure water and frozen at -20ºC.
| |
| - |
| |
| - | More notes here tra la lalal
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_3rd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 3<sup>rd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Chemically Competent Cells : BL21 (DE3) dCysI dFpr dydbk, NEBturbo stocks
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>
| |
| - | Chemically Competent BL21 (DE3) Cells were made<br>
| |
| - | We grew 5ml of sD001 cells overnight from a single colony. This 5ml was used to innoculate 500ml of LB broth. <br> Broth was incubated for 1.5h and optical density was read at 0.62 OD600. <br>Cells were alloquoted into 10 falcon tubes (50ml each) and centrifuged at 4000xg for 20 minutes at 4C. <br> Supernatant was removed and cells were resuspended in 200ml of Buffer 1 (4x 50ml) and left on ice for 20 minutes. <br> Cells were centrifuged again for 20 minutes at 4000xg. <br> Supernatant was removed and cells were resuspended in 12ml Buffer 2. <br> Cells were alloquoted at 500ul into microcentifuge tubes and frozen at -80C.
| |
| - |
| |
| - | <br>Buffer 1: 50mM CaCl2
| |
| - | <br>Buffer 2: <ul><li>0.53ml 2M CaCl2<br>
| |
| - | <li>2.8ml 60% Glycerol<br>
| |
| - | <li>8.67ml sterile H2O
| |
| - | </ul>
| |
| - | <br>This is the correct Chemical Competent Cells protocol (Similar to Protocol 2) , that we should have used instead of the one above:
| |
| - |
| |
| - | <ol>
| |
| - | <li> Take a single colony of E. coli cells and inoculate 5ml of LB broth. <br> Incubate over night at 37C and 200rpm and innoculate about 500ml to 1L sterile LB broth. <br> DO NOT ADD antibiotics since these cells do not have a plasmid in them. <br> Work as sterile as possible.
| |
| - |
| |
| - | <li> Inoculate about 300-400ml sterile LB broth with 500ul of preculture.
| |
| - |
| |
| - | <li> Grow the cells on a shaker at 37C until they reach an OD @ 600nm of 0.3 to 0.4 (1cm pathlength of the cuvette).
| |
| - |
| |
| - | <li> Centrifuge at 3000xg for 10 minutes at 4C. Ice down 100mM CaCl2 and 100mM MgCl2 solutions at this point.
| |
| - |
| |
| - | <li> Gently resuspend the bacteria pellet on ice in 50ml of ice cold 100mM MgCl2, taking 3-5 minutes for this procedure. <br> Centrifuge the cell suspension at 3000xg for 10 minutes at 4C.
| |
| - |
| |
| - | <li> Resuspend the bacteria pellet on ice 50ml of ice cold 100mM CaCl2, incubate the cells for 10 minutes on ice.
| |
| - |
| |
| - | <li> Centrifuge the cell suspension at 3000xg for 10 minutes at 4C and resuspend the cell pellet in 4ml of ice cold, sterile 100mM CaCl2 in 15%(w/v) glycerol. <br>Dispense in 50uL aliquots and freeze cells at -80C.
| |
| - | </ol>
| |
| - |
| |
| - | <br>Chemically competent cells (NEB Turbo)
| |
| - | <br>Prepared via iGEM chemically competent protocol with following changes. <br> 500ul of preculture used to inoculate 500ml LB broth. Grown at 37C for 3h hours to an OD600 of 0.536. <br>Cells centrifuged at 3200 rpm on old centrifuge for 10m at 4C. Pellets resuspended in 80ml of CCMB80 buffer. <br> Incubated on ice for 20m. Centrifuged for 10m at 3200 rpm for 10m at 4C. <br>Pellets resuspended in 5ml of CCMB80 buffer. Aliquoted into Microcentrifuge tubes and frozen at -80C.
| |
| - |
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Thursday_4th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 4<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Heat Shock Transformation
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Preparation of Agar Plates</b><br>
| |
| - |
| |
| - | LB Agar was melted; 100ml was used to make 8 ampicillin plates, <br>100ml was used to make 8 spectinomycin plates and the remaining was used to make 20 chloramphenicol plates. <br>Antibiotic concentrations are: Ampicillin 50ug/ml, Spectinomycin 50ug/ml, Chloramphenicol 34ug/ml.
| |
| - | <br>
| |
| - | <br><b>Heat Shock Transformation</b><br>
| |
| - | sD001: BL21 (DE3) with deletions, was transformed with the following plasmids and plasmid combinations:<ul>
| |
| - | <br>
| |
| - | <li> sD001+pD004 ( FNR, Spectinomycin)
| |
| - | <li> sD001+pD005 ( SIR, Fdx, Chloramphenicol)
| |
| - | <li> sD001+pD006 (Sir, Chloramphenicol)
| |
| - | </ul>
| |
| - | Transformation was done according to protocol 1 with the following specifications:<br>
| |
| - | BL21 (DE3) chemically competent cells were thawed on Ice. 1ul of plasmid DNA was added to a tube of BL21 (DE3) cells. <br>Cells were incubated on ice for 30 minutes. Cells were transfered to heating block at 42C for 45s. <br> Cells were returned to ice for 2 minutes. 1ml of LB Broth was added to the cells and they were incubated at 37C for 1h. <br>Cells were then plated on agar with appropriate antibiotics (specified previously).
| |
| - | These transformations worked; single colonies were lifted from plates, entered to catalog and stocked in glycerol stock (protocol 3).
| |
| - | <br>Catalog names:
| |
| - | <ul>
| |
| - | <li> sD006= sD001+pD004 ( FNR, Spectinomycin)
| |
| - | <li> sD007= sD001+pD005 ( SIR, Fdx, Chloramphenicol)
| |
| - | <li> sD008= sD001+pD006 (Sir, Chloramphenicol)
| |
| - | </ul>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Friday_5th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 5<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Planning transformations for the next week
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN">
| |
| - | <HTML>
| |
| - | <HEAD>
| |
| - | <META HTTP-EQUIV="CONTENT-TYPE" CONTENT="text/html; charset=utf-8">
| |
| - | <TITLE></TITLE>
| |
| - | <META NAME="GENERATOR" CONTENT="OpenOffice.org 3.4 (Unix)">
| |
| - | <META NAME="CREATED" CONTENT="20130812;15135600">
| |
| - | <META NAME="CHANGED" CONTENT="20130812;17044700">
| |
| - | <STYLE TYPE="text/css">
| |
| - | <!--
| |
| - | @page { margin: 0.79in }
| |
| - | P { margin-bottom: 0.08in }
| |
| - | A:link { so-language: zxx }
| |
| - | -->
| |
| - | </STYLE>
| |
| - | </HEAD>
| |
| - | <BODY LANG="en-US" DIR="LTR">
| |
| - | <P STYLE="margin-bottom: 0in; line-height: 114%"><A NAME="docs-internal-guid-1ecd545a-72a7-d313-3414-d51c38553976"></A>
| |
| - | <FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">We
| |
| - | decided to partly reproduce Figure 3C from:
| |
| - | </SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><A HREF="http://www.jbioleng.org/content/5/1/7"><FONT COLOR="#005400"><SPAN STYLE="text-decoration: none"><FONT FACE="Verdana"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="font-style: normal"><U><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">http://www.jbioleng.org/content/5/1/7</SPAN></SPAN></U></SPAN></FONT></FONT></SPAN></FONT></A><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">:</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | <P STYLE="font-weight: normal"><FONT SIZE=2 STYLE="font-size: 11pt"><BR><IMG SRC="https://lh5.googleusercontent.com/EKwdYjSSLfO_91W7fgqGLKIPkkGjAMWWrfB0GcvR5o1wlQJsBaa5cqajDhreNfAi5ZS1cLaMgKrws8sn6VhEGAAgIfEajdqALZCCNgrDG9NSD0AoEV_kLXdO" NAME="graphics1" ALIGN=BOTTOM WIDTH=626 HEIGHT=462 BORDER=0></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">So,
| |
| - | we would pursue to grow the following strains on a minimal media M9
| |
| - | plate, supplemented with all amino acids</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">aside
| |
| - | from the sulfur containing ones, and sulfite ans the only sulfur
| |
| - | source:</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">We
| |
| - | already thought we have all of the strains we need, however, an
| |
| - | overnight culture was launched of a few single colonies from this
| |
| - | double plasmid strain (sD001+pD004+pD005, which supposedly had all 3
| |
| - | genes SIR FNR and Fdx) and it didn't grow. </SPAN></FONT></FONT></FONT>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-weight: normal; line-height: 114%">
| |
| - | <FONT SIZE=2 STYLE="font-size: 11pt"><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="background: #ffffff">This
| |
| - | most likely occurred because the strains didn't have </SPAN></SPAN></FONT></SPAN></FONT><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><I><SPAN STYLE="background: #ffffff">Spec
| |
| - | </SPAN></I></FONT></SPAN></FONT><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="background: #ffffff">antibiotics
| |
| - | resistance, as the other spec resistant strain containing</SPAN></SPAN></FONT></SPAN></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">the
| |
| - | FNR gene (pD004), was found not to be resistant as well. </SPAN></FONT></FONT></FONT>
| |
| - | </P>
| |
| - |
| |
| - | <P STYLE="margin-top: 0.08in; margin-bottom: 0.08in"><IMG SRC="https://static.igem.org/mediawiki/2013/thumb/9/91/Wishplate.jpg/800px-Wishplate.jpg" NAME="graphics2" ALIGN=LEFT WIDTH=626 HEIGHT=462 BORDER=0><BR CLEAR=LEFT><FONT SIZE=3><I>Illustration
| |
| - | 1: Strains will be grown on a minimal media M9 plate, supplemented
| |
| - | with all amino acids aside from the sulfur containing ones; plates
| |
| - | will have increased glucose, and sulfite as the only sulfur source.
| |
| - | Growth is expected only for WT and the strain containing all three
| |
| - | alternative genes of sulfur reduction.</I></FONT></P>
| |
| - | </SPAN><BR CLEAR=LEFT><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; line-height: 114%"><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">Therefore,
| |
| - | we would re-make: </SPAN></FONT></FONT></FONT>
| |
| - | </P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-right: 0.15in; margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><FONT COLOR="#222222"><B><SPAN STYLE="background: #ffffff">sD001+pD004+pD005</SPAN></B></FONT><FONT COLOR="#222222"><SPAN STYLE="background: #ffffff">
| |
| - | E.coli:</SPAN></FONT><FONT COLOR="#ff9900"><SPAN STYLE="background: #ffffff">ΔcysI,
| |
| - | Δfpr, ΔydbK</SPAN></FONT><SPAN STYLE="background: #ffffff">::
| |
| - | </SPAN><FONT COLOR="#0000ff"><B><SPAN STYLE="background: #ffffff">soFD</SPAN></B></FONT><SPAN STYLE="background: #ffffff">,
| |
| - | </SPAN><FONT COLOR="#ff0000"><B><SPAN STYLE="background: #ffffff">zmSIR
| |
| - | </SPAN></B></FONT><SPAN STYLE="background: #ffffff">;Chloramphenicol
| |
| - | ,</SPAN><FONT COLOR="#ff00ff"><B><SPAN STYLE="background: #ffffff">zmFNR</SPAN></B></FONT><FONT COLOR="#222222"><SPAN STYLE="background: #ffffff">;
| |
| - | Spectinomycin- </SPAN></FONT><FONT COLOR="#222222"><U><SPAN STYLE="background: #ffffff">with
| |
| - | all three genes.</SPAN></U></FONT></FONT></FONT></FONT></P>
| |
| - | <LI><P STYLE="margin-right: 0.15in; margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><FONT COLOR="#222222"><U><B><SPAN STYLE="background: #ffffff">sD001+pD004:
| |
| - | </SPAN></B></U></FONT><FONT COLOR="#222222"><SPAN STYLE="background: #ffffff">E.coli:</SPAN></FONT><FONT COLOR="#ff9900"><SPAN STYLE="background: #ffffff">ΔcysI,
| |
| - | Δfpr, ΔydbK</SPAN></FONT><SPAN STYLE="background: #ffffff">::
| |
| - | </SPAN><FONT COLOR="#ff00ff"><B><SPAN STYLE="background: #ffffff">zmFNR</SPAN></B></FONT><FONT COLOR="#222222"><SPAN STYLE="background: #ffffff">;
| |
| - | Spectinomycin</SPAN></FONT></FONT></FONT></FONT></P>
| |
| - | </UL>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-right: 0.15in; margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#222222"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">and
| |
| - | make</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-right: 0.15in; margin-bottom: 0in; line-height: 114%">
| |
| - | <BR>
| |
| - | </P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-right: 0.15in; margin-bottom: 0in; background: transparent; line-height: 114%">
| |
| - | <FONT SIZE=2 STYLE="font-size: 11pt"><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><B><SPAN STYLE="background: #ffffff">sD001+pD004+pD006</SPAN></B></SPAN></FONT></SPAN></FONT><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><SPAN STYLE="background: #ffffff">
| |
| - | </SPAN></SPAN></FONT><FONT COLOR="#222222"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">E.coli:</SPAN></SPAN></SPAN></FONT></SPAN></FONT><FONT COLOR="#ff9900"><SPAN STYLE="text-decoration: none"><SPAN STYLE="background: #ffffff">
| |
| - | </SPAN></SPAN></FONT><FONT COLOR="#ff9900"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">ΔcysI,
| |
| - | Δfpr, ΔydbK</SPAN></SPAN></SPAN></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">::</SPAN></SPAN></SPAN></FONT></SPAN></FONT><FONT COLOR="#ff00ff"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><B><SPAN STYLE="background: #ffffff">zmFNR</SPAN></B></SPAN></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">;
| |
| - | Spectinomycin, </SPAN></SPAN></SPAN></FONT></SPAN></FONT><FONT COLOR="#ff0000"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><B><SPAN STYLE="background: #ffffff">zmSIR</SPAN></B></SPAN></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">;
| |
| - | Chloramphenicol</SPAN></SPAN></SPAN></FONT></SPAN></FONT></FONT></P>
| |
| - | </UL>
| |
| - | <P STYLE="margin-right: 0.15in; margin-bottom: 0in; background: transparent; line-height: 114%">
| |
| - | <BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-right: 0.15in; margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">These
| |
| - | transformations will be done by using two strains of competent cells
| |
| - | prepared using Protocol 2 :</SPAN></FONT></FONT></FONT></P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">sD001
| |
| - | competent cells were transformed with:</SPAN></FONT></FONT></FONT></P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">pD004</SPAN></FONT></FONT></FONT></P>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">Double
| |
| - | transformation: pD005 +pD004</SPAN></FONT></FONT></FONT></P>
| |
| - | </UL>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">sD007
| |
| - | (sD001+pD005) competent cells were transformed with:</SPAN></FONT></FONT></FONT></P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">pD004</SPAN></FONT></FONT></FONT></P>
| |
| - | </UL>
| |
| - | </UL>
| |
| - | <P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; line-height: 114%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="background: #ffffff">These
| |
| - | transformations will be done by heat shock using protocol 1.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="font-weight: normal"><FONT SIZE=2 STYLE="font-size: 11pt"><BR></FONT><BR><BR>
| |
| - | </P>
| |
| - | </BODY>
| |
| - | </div>
| |
| - | </HTML>
| |
| - | <!-- === To here === -->
| |
| - |
| |
| - | <html><div id="target_Tuesday_16th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transformation efficiency measurements
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transformation of Puc18 to sD001 (BL21 ED3) competent cells.
| |
| - | We have made a transformation of pUC18 into our sD001 BL21(DE3) strain of competent cells. <br>Transformation was done by heat shock protocol 1 with the following specifications:<br>
| |
| - | 200 ul Chemically Competent Cells were thawed on Ice. 0.5 ul DNA was added and incubate on ice for 30 minutes.<br> HEAT SHOCK cells were Incubated at 42C for 45 seconds then incubated on ice for 2 minutes. 200 ul of LB broth was added and cells were incubated at 37C for 1 hour.<br> 10 ul of cells were plated on agar supplemented with Ampicillin. During the night 18 colonies grew.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_17th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 17<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Making sD001+pD004 (Spect), sD001+pD005 (Chl31) competent, by using protocol 2 with these specifications:<br>
| |
| - | The night before, cells were inoculated in a 5 ml culture and grown overnight with selection.<br>
| |
| - | 0.05 ml of the cell culture was diluted ~ 1:200 into 10 ml of selective media (Chl31,Spect) and grew to an OD600 of 0.6 – 0.7 <br>(sD001+pD004 didn’t grow and protocol was continued for sD001+pD005 - see comment). Cells were Spun down at 4 ºC, 4000 rpm, 15 minutes.<br> Then were resuspended in 15 ml, ice-cold 100 mM CaCl2 and left for 3 hours. <br> Next, cells were spun down at 4 ºC, 4000 rpm, for 15 minutes, Resuspended in 4 ml, ice-cold 100 mM CaCl2 + 15% glycerol <br> and aliquoted into pre-chilled Eppendorf tubes. Tubes were immediately stored at -80ºC.
| |
| - | <br>10 ml CaCl2 100nM + glycerol 15% was made from:<ul>
| |
| - | <li>3.33 ml Glycerol 60% solution.
| |
| - | <li>6.17 ml Sterile water
| |
| - | <li>0.5 ml CaCl2 2 M solution.
| |
| - | </ul>
| |
| - | <br><b>Comment:</b> sD001+pD004 did not grow overnight (and possibly always) in Streptavidin<br> instead of Spectinomycin so they most likely lost their resistance and we will make them again tomorrow by tranforming the BL21(DE3) cells with pD004.
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Thursday_18th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 18<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Heat shock Transformation
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b> Transformations made: </b> <br>
| |
| - | <ul>
| |
| - | <li>sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
| |
| - | <li>sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
| |
| - | <li>sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol
| |
| - | </ul>
| |
| - | Transformations were made with protocol 1 with the following specifications:
| |
| - | <br> BL21 (DE3) chemically competent cells were thawed on Ice. <br> 2ul of plasmid DNA was added to 20ul of BL21 (DE3) cells. Cells were incubated on ice for 30 minutes. <br>Cells were transfered to heating block at 42C for 45s. Cells were returned to ice for 2 minutes. <br> 200ul of LB Broth was added to the cells and they were incubated at 37C for 1h. <br> After incubations cells of each transformation were plated on two plates: one with 5 ul , and the other with 100 ul of the post recovery cells culture. <br>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Friday_19th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 19<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | TRANSFORMATIONS WORKED!!! cells were stocked and entered in catalog.
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <ul>
| |
| - | <li><font color="#EE0F29">sD012/sD013</font>=sD001+pD004+pD005 E.coli:ΔcysI, Δfpr, ΔydbK:: soFD, zmSIR ;Chloramphenicol ,zmFNR; Spectinomycin- with all three genes
| |
| - | <li><FONT COLOR="#EE0F29">sD016/sD017</FONT>=sD001+pD004 E.coli:ΔcysI, Δfpr, ΔydbK:: ,zmFNR; Spectinomycin
| |
| - | <li><FONT COLOR="#EE0F29">sD014/sD015</FONT>=sD001+pD004+pD006 E.coli: ΔcysI, Δfpr, ΔydbK::zmFNR; Spectinomycin, zmSIR; Chloramphenicol
| |
| - | </ul>
| |
| - | <br><b>Glycerol Stocks were made of the above mentioned strains</b>
| |
| - |
| |
| - | <br> 2 Single colonies from each agar plate of above mentioned strains were picked and used to inoculate 5ml LB broth overnight. <br> 750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.<br> Two sets of Glycerol stocks were used for each of sD001+pD004, sD001+sD004+sD005, sD001+sD004+sD006; <br>one set was frozen at -20ºC and the other set was frozen at -80ºC.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Wednesday_24th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 24<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN">
| |
| - | <HTML>
| |
| - | <HEAD>
| |
| - | <META HTTP-EQUIV="CONTENT-TYPE" CONTENT="text/html; charset=utf-8">
| |
| - | <TITLE></TITLE>
| |
| - | <META NAME="GENERATOR" CONTENT="OpenOffice.org 3.4 (Unix)">
| |
| - | <META NAME="CREATED" CONTENT="20130813;14564400">
| |
| - | <META NAME="CHANGED" CONTENT="20130813;14581400">
| |
| - | <STYLE TYPE="text/css">
| |
| - | <!--
| |
| - | @page { margin: 0.79in }
| |
| - | TD P { margin-bottom: 0in }
| |
| - | P { margin-bottom: 0.08in }
| |
| - | -->
| |
| - | </STYLE>
| |
| - | </HEAD>
| |
| - | <BODY LANG="en-US" DIR="LTR">
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none"><A NAME="docs-internal-guid-6a562b8e-77bf-e282-d38b-5ab6a27ab8a3"></A>
| |
| - | <FONT COLOR="#000000"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><B><SPAN STYLE="background: transparent">24/7/13</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-weight: normal; line-height: 100%">
| |
| - | <FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Arial"><FONT SIZE=2 STYLE="font-size: 11pt"><SPAN STYLE="font-style: normal"><SPAN STYLE="background: transparent">Made
| |
| - | 500 ml of </SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="background: transparent">M9
| |
| - | Minimal Plates with Sulfur Dropout Powder accouding to the following
| |
| - | recipe: </SPAN></SPAN></FONT></FONT></SPAN></FONT>
| |
| - | </P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Recipe:
| |
| - | M9 Minimal Plates with Sulfur Dropout Powder</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">These
| |
| - | stock solutions can be pre-sterilized and stored indefinitely:</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">5x
| |
| - | M9 Salts (from scratch)</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=89>
| |
| - | <COL WIDTH=110>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Reagent</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Quantity</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in">
| |
| - | <FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">Na</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">2</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">HPO</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">4</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">17
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in">
| |
| - | <FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">KH</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">2</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">PO</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">4</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">7.5
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">NaCl</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">1.25
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in">
| |
| - | <FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">(NH</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">4</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">)</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">2</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">SO</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: #ffffff">4</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">3.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P STYLE="margin-bottom: 0in; line-height: 100%"><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Bring
| |
| - | to a total volume of 500 ml.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Adjust
| |
| - | pH to 7.4 with NaOH.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Sterilize
| |
| - | by autoclaving or filtration</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">or</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">5x
| |
| - | M9 Salts (from Difco Powder)</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=97>
| |
| - | <COL WIDTH=94>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Reagent</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Quantity</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">M9
| |
| - | Salts</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">28.2
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Bring
| |
| - | to a total volume of 500 mL.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Sterilize
| |
| - | by autoclaving or filtration</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">2x
| |
| - | Yeast Plate Agar</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=84>
| |
| - | <COL WIDTH=89>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Reagent</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Quantity</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">Agar</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">30
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Bring
| |
| - | to a total volume of 500 ml.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Sterilize
| |
| - | by autoclaving</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">5x
| |
| - | Amino Acid Dropout Powder</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=193>
| |
| - | <COL WIDTH=98>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Reagent</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Quantity</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">Sulfur
| |
| - | dropout powder</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">0.5
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Bring
| |
| - | to a total volume of 200 ml.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Sterilize
| |
| - | by autoclaving</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Sulfur
| |
| - | dropout powder is a rich supplement mix with cysteine and methionine
| |
| - | omitted:</SPAN></FONT></FONT></FONT></P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=111>
| |
| - | <COL WIDTH=62>
| |
| - | <COL WIDTH=107>
| |
| - | <COL WIDTH=90>
| |
| - | <COL WIDTH=152>
| |
| - | <COL WIDTH=69>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Amino
| |
| - | acids</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Nucleotide
| |
| - | bases</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Alanine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Leucine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">10.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Adenine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">0.5
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Arginine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Lysine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Uracil</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Asparagine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Methionine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">0.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Aspartic
| |
| - | acid</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Phenylalanine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Vitamins</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Cysteine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">0.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Proline</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">p-Aminobenzoic
| |
| - | acid</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">0.2
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Glutamic
| |
| - | acid</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Serine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Inositol</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Histidine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Tyrosine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Isoleucine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Valine</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.08in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2.0
| |
| - | g</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | <TD BGCOLOR="#ffffff">
| |
| - | <P><BR>
| |
| - | </P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P STYLE="font-weight: normal"><BR><BR><BR><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Recipe:
| |
| - | M9 Minimal Plates with Sulfur Dropout Powder</SPAN></B></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">The
| |
| - | plates can be made fresh from pre-sterilized stock solutions.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | <TABLE CELLPADDING=2 CELLSPACING=2>
| |
| - | <COL WIDTH=236>
| |
| - | <COL WIDTH=79>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Reagent</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P ALIGN=CENTER STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><B><SPAN STYLE="background: transparent">Quantity</SPAN></B></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">5x
| |
| - | M9 Salts</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">200
| |
| - | mi</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">5x
| |
| - | Amino Acid Dropout Powder</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: #ffffff">200
| |
| - | mi</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in"><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: transparent">1
| |
| - | M MgSO</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: transparent">4</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">2
| |
| - | ml</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">20%
| |
| - | Glucose</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">20
| |
| - | ml</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | <TR>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in"><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: transparent">1M
| |
| - | CaCl</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT><FONT COLOR="#000000"><SPAN STYLE="text-decoration: none"><FONT FACE="Helvetica Neue"><FONT SIZE=1><SPAN STYLE="font-style: normal"><SPAN STYLE="font-weight: normal"><SPAN STYLE="background: transparent">2</SPAN></SPAN></SPAN></FONT></FONT></SPAN></FONT></P>
| |
| - | </TD>
| |
| - | <TD>
| |
| - | <P STYLE="border: 1px solid #000000; padding: 0.02in 0.07in; font-style: normal; font-weight: normal; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">0.1
| |
| - | ml</SPAN></FONT></FONT></FONT></P>
| |
| - | </TD>
| |
| - | </TR>
| |
| - | </TABLE>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 100%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Bring
| |
| - | to a total volume of 500 mL</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Stir
| |
| - | and warm on a hot plate to about 60 C (hot to the touch)</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Melt
| |
| - | 500 ml 2x Yeast Plate Agar in the microwave for ~8 minutes on high</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Cool
| |
| - | to about 60 C (hot to the touch)</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">This
| |
| - | takes about 30 minutes on the bench or 5 minutes in a water bath.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">Add
| |
| - | the 2x Yeast Plate agar to the other reagents to make 1 L of media.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Helvetica Neue"><FONT SIZE=3><SPAN STYLE="background: transparent">This
| |
| - | recipe will prepare 20 plates at 25 ml / plate.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P><BR><BR>
| |
| - | </P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">made
| |
| - | 7 plates without antibiotics and 20 with Chloramphenicol and
| |
| - | Spectinomycin - by mistake.</SPAN></FONT></FONT></FONT></P>
| |
| - | <P STYLE="margin-bottom: 0in; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">Used
| |
| - | one plate without AB to plate the following strains:</SPAN></FONT></FONT></FONT></P>
| |
| - | <UL>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">sD007=sD001+pD005</SPAN></FONT></FONT></FONT></P>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">sD008=sD001+pD006</SPAN></FONT></FONT></FONT></P>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">sD013=
| |
| - | sD001+pD005+ pD004</SPAN></FONT></FONT></FONT></P>
| |
| - | <LI><P STYLE="margin-bottom: 0in; background: transparent; font-style: normal; font-weight: normal; line-height: 115%; text-decoration: none">
| |
| - | <FONT COLOR="#000000"><FONT FACE="Cambria"><FONT SIZE=3><SPAN STYLE="background: transparent">sD015=
| |
| - | sD001+pD006+ pD004</SPAN></FONT></FONT></FONT></P>
| |
| - | </UL>
| |
| - | <P STYLE="margin-bottom: 0in"><BR>
| |
| - | </P>
| |
| - | </BODY>
| |
| - | </div>
| |
| - | </HTML>
| |
| - | <!-- === To here === -->
| |
| - |
| |
| - | <html><div id="target_Monday_5th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 5<sup>th</sup>August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Confirmation of strains SD002 - SD018
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <div dir="ltr">
| |
| - | Strains sd002-sd018 were grown overnight in 5ml LB.
| |
| - | </div>
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Tuesday_6th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 5<sup>th</sup>August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Confirmation of strains SD002 - SD018 using colony PCR
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <div dir="ltr">
| |
| - | Fresh single colonies of strains SD002-SD018 were prepared for PCR using the colony pcr protocol. The primers used for were FD_F, FD_R, FNR_F, FNR_R and SirA_F and SirA_R for each strain.
| |
| - | </div>
| |
| - | <div dir="ltr">
| |
| - | Strains SD002-SD018 were confirmed.</br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f3/SirA_PCR_confirmation_.png" width="300" height="300">
| |
| - | </div>
| |
| - | </br>
| |
| - | <div dir="ltr">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/b/b9/FNR_PCR_confirmation.png" width="300" height="300">
| |
| - | </div>
| |
| - | <div dir="ltr">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/8/82/Colony_PCR_FD.png" width="300" height="300">
| |
| - | </div>
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_19th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Day Number<sup>suffix</sup> Month</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Received FrpA and FdxA from IDT.<br>
| |
| - | Started cloning strategy:<br>
| |
| - | Ligated FdxA G block into pJET plasmid for stock purposes, using the following protocol:<br>
| |
| - | <p>
| |
| - | 1. Set up the blunting reaction on ice:
| |
| - | </p>
| |
| - | <table border="1" cellspacing="0" cellpadding="0">
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Component
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Volume
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 2X Reaction Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 10 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Non-purified PCR product
| |
| - | </p>
| |
| - | <p>
| |
| - | or
| |
| - | </p>
| |
| - | <p>
| |
| - | purified PCR product/other sticky-end DNA fragment
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 1 µl
| |
| - | </p>
| |
| - | <p>
| |
| - | 0.15 pmol ends
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Water, nuclease-free
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | to 17 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | DNA Blunting Enzyme
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 1 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Total volume
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 18 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p>
| |
| - | <br/>
| |
| - | Vortex briefly and centrifuge for 3-5 s.
| |
| - | </p>
| |
| - | <p>
| |
| - | 2. Incubate the mixture at 70°C for 5 min. Chill on ice.
| |
| - | </p>
| |
| - | <p>
| |
| - | 3. Set up the ligation reaction on ice. Add the following to the blunting reaction mixture:
| |
| - | </p>
| |
| - | <table border="1" cellspacing="0" cellpadding="0">
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Component
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Volume
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | pJET1.2/blunt Cloning Vector (50 ng/µl)
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 1 µl (0.05 pmol ends)
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | T4 DNA Ligase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 1 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | Total volume
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="308" valign="top">
| |
| - | <p>
| |
| - | 20 µl
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p>
| |
| - | <br/>
| |
| - | Vortex briefly and centrifuge for 3-5 s to collect drops.
| |
| - | </p>
| |
| - | <p>
| |
| - | 4. Incubate the ligation mixture at room temperature (22°C) for 5 min.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_20th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 20<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Cloning of FdxA and FprA
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Digestion of FprA with NdeI and AvrII
| |
| - | <br>Gel Clean up of FprA fragment
| |
| - | <br>Digestion of pETDuet-1 with NdeI and AvrII
| |
| - | <br>Digestion of FdxA with NcoI and HindIII
| |
| - | <br>Digestion of pETDuet-1 NcoI and HindIII
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_21st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 21<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligation and Transformations
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligation of FprA NdeI AvrII with pET NdeI AvrII
| |
| - | <br>Ligation of FdxA NcoI HindIII with pET NcoI HindIII
| |
| - | <br>Transformation of pET FprA into NEBTurbo
| |
| - | <br>Transformation of pET FdxA into NEBTurbo
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Thursday_22nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 22<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Nano drop
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Plasmid mini-prep of transformations
| |
| - | <br>Nano dropped
| |
| - | <ol><li>pETDuet: 59.1ng/ul</li>
| |
| - | <li>pETDuet: 45.9ng/ul</li>
| |
| - | <li>pJET Fdx: 54.2ng/ul</li>
| |
| - | <li>pLS FRP: 19.7ng/ul</li></ol>
| |
| - | <br>Digest pLS FrpA with NdeI and AvrII
| |
| - | <br>Digest pETDuet with NdeI and AvrII
| |
| - | <br>Digest FdxA gBlock with NcoI and HindIII
| |
| - | <br>Digest pETDuet with NcoI and HindIII
| |
| - | <br>Ligation of FprA with pETDuet
| |
| - | <br>Ligation of FdxA with pETDuet
| |
| - | <br>Transformation of pET FprA and pET FdxA into NEBTurbo
| |
| - | <br>PCR of
| |
| - | <ul><li>FdxA gBlock with FdxA F/R</li>
| |
| - | <li>pLS FprA with FprA F/R</li>
| |
| - | <li>pET duet with MCSI F/R</li>
| |
| - | <li>pACYC duet with MCSI F/R</li></ul>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Friday_23rd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 23<sup>rd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Patching
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Patched colonies of pET FprA and colonies of pJET FdxA
| |
| - | <br>Transformations of pET Fdx didn't work
| |
| - | <br>Checking strains containing plasmids fpr to make sure genes are there.
| |
| - | <br>Results from Thursdays PCR:
| |
| - | <ul><li>no band for fdxA</li>
| |
| - | <li>band for fprA</li>
| |
| - | <li>band for pET</li>
| |
| - | <li>no band for pACYC</li>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Saturday_24th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 24<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Weekend warriors!
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Nanodrop <ul>
| |
| - | <li>FdxA 1 3.1ng/ul</li>
| |
| - | <li>FdxA 2 4.3ng/ul</li>
| |
| - | <li>pET Duet 6.2ng/ul</li>
| |
| - | <li>pET Duet 4.9ng/ul</li></ul>
| |
| - | <br>Checking FdxA gBlock by PCR
| |
| - | <ul><li>1 ul Fdx F</li>
| |
| - | <li>1 ul Fdx R</li>
| |
| - | <li>1 ul Template</li>
| |
| - | <li>7 ul H20</li>
| |
| - | <li>10 ul dreamTaq 2x master mix</li>
| |
| - | PCR failed.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Sunday_25th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 25<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligations
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | For FprA and pET Duet:
| |
| - | <ol><li>Miniprep more plasmid</li>
| |
| - | <li>Digest plasmid and vector backbone</li>
| |
| - | <li>Check DNA concentration</li>
| |
| - | <li>Ligate</li>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Monday_26th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 26<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | P1 phage transduction
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br> The p1 phage lysate was prepared as described in the P1 phage transduction protocol.
| |
| - | <br> BL21 (DE3) <i>ΔCysI Δfpr ΔydbK </i>was grown in 5ml Lb.
| |
| - | <br>One colony was discovered in transformed plate. This colony was re-streaked and grown overnight.
| |
| - | <br>the ligation product from overnight ligation was used to transorm NEB cc cells by heatshock
| |
| - | <br>5ul plate gave a few colonies
| |
| - | <br>10ul plate gave many colonies
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Tuesday_27th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 27<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Sequencing FdxA
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | pJET FdxA sent for sequecing
| |
| - |
| |
| - | <div dir="ltr">
| |
| - | Steps 2-7 of the P1 phage transduction: Lysate preparation were carried out.
| |
| - | </div>
| |
| - | <div dir="ltr">
| |
| - | BL21(AI) was picked and placed into 5ml LB and incubated at 37C overnight.
| |
| - | </div>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Wednesday_28th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 28<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | P1 phage transduction
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>
| |
| - | The transduction section of the P1 phage transduction protocol was carried out.
| |
| - | Cells were plated on Kanamyocin plates to select for resistance and grown overnight.
| |
| - | </p>
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Thursday_29th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 29<sup>th</sup> August</h3>
| |
| - |
| |
| - | <p>
| |
| - | Colonies from the P1 phage transduction grew on the Kanomycin plates.
| |
| - | </p>
| |
| - | <div>
| |
| - | Selected colonies were patched onto Kan and LBA plates and left to grow overnight.
| |
| - | </div>
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Friday_30th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 30<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Confirmation of P1 phage transduction:
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <p>
| |
| - | Colony PCR was used on patched colonies from the p1 phage transduction. The primers used for each colony were CysI F/R and KanR F/R.
| |
| - | </p>
| |
| - | <div>
| |
| - | PCR confirmed that CysI was deleted in BL21(AI) and replaced with a Kanomycin resistance gene.</br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f4/PCR_confirmation_of_BL21AIdeleted_CysI.jpg" width="300" height="300">
| |
| - | </div>
| |
| - | <div>
| |
| - | 2 Single colonies from each agar plate of the patched p1 phage transduced plates were picked and used to inoculate 5ml LB broth overnight.
| |
| - | 750ml of overnight culture was added to 250ml of 60% glycerol in a cryotube.
| |
| - | </div>
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_9th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 9<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Sevres Workshop
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Sevres Workshop
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_10th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 10<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Sevres Workshop
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Sevres Workshop
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Monday_16th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 16<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Cloning gBlock FdxA and Biobricking FprA and SirA
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>FprA and SirA were PCRed with FprA BB F, FprA BB R, SirA BB F and SirA BB R primers respectfully. The PCR was run with an annealing temperature of 60C with an extension time of 1m40s using Phusion polymerase. The band of ~1400bp was cut out and cleaned up using a Quagen Gel Extraction Kit.</p>
| |
| - |
| |
| - | <p>Restriction Digestion of gBlock FdxA with NcoI and HindIII. pET FprA was also digested with NcoI and HindIII. Digestion lasted 30 minutes at 37C afterwhich enzymes were heat inactivated at 80C for 20 minutes. Digestions were ligated together using 6.5ul of FdxA insert and 2ul of FprA into a total volume of 10ul.</p>
| |
| - |
| |
| - | <p>PCR products for FprA and SirA along with linearized pSB1c3 backbone were digested with EcoRI and PstI for 30m at 37C. Restriction enzymes were then heat inactivated at 80C for 20 minutes. Digestions were then ligated together using equal amounts of 2ul insert to 2ul of backbone.</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_17th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 17<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transforming gBlock FdxA and Biobricking FprA and SirA
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Ligations were transformed into E. coli NEBTurbo Chemically Competent Cells by Heat Shock transformation. Cells were recovered for 1.5 hours before being plated. pSB1c3 fprA and pSB1c3 SirA were plated onto Chloramphenicol plates (34ug/ul) and pET FprA FdxA were plated onto Ampicillin (50ug/ul) plates.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_18th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 18<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Patching gBlock FdxA and Biobricking FprA and SirA
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Colonies from Transformation were patched onto appropriate antibiotic plates, 15 colonies from SirA were patched, 6 colonies from FprA were patched and 4 colonies from FdxA were patched.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Thursday_19th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 19<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR Verification of vectors
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Vectors (pET FprA FdxA, pSB1c3 SirA, and pSB1c3 FprA) were used for colony PCR using DreamTaq. Primers used were:</p>
| |
| - | <p>pET FprA FdxA: MCSI F/R, MCSII F/R, FprA F/R, FdxA F/R</p>
| |
| - | <p>pSB1c3 SirA: SB-prep-3P-1/SB-prep-2Ea, SirA F/R</p>
| |
| - | <p>pSB1c3 FprA: SB-prep-3P-1/SB-prep-2Ea, FprA F/R</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Saturday_21st_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 21<sup>st</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Weekend Rush
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Gibson assembly of pSB9S1, pSB10K1, and pSB3C7.</p>
| |
| - | <p>Digestion of sirA, fprA, fdxA and linearized backbone with XbaI and SpeI</p>
| |
| - | <p>Digestion of Linearized pSB1C3 with XbaI, SpeI, and DpnI</p>
| |
| - | <p>Ligation of sirA, fprA, and fdxA with pSB1C3</p>
| |
| - | <p>Heat Shock transformation of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA into NEBTurbo</p>
| |
| - | <p>Heat Shock transformation of pSB9S1, pSB10K1 and pSB3C7 into NEBTurbo</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Sunday_22nd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 22<sup>nd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Verifying shipment vectors
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Growing Culture of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA.</p>
| |
| - | <p>Mini-prep of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA vectors </p>
| |
| - | <p>Colony PCR of pSB1C3 sirA, pSB1C3 fprA and pSB1C3 fdxA with sirA F/R, fprA F/R, fdxA F/R, and biobrick verification primers F/R</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="target_Friday_27th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 27<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Growth Curves
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>IPTG Concentrations by column: 1 0nM, 2 10nM, 3 50nM, 4 100nM, 5 500nM, 6 1uM, 7 5uM, 8 10uM, 9 50uM, 10 100uM, 11 500uM, 12 1mM
| |
| - | <p>Arabinose Concentrations by column: 1 0%, 2 0.01%, 3 0.02%, 4 0.03%, 5 0.04%, 6 0.05%, 7 0.06%, 8 0.07%, 9 0.08%, 10 0.09%, 11 0.1%, 12 0.2%
| |
| - |
| |
| - | <p>Row A: BL21 AI dcysI pACYC SirA pET FprA FdxA 1
| |
| - | Row B: BL21 AI dcysI pACYC SirA pET FprA FdxA 1
| |
| - | Row C: BL21 AI dcysI pACYC SirA pET FprA FdxA 2
| |
| - | Row D: BL21 AI dcysI pACYC SirA pET FprA FdxA 2
| |
| - | <p>Row E: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1
| |
| - | Row F: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 1
| |
| - | Row G: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2
| |
| - | Row H: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 2
| |
| - |
| |
| - | 10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Glucose, 5ul CaCl2, 27.5mL H2O
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Saturday_28th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 28<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Growth Curves
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Growth curves of BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA.
| |
| - |
| |
| - | Column 1: Positive control WT E. coli BL21 (DE3), 2: Negative Control BL21 AI dcysI, 3: BL21 AI dcysI pACYC SirA pET FprA FdxA 0 Arabinose 0 IPTG, 4: 0.1% Arabinose 10uM IPTG, 5: 0.05% Arabinose 50uM IPTG, 6: 0.01% Arabinose 100uM IPTG, 7: 0.2% Arabinose 1mM IPTG, 8: Negative Control BL21 (DE3) dcysI dfpr dydbf, 9: BL21 (DE3) dcysI pACYC SirA pET FprA FdxA 0 IPTG, 10: 50nM IPTG, 11: 1uM IPTG, 12: 50uM IPTG</p>
| |
| - |
| |
| - | <p>Grown in M9 Media with Galactose.</p>
| |
| - | <p>10mL 5x M9 Salts, 10mL 5x Amino Acid Sulfur dropout, 0.5mL MgSO4, 2mL 20% Galactose, 5ul CaCl2, 27.5mL H2O
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Sunday_29th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 29<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR's and more!
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Colony PCR on new Backbones. RFP and Biobrick verification primers
| |
| - | This is for pSB2C and pSB3K
| |
| - |
| |
| - | <p>Colony PCR on SirA, FprA, and FdxA Biobricked parts
| |
| - | Using Biobrick primers and SirA, FprA and FdxA primers respectfully
| |
| - | https://2013.igem.org/File:20130929_BioB.jpg
| |
| - | https://2013.igem.org/File:20130929_RFP.jpg
| |
| - | https://2013.igem.org/File:20190929_pSB3K.jpg
| |
| - |
| |
| - | <p>Phusion PCR on Duet vectors and pSB1C3 using standard cloning primers
| |
| - |
| |
| - | <p>Gel Clean up
| |
| - |
| |
| - | <p>Digestion with NcoI and AvrII
| |
| - |
| |
| - | <p>Standard cloning of new backbones (1h ligation at 16C)
| |
| - |
| |
| - | <p>Transform into NEBTurbo
| |
| - |
| |
| - | <p>Cutting Biobrick SirA, FprA, FdxA and Linearized backbone with EcoRI and SpeI
| |
| - |
| |
| - | <p>Standard clonging of Biobrick parts (1h ligation at 16C)
| |
| - |
| |
| - | <p>Transform into NEBTurbo
| |
| - |
| |
| - | <p>Treat XbaI SpeI cut Backbone with TSAP 1h.
| |
| - |
| |
| - | <p>Standard cloning of Biobrick parts (cut with XbaI, SpeI) into TSAP'd backbone (1h @ 16C)
| |
| - |
| |
| - | <p>Colony PCR on BL21 (DE3) dcysI pACYC SirA pET FprA FdxA and BL21 AI dcysI pACYC SirA pET FprA FdxA
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Monday_30th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 30<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Growth Curves
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We performed Growth Curves with the following strains in each column:
| |
| - | <ol><li>WT BL21 AI</li>
| |
| - | <li>BL21 AI dcysI</li>
| |
| - | <li>BL21 AI dcysI pD002 pD003 0uM IPTG 0% Arabinose</li>
| |
| - | <li>BL21 AI dcysI pD002 pD003 10uM IPTG 0.05% Arabinose</li>
| |
| - | <li>BL21 AI dcysI pD002 pD003 100uM IPTG 0.1% Arabinose</li>
| |
| - | <li>BL21 AI dcysI pD002 pD003 1mM IPTG 0.2% Arabinose</li>
| |
| - | <li>WT BL21 DE3</li>
| |
| - | <li>BL21 DE3 dcysI dfpr dydbf</li>
| |
| - | <li>BL21 DE3 dcysI dfpr dydbf pD002 pD003 0uM IPTG</li>
| |
| - | <li>BL21 DE3 dcysI dfpr dydbf pD002 pD003 10uM IPTG</li>
| |
| - | <li>BL21 DE3 dcysI dfpr dydbf pD002 pD003 100uM IPTG</li>
| |
| - | <li>BL21 DE3 dcysI dfpr dydbf pD002 pD003 1mM IPTG</li>
| |
| - |
| |
| - | Results are https://2013.igem.org/File:20130930_GC_Glucose.xls
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Tuesday_1st_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 1<sup>st</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Israeli Collaboration
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Plasmids arrived. PCR CI plasmid with CI biobrick F/R primers.</p>
| |
| - | <p>Gel Clean-up of CI promoter PCR</p>
| |
| - | <p>Z score of BL21 dCysI pD002 pD003:<b>Didn't Grow, forgot Sucrose in M9</b></p>
| |
| - | <p>Transform pSB1A3 E0240 and pSB3K3 into NEB Turbo</p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Wednesday_2nd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 2<sup>nd</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Race to finish stuff
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Grew up 5ml cultures of pSB3K3 and pSB1A3 E0240 from transformations</p>
| |
| - | <p>Plasmid mini preps of pSB3K3 and pSB1A3 E0240</p>
| |
| - | <p>Restriction Digest of CI promoter PCR product with XbaI and PstI</p>
| |
| - | <p>Restriction Digest of Linearized Backbone pSB1C3 with XbaI, PstI, and DpnI</p>
| |
| - | <p>Make new NEB Turbo Chemically Competent Cells: Modified protocol. 4mL of NEBTurbo into 2 x 2mL tubes. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of 100mM MgCl2 Ice cold. Centrifuge at 14000 rpm for 1 minute at 4C. Resuspend in 500uL of iGEM cc cell buffer Ice cold. Centrifige for 1 minute at 14000 rpm at 4C. resuspend in 100ul of iGEM cc cell buffer Ice cold.</p>
| |
| - | <p>Heat Shock Transformation of pSB1C3 SirA, pSB1C3 FprA, pSB1C3 FdxA into NEBTurbo (new chemically competent cells)</p>
| |
| - | <p>Ligation of CI promoter with pSB1C3 backbone.</p>
| |
| - | <p>Heat Shock Transformation of pSB1C3 CI into NEB Turbo</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="target_Thursday_3rd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Target</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Target" target="_blank" class="tbnotelogo DSlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 3<sup>rd</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Race to Finish stuff
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p>Plated new SirA, FprA, and FdxA transformations on CHL</p>
| |
| - | <p>Picked pSB1C3 CI and grew in LB broth</p>
| |
| - | <p>Z Score of BL21 dCysI pD002 pD003 with Gentamicin as positive hit control</p>
| |
| - | <p>Analytical Digestions of New Vectors (pAD1S, pAD2C, pAD3K, pAD4A)</p>
| |
| - | <p>Digest pSB1C3 CI with EcoRI and SpeI</p>
| |
| - | <p>Digest pSB3K3 with EcoRI and PstI</p>
| |
| - | <p>Digest pSB1A3 E0240 with XbaI and PstI</p>
| |
| - | <p>Ligation of CI promoter with GFP reporter and pSB3K3 backbone</p>
| |
| - | <p>Heat Shock Transformation of pSB3K3 CI GRP into NEBTurbo</p>
| |
| - | <p>PCR verify SirA, FprA, FdxA, and CI biobrick constructs</p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_22nd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 22<sup>nd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transforming the NEB TURBO strain with the pET21b and the pUC18 plasmids. Competent cells were prepared by the CaCl2 protocol. The transformation cultures were plated on ampicilline plates. Transformation was unsuccessful.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Tuesday_23rd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 23<sup>rd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transforming the new NEB strain with the pET21b and the pUC18 plasmids (as yesterday). We’ve also plated the leftovers from the yesterdays' transformation (190 µL of culture on ampicilline plates).
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Wednesday_24th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 24<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | Transformation form yesterday didn’t work. We plated the leftovers on new ampicillin plates.
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Thursday_25th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 25<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | The transformation worked, probably it failed the last two times because the recovery time was to short or the plates were wrong. We did a streak plate to get single colonies.
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Friday_26th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 26<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Single colonies were plated into LB + ampicillin. 4 liquid cultures were prepared: NEB + pET21b (1), NEB + pET21b (2), jNEB + pET21b (1), jNEB + pET21b (2). After 6 h of incubations the liquid cultures were used for
| |
| - | <br />
| |
| - | <br />• Glycerol stock preparation.
| |
| - | <br />• Plasmid purification (the protocol from the box).
| |
| - | <br />
| |
| - | <br />DNA concentrations were measured by the nanodrop (ng/µL):
| |
| - | <br />
| |
| - | <br />NEB1 134.4
| |
| - | <br />NEB2 55.6
| |
| - | <br />jNEB1 186.6
| |
| - | <br />jNEB2 138.6
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Saturday_27th_July.html"</div></html>
| |
| - | <html><div id="infiltrate_Sunday_28th_July.html"</div></html>
| |
| - | <html><div id="infiltrate_Monday_29th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 29<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We did an analytical digest of pET 21b that we purified yesterday. We used Nedl and Xhol so our fragments should be: the backbone of the plasmid (around 5000 bp long) and the cloned MSMEG_1529 gene (around 600 bp long). On the following picture is our plasmid and we suppose that the MSMEG_1592 gene is cloned somewhere in between the two restriction sites that we have chosen. But we still don't really know that because we need the full sequence of the plasmid.
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/a/a9/Plasmid.png" />
| |
| - | <br />
| |
| - | The protocol used for preparing the digestion:
| |
| - | <br />
| |
| - | <br />
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td>Reagent</td>
| |
| - | <td>Volume</td>
| |
| - | <td>10x</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>Plasmid Miniprep</td>
| |
| - | <td>5µl</td>
| |
| - | <td></td>
| |
| - | </tr>
| |
| - | <td>H2O</td>
| |
| - | <td>12 µl</td>
| |
| - | <td>120 µl</td>
| |
| - | </tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | <td>20 µl</td>
| |
| - | </tr>
| |
| - | <td>10x FastDigest Buffer</td>
| |
| - | <td>2 µl</td>
| |
| - | <td>20 µl</td>
| |
| - | </tr>
| |
| - | <td>FastDigest Enzyme 1</td>
| |
| - | <td>0.5µl</td>
| |
| - | <td>5 µl</td>
| |
| - | </tr>
| |
| - | <td>FastDigest Enzyme 2</td>
| |
| - | <td>0.5µl</td>
| |
| - | <td>5 µl</td>
| |
| - | </tr>
| |
| - | <td>Total Volume</td>
| |
| - | <td>20.0 µl</td>
| |
| - | <td>200 µl</td>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br />
| |
| - | Digest for 1 h at 37 °C with shaking.
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/4/47/KR004491.jpg" />
| |
| - | <br />
| |
| - | <br />
| |
| - | NEB1 and 2 are plasmids isolated from two different liquid cultures of the NEB strain; jNEB1 and 2 are plasmids isolated from two different liquid cultures of the NEB strain which was made competent by Jake. The (-) stands for a negative control: only DNA was added, without any digestion enzymes. As you can see it on the gel there are 2 bands - one is around 5000 bp long (fits the length of our plasmids backbone), and the other one is around 700 bp long (fits the length of our gene).
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_30th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 30<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transformed the bl21 (DE3) strain with the pET21b (plated the transformation culture on 2 amp plates).
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_31st_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 31<sup>st</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transformation worked. The number of transformed colonies is: 78 on plate 1 and 284 on plate. We prepared the liquid cultures and glycerol stocks of bl21 (DE3) + pET21b strain.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_1st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 1<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We want to see if 1 mM solution of IPTG induces the over expression in our strain.
| |
| - | We prepared 4 liquid cultures (no antibiotics added):
| |
| - | <br />
| |
| - | <br />• bl21 (DE3) + pET21b strain induced with 1 mM IPTG
| |
| - | <br />• uninduced bl21 (DE3) + pET21b strain
| |
| - | <br />• untransformed bl21 (DE3) + 1 mM IPTG
| |
| - | <br />• untransformed bl21 (DE3)
| |
| - | <br />
| |
| - | <br />
| |
| - | 10 mL of culture had 500 µL of the overnight culture (O.D.600 was set to 0.2) and 100 µL of 100 mM IPTG.
| |
| - | We measured the O.D. of the cultures (600 nm) for time 0 and after 6 h. We also diluted our cultures to calculate the CFU/mL (for time 0 10-1 and 10-2 dilutions were prepared, and 100 µL of each dilution was plated on LBA plates; for 6 h 10-3, 10-4 and 10-5 for the induced culture and 10-7, 10-8 and 10-9 for all the others, 10 µL of each were plated). We also saved 2 mL for each group in the fridge.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Friday_2nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 2<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We repeated the time 6 measurement (the cultures were over diluted, so this time we did 10-5, 10-6 and 10-7). We also did the 24 h measurement (we used the 10-6, 10-7 and 10-8 dilutions).
| |
| - | The final results are:
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/1/1f/O.D.1.png" />
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/50/CFU1.png" />
| |
| - | <br />
| |
| - | <br />
| |
| - | Growth inhibition could be noticed for the induced strain, which is probably a consequence of the over expression. The induced culture recovered and reached a greater CFU/mL value than in the previous groups. Maybe because we didn’t add any antibiotics in our media, the plasmid was lost and the culture could recover after achieving the over expression.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 5<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We want to repeat our previous experiment, but now we will add ampicillin in the media containing the transformed strains. We set everything as previously, did the 0 h (100 µL of 10<sup>-1</sup> and 10<sup>-2</sup>) and 6 h measurement (100 µL of 10<sup>-1</sup> and 10<sup>-2</sup> for the induced strain; 100 µL of 10<sup>-1</sup> and 10<sup>-6</sup> for the others).
| |
| - | <html><div id="infiltrate_Tuesday_6th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 6<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We did the 24 h measurement (100 µL of 10<sup>-6</sup> and 10<sup>-7</sup>), and repeated the 0 h measurement (100 µL of 10<sup>-3</sup> dilution).
| |
| - | <br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_7th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 7<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Repeated the 0 h measurement for uninduced bl21 (DE3) + pET21b strain (100 µL of 10<sup>-3</sup> dilution), and the 24 h measurement for the induced strain (100 µL of 10<sup>-5</sup>, 10<sup>-4</sup>, 10<sup>-3</sup> and 10<sup>-2</sup>).
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_8th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 8<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | The growth curve for uninduced and induced bl21 (DE3), with antibiotics in the liquid culture:
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/eb/OD2.png" />
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://static.igem.org/mediawiki/2013/3/31/CFU2.png" />
| |
| - | <br />
| |
| - | <br />
| |
| - | The O.D. grows again after 24 h for the induced strain, but the CFU stays the same. Probably the O.D. grows because of the protein.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_12th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 12<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | In order to grow M. smegmatis we should add Tween 80 (0.2 % / v.v) into the LB media (it stops the cells from forming clumps). In some papers we found that Tween 80 could inhibit the growth of E. coli, so we did a growth curve to check that. 500 μL of BL21 + pET21b culture (O.D. 600 nm = 1.00) was added to 10 mL of LB supplemented with different concentrations of Tween 80 – 0.2, 0.1 and 0.05 %. There were two sets of these cultures – one was induced with IPTG and the other one was not. O.D. was measured after 3 and 6 h. At these time periods cultures were also diluted to calculate the CFU.
| |
| - | No growth inhibition was observed, so we can use Tween 80 in our E.coli – M. smegmatis co-cultures.
| |
| - | We have also made some plates with malachite green (40, 4 and 0.4 μg/mL) and we have plated E. coli on them.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_13th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 13<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We finally got M. smegmatis today!!! We made liquid cultures in LB + 0.2% Tween 80 and we also plated it on LBA.
| |
| - | <br />
| |
| - | E. coli doesn’t grow on plates with 40 and 4 μg/mL of malachite green, but it does on 0.4 μg/mL.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_14th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 14<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Streak plate and liquid cultures for M. smegmatis and E. coli BL21 + pET21b.
| |
| - | We started a plate reading experiment in order to see which concentrations of nalidixic acid should we use in our selective media. The tested concentrations were: 50, 25, 12.5, 6.25,3.125, 1.5625, 0.78125, 0.390625, 0.1953125, 0.09765625, 0.048828125 μg/mL. We also tested different concentrations of IPTG, to see which ones induce the strain without killing it. The tested concentrations were: 1, 0.5, 0.25, 0.125, 0.0625, 0.03125, 0.015625, 0.0078125, 0.00390625, 0.001953125, 0.0009765625 μg/mL. The concentration of bacteria in each well was 1 % and the bl21 culture of O.D. = 0.5 was used.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_15th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 15<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Another plate reading experiment, with M. smegmatis for nalidixic acid (50, 25, 12.5, 6.25,3.125, 1.5625, 0.78125, 0.390625, 0.1953125, 0.09765625, 0.048828125 μg/mL) and with malachite green (400, 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, 0.390625 μg/mL); The concentration of bacteria was 1 % in LB with 0.2 % of Tween 80 and the culture with O.D. of 0.5 was used.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Friday_16th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 16<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We started a growth curve for M. smegatis. In 20 mL of LBA with 0.2 % of Tween 20 μL of the liquid culture was added (O.D. Of the culture which was inoculated was 1). O.D. And CFU were determined each 3 hours. Dilutions which were used are: 10-1 and 10-2 for time 0, 10-2 and 10-3 for 3 h, 10-5 and 10-6 for 9 h.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Saturday_17th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 17<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Because we suspect that the culture was contaminated we repeated the experiment with 3 separate cultures. n 20 mL of LBA with 0.2 % of Tween 20 μL of the liquid culture was added (O.D. Of the culture which was inoculated was 1). O.D. And CFU were determined each 3 hours. Dilutions which were used are: 10-1 and 10-2 for time 0, 10-2 and 10-3 for 3 h, 10-5 and 10-6 for 9 h, 10-7 for 24 h. We saved some plates so we could perform acid fast staining and check if its really M. smegmatis.
| |
| - | We have transformed bl21 by electroporation with pET21b and with pSB1C3, so we could get RFP E. coli expressing our protein. The transformed culture was plated on plates containing ampicilline and chloramphenicol.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Sunday_18th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Sunday 18<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Made a liquid culture of BL21 + pET21b + pSB1C3.
| |
| - | Plated the strain which contains the LLO plasmids (pACYZ184) on LBA + tetracycline + chloramphenicol, LBA + tetracycline and LBA + chloramphenicol because we don’t know which resistance the plasmid really has.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_19th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 19<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | LLO plasmid containing bacteria are growing only on chloramphenicol containing plates, so tetracyclin resistance was lost due to the cloning of the hly downstream of the tet promoter.
| |
| - | <br />
| |
| - | <br />
| |
| - | The cells we transformed with pET21b (ampiciline resistance) and with the pSB1C3 plasmid (chloramphenicol resistance) are not growing on amp and chl containing plates because the origins of the plasmids are not compatible. So we are repeating the transformation with the pSB3C5 plasmid, which has a different origin.
| |
| - | <br />
| |
| - | <br />
| |
| - | We have started a co-culture with M. smegmatis and E. coli NEB turbo + pSB1C3 to see if our selective media with nalidixic acid is really working. Two cultures in their stationary phase were mixed (O.D. for M. smegmatis was 1.5 and for E. coli was 1): in 10 mL of LB 100 µL of each culture was added. We did dilution series for the start cultures and for the co-culture. Each was plated on: LBA plates where both strains should grow; on LBA + 3 µg/mL nalidixic acid plates, where only M. smegmatis should grow; on chl plates where only E. coli should grow.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_20th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 20<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We did a miniprep for the LLO plasmid (we had to do dialysis to purify the plasmid).
| |
| - | <br />
| |
| - | <br />
| |
| - | We observed the RFP producing cells (BL21 + pET21b + pSB3C5) under the fluorescent microscope and the cells produce RFP. We made a liquid culutre of the strain with 1 mM IPTG. We also plated them on LBA + 1 mM IPTG.
| |
| - | <br />
| |
| - | <br />
| |
| - | Liquid culture of M. smegmatis was made, but in the liquid culture 2 µL/mL of malachite green was added. We plated the culture on LBA + 3 µL/mL of nalidixic acid and on LBA to compare the number of colonies.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_21st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 21<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Our macrophages arrived today and we are staring a cell culture!
| |
| - | The cells with pET21b and pSB3C5 can't survive the induction with 1 mM IPTG because they have two IPTG inducable promoters. We want to use a different insert, one with an uninducable promoter, such as BBa_J23100-118.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_22nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 22<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Counting the colonies from Monday; our plates with nalidixic acid are selective. We also noticed that the colonies showed up faster on the plates for the liquid culture supplemented with malachite green.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_26th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 26<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We started a killing assay for M. smegmatis: we had two groups; in the first one the ratio between M. smegmatis and E. coli BL21 + pET21b was 1:1 and in the other it was 1:2. BL21 was induced with 1 mM IPTG in the co-culture (10 mL of LB, 0.1 mL of each strain and 0.1 mL of 100 mM IPTG). For each group a control was made - same ratio between the strains but no induction. Also we had one group with only M. smegmatis. We did dilution series for time 0, after 3 and after 6 h. We also measured the O.D. (600 nm) for each time point.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_27th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 27<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We did a digestion of J23102 and J23104 with EcoRI and with and Pstl and we gel purified the RFP gene with a constitutive promoter. We also did a digestion for pSB3C5 with the same enzymes and we did gel purification for the backbone. The ligation product was then transformed into NEB Turbo.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_28th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 28<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Cloning from yesterday didn't work, so we will repeat everything with a different backbone. On gels for the digested pSB3C5 we couldn't see the part which was cut out, so we guess there is something wrong with this plasmid and we want to use a new one - pColaDuet-1 with a colA origin. We amplified the insert form J23102 and J23104 with biobrick verification primers and then we did PCR purification. We digested the insert and the backbone with EcoRI and Pstl and we did PCR purification for both of them. After measuring the concentration for both, we did a ligation in molar ration insert:backbone = 3:1 on 16 deg C for 1 h. The ligation product was transformed into NEB Turbo.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_29th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 29<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We did a phagocytosis assay for our macrophages. First we passaged our cells and we determined their number (colored them with trypan blue and counted them): 2.68* 10<sup>6</sup>, 3.72* 10<sup>6</sup> and 1.32* 10<sup>6</sup>. To the first one we added 40, to the second 30 and to the last one 90 µl of NEB + pSB1A3 cell suspension. After 1 h we made this awesom picture:
| |
| - | <br />
| |
| - | <br />
| |
| - | <img src="https://2013.igem.org/File:Cool_pic_1.tif" />
| |
| - | <br />
| |
| - | <br />
| |
| - | Cloning from yesterday didn't work, so we repeated everything with longer digestion time for the backbone.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Friday_30th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 30<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Cloning worked. Made liquid cultures. Counted the colonies for the killing assay.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Saturday_31st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 31<sup>st</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | miniprep for pColADuet-1 + J23102/104. PCR for pET21b and the LLO plasmid (it didn't work).
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_2nd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 2<sup>nd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | Transformed BL21 + pET21b with pColA + J23102/104 (electroporation and heat shock), transformed BL21 + pET21b with pColA + J23102/104 and with the LLO plasmid.
| |
| - |
| |
| - | The PCR for the pET21b worked and we've sent it for sequencing; the PCR for the LLO plasmid didn't work :(
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_3rd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 3<sup>rd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Liquid cultures for BL21 + pET21b + pColA and for BL21 + pET21b + pColA + the LLO plasmid. We passaged the macrophages and we ordered new primers for sequencing the LLO plasmid.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_4th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 4<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | The killing assay for M. smegamtis, with more time points. Now we can also follow the number of E. coli because it has RFP. In 20 mL of LB we added 100 µL of the M. smegmatis liquid culture (O.D. = 1.2) and 100 µL of the E. coli liquid culture (O.D. = 1) so we get 1:1 ratio. We measured the O.D. and the CFU for time 0, 1, 2, 3 and 6 h. To do the CFU for E. coli we plate the dilution on LBA + Kan + Amp, and for M. smegmatis we plate on LBA + 30 µL.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_5th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 5<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Counted the colonies for E. coli and prepared everything for another killing assay. Liquid cultures for E. coli BL21 + pET21b + the LLO plasmid + the RFP plasmid; BL21 + pET21b + the RFP plasmid; M. smegmatis.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Friday_6th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 6<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | New killing assay with different E. coli and M.smegmatis ratio --> 0.1 : 1
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Saturday_7th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 7<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | New killing assay with a new ratio --> E. coli : M. smegmatis = 0.01 : 1
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_9th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 9<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Counting the colonies from the killing assay and doing the Bradford assay for each time point.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_10th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 10<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />• PCR for the linearized backbone: template - pSB1C3 (1 µL), primers (SB-prep-2Eb, SB-prep-3P-1; 2.5 µL), HE buffer (10 µL), dNTPs (1 µL), polymerase (0.5 µL), dH2O (32.5 µL).
| |
| - | <br />
| |
| - | <br />
| |
| - | program: 94.0 (30 s) - 94.0 (10 s), 55.0 (1 min), 72.0 (2 min), 72.0 (3 min) - 30 cycles.
| |
| - | <br />• touchdown PCR for the new backbones:
| |
| - |
| |
| - | <br />
| |
| - | <br />
| |
| - | <table border="1">
| |
| - | <tr>
| |
| - | <td>Template</td>
| |
| - | <td>Primers</td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td>pACYC</td>
| |
| - | <td>pDCA2 and pDCA</td>
| |
| - | <td></td>
| |
| - | </tr>
| |
| - | <td>pET</td>
| |
| - | <td>pDCo4-F and pDCo4-R</td>
| |
| - | </tr>
| |
| - | <td>pCDF</td>
| |
| - | <td>pDCA1 and pDCA</td>
| |
| - | </tr>
| |
| - | <td>pColA</td>
| |
| - | <td>pDCA3 and pDCA</td>
| |
| - | </tr>
| |
| - | </tr>
| |
| - | </table>
| |
| - | <br />
| |
| - | <br />
| |
| - | program: 95.0 (10 s) - 95.0 (30 s), 60.0 (30 s), 59.0 (30 s),58.0 (30 s), 56.0 (30 s), 55.0 (30 s), 72.0 (30 s) - 72.0 (10 min)- 30 cycles.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Wednesday_11th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 11<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | PCR for biobricking TDMH, for sequencing the LLO plasmid and for adding biobrick cutsites to pET21b; PCR purification of the products. PCR for the linear backbone and PCR purification. PCR for the new backbones gel slice and purification.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Thursday_12th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 12<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <br />• linear bacbone PCR: Phusion protocol from the 10th of the September, new PCR program: 98.0 (30 s) - 98.0 (10 s), 58.0 (15 s), 72.0 (1:10) - 72.0 (3 min). This time the PCR worked fine - no unspecific binding; the band was 2 kb long.
| |
| - | <br />
| |
| - | <br />• PCR for biobricking TDMH: we designed primers to add biobrick cutsites on our TDMH gene. Template - pET21b+TDMH miniprep (150 ng/µL), primers - TDMH F (gaattcgcggccgcttctagATGATTTCCCTCCGGAAGCC) and TDMH R (ctgcagcggccgctactagtaTCAGTGGTGGTGGTGGTGGT). Program: 98.0 (30 s) - 98.0 (10 s), 62.0 - 58.0 (30 s), 72.0 (30 s) - 72.0 (10 min). It worked, bend size - 700 bp.
| |
| - | <br />
| |
| - | <br />• Gibson assembly for the new backbones: PCR products from the 10th of September were used (the same PCR reaction was done for the biobrick pSB2C3 backbone with all primers, so each PCR product for the Duet backbones was mixed with the corresponding pSB product. Protocol: 5 µL of each product, 10 µL of the Gibson master mix, 15 min on 50.0.
| |
| - | <br />
| |
| - | <br />• PCR for RFP - we wanna add biobrick cut sites on the RFP gene from pSB1C3 (Phusion protocol). Primers: gaattcgcggccgcttctagATGGCTTCCTCCGAAGACGT(RFP F), ctgcagcggccgctactagtaGCGATCTACACTAGCACTAT (RFP R).
| |
| - | <br />
| |
| - | <br />• PCR to biobrick pET, so we could clone RFP in it and put it under the T7 promoter: template is pET21b+TDMH (Phusion protocol). Primers: tactagtagcggccgctgcagGATCCGGCTGCTAACAAAGC (pET R), ctagaagcggccgcgaattcATGTATATCTCCTTCTTAAA (pET F)
| |
| - | <br />
| |
| - | <br />• miniprep for DB3.1 + pColA-pSB3C5 and for DB3.1 + pCDF-pSB3C5. Then we did colony PCR for the minipreps with the corresponding primers (pDCA/pDCA3 and pDCA/pDCA1) to check if the insert from the Duet vectors is inside. The bends were the right size.
| |
| - | <br />
| |
| - | <br />• Digestion of TDMH (biobricked) and the linear backbone:
| |
| - | <br />
| |
| - | For the backbone: 10 µL of the plasmid, 10 µL of the Green buffer, 3 µL for EcoRI and Pstl, 14 µL of dH2O.
| |
| - | <br />
| |
| - | For TDMH: 10 µL of the pcr product, 4 µL of the Green buffer, 1.5 µL for EcoRI and Pstl, 23 µL od dH2O.
| |
| - | <br />
| |
| - | <br />• PCR Ligation for biobricking TDMH: dH20 4.5 µL, TDMH 1 µL, linear backbone 3 µL, T4 ligation buffer 1 µL, T4 ligase 0.5 µL; 16.0 fr 1 h.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Friday_13th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 13<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | A lot of macrophages died (in suspension) because we forgot to add glutamine and pyruvate sodium. We repeated the experiment with the complete media (but again without antibiotics).
| |
| - | <br />
| |
| - | <br />
| |
| - | <br />• Results for the GA: because the Chl plates were off, I have to repeat everything for biobricking TDMH and for the pACYC derived backbone. The cloning for pCDF and pColA worked - patched the colonies, start liquid cultures.
| |
| - | <br />
| |
| - | <br />• Launch NEB Turbo to make competent cells.
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Saturday_14th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 14<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | Fresh liquid cultures for: M smegmatis pMyC-GFP (kanamycine resistance) , M smegmatis, E.coli Bl21 carrying pET21b-TDMH and pColA-RFP (ampicilin and kanamycine resistances) and E.coli Bl21 carrying pET21b-TDMH, pColA RFP and pACyC-hly (ampicilin, kanamycine and chloramphenicol resistances)
| |
| - | <br />
| |
| - | <br />• CaCl2 competent cells for NEB Turbo - 25 mL of the culture (O.D. 1), 3 washing steps (1o min, 4 000 rpm, on 4.0). For the first one - 100 mM MgCl2, for the second - 100 mM CaCl 2, after the last one the cells were resuspended in CaCl2 + glycerol. I've also made electrocompetent cells (3 washes in dH20).
| |
| - | <br />
| |
| - | <br />• cloning biobricked TDMH in the linear backbone - protocol from the 12th of September. New competent cells and new Chl plates.
| |
| - | <br />
| |
| - | <br />• pET+pSB3C5 worked - miniprep; repeated the Gibson for pACYC
| |
| - | <br />
| |
| - | <br />• PCR for confirming pET+pSB3C5 - tamplet is the miniprep and the primers are pDCo4 R/F. pET Duet as the positive controle (Phusion protocol).
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Sunday_15th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 15<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <br />• Liquid culture for TDMH+pSB1C3.
| |
| - | <br />
| |
| - | <br />• Colony PCR for confirming TDMH+pSB1C3 with biobrick verification primers.
| |
| - | <br />
| |
| - | <br />• A new setup for testing if E. coli kills M. smegmatis in the macrophages: 2 wells with M. smegmatis, 1 well with M. smeg + E. coli uninduced, 1 well with only E. coli, 1 well with M. smeg + E. coli induced. First we infect the macropheges with the liquid culture of M. smeg GFP - we set the final O.D. of the culture in the well to 0.03 (100 µL of the liquid culture with O.D. 0.3 to 900 µL of RPMI with attached macrophages. After 2 h of incubation in the CO2 incubator we wash the cells with PBS 10 times and we add E. coli induced or uninduced (induced overnight with 10 µL IPTG).
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Monday_16th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Monday 16<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <br />• I have to repeat the biobricking of TDMH because I didn't use the DpnI and because the linear backbone which I was using didnt have the RFP cassette. So I've repeated the PCR with the right backbone.
| |
| - | <br />
| |
| - | <br />• Digesting the linear backbone: 10 µL plasmid, 10 µL fast digest buffer, 3 µL for EcoRI and Pstl, 1 µL od DpnI, 73 µL of dH20. 1 h, 37.0
| |
| - | <br />
| |
| - | <br />• Ligation of the digested linear backbone and TDMH - backbone 3 µL, insert 1 µL, ligation buffer 1 µL, ligation enzyme 0.5 µL, dH2O 4.5 µL.
| |
| - | <br />
| |
| - | <br />•A new setup for the macrophages; the protocol from the 15th of September; the groups were: macrophages alone, 2 x macrophages infected with M. smegmatis, 2 x macrophages infected with E. coli, 2 x M. smeg + E. coli uninduced, 2 x M. smeg + E. coli induced overnight, 2 x M. smeg + E. coli induced for 2 h. We also scratched the macrophages from yesterdays' setup and tried to get CFUs for them - 1 mL of the scratch (in PBS)was centrifuged (1 500 rpm, 10 min) to remove any cells which were not phagocytosed. The pallet was resuspended in 1 mL of PBS and the membranes of the macrophages were lysed with 5 µL of TritonX. 100 µL of the suspension was plated on LBA plates.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_17th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 17<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <br />• A new setup (as yesterday); plated the scratches form yesterday. This time we washed our cells after the infection with e. coli.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Wednesday_18th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Wednesday 18<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Made pictures for the yesterdays' setup. The cloning from yesterday didn't work, so I plated the leftovers of the transformation culture.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Friday_20th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 20<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <br />• The cloning for biobricking TDMH worked, so we have to check if it has the insert. We run a PCR with the TDMH primers and we get a bend of around 700 bp, which is fine. We also did a PCR with the biobrick verification primers and the bend was around 1 kb and it was different then the band for the pSB1C3 (bigger, but the difference is not that obvious). So there is probably something inside.
| |
| - | <br />
| |
| - | <br />• We did a new setup where we also tried to use M. smegmatis which is not GFP and stain it with a fluorescent die for Mycobacteria, but its not working. After a few h the level of contamination was hughe so we are repeating everything tomorrow with adding antibiotics in the media.
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Tuesday_15th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 15<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Start fresh cultures for E.coli bl21 and M.smegmatis-GFP. <br>
| |
| - | Change the media of the macrophages J774.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Wednesday_16th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We want to investigate the stability of the protein TDMH at different pH.<br>
| |
| - | To do this, I prepared buffers at different pH using monosodium phosphate and disodium phosphate. <br>
| |
| - | We used a calculator (http://home.fuse.net/clymer/buffers/phos2.html) to have an idea of how much miligrams should we add of each to get the right pH. Buffer strenght was 10mM.<br>
| |
| - | <br>
| |
| - | We prepared a range of pH and checked them using a pH meter.<br>
| |
| - | <br>
| |
| - | The pH were: 4,54 ; 5,15; 6,43; 7,36; 8,25 and 8,84 <br>
| |
| - | <br>
| |
| - | pH lower than 4,5 and higher than 8,8 couldn't be reached (because of the pKa as it is a weak acid).<br>
| |
| - | <br>
| |
| - | We wanted to test another pH around 3, so we add HCl to reach pH 3.<br>
| |
| - | <br>
| |
| - | The buffer were made with osmosed water and have been autoclaved after the pH measurement.<br>
| |
| - | <br>
| |
| - | <br>
| |
| - | We also made glycerol stock of E.coli (the one with 3 plasmids carrying TDMH,LLO and RFP genes)from the overnight as described in the protocol.
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Thursday_17th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Thursday 17<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | To study the stability of TDMH at 7 different pH we extracted it from E.coli using the kit B-PER.<br>
| |
| - | <br>
| |
| - | We have 4 groups: <br>
| |
| - | <br>
| |
| - | - M.smegmatis alone<br>
| |
| - | - M.smegmatis + E.coli's control (producing another protein) induced<br>
| |
| - | - M.smegmatis + E.coli's Bl21 (with TDMH gene) uninduced proteins<br>
| |
| - | - M.smegmatis+ E.coli's Bl21 (with TDMH gene) induced proteins<br>
| |
| - | <br>
| |
| - | We plate at time 0, 3h and 6 h using selective plates (nalidixic acid 3 micrograms/mL) and making 2 different dilutions<br>
| |
| - | <br>
| |
| - | We had 3 wells for each condition.
| |
| - | <br>
| |
| - | We plated bacteria on 504 plates
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Friday_18th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Friday 18<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | Making fresh cultures to repeat the experiment.
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Saturday_19th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Saturday 19<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | Repeating the pH experiment using smaller volume of detergent (3 microliters) because we were afraid that the detergent will affect M.smegmatis in the previous experiment.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Sunday_20th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Counting the colonies of M.smegmatis on the plates from Thursday.<br>
| |
| - | <br>
| |
| - | We stopped because we noticed no significant difference between what was tested and the controls.<br>
| |
| - | <br>
| |
| - | Maybe the protein wasn't extracted properly or it was extracted and inactive (denaturated)...<br>
| |
| - | <br>
| |
| - | Also we noticed a decrease of 10-20% of the number of M.smegmatis colonies growing in all the wells with the detergent (and the proteins) (around 50microliters per well). <br>
| |
| - | <br>
| |
| - | The very low pH (3 and 4,5) affected the growth of M.smegmatis by 20-30% <br>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Monday_21st_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 21<sup>st</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Counting the colonies from the second experiment ==> unsuccessful experiment. <br>
| |
| - | <br>
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="infiltrate_Tuesday_22nd_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Starting new cultures and making glycerol stocks for M.smegmatis-GFP.
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="infiltrate_Saturday_26th_October.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Infiltrate</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Infiltrate" target="_blank" class="tbnotelogo TClogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 16<sup>th</sup> October</h3>
| |
| - | <p><b><em>
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | We repeated the pH study using the plate reader and the OD this time. <br>
| |
| - | Same controls and conditions, the only difference is the protein extraction. <br>
| |
| - | We decided that we will just overexpressed E.coli (10mM IPTG as previously) and collect the supernatant. <br>
| |
| - | We centrifuged 5minutes at 4000 rpm and took the supernatant. Then, the supernatant was filter sterilized <br>
| |
| - | We add 200 microliters of M.smegmatis (OD 0,05) resuspended in the appropriate buffer and 20 microliters of E.coli (OD 0,5).<br>
| |
| - | To know precisely the initial number of bacteria, we made CFU for each pH (resuspended in a different buffer). <br>
| |
| - | We launched the plate reader for 24 hours.
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Monday_24th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>24<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | starting bacterial culture of MG1655-6300 (Chantal’s glycerol)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -streaking 2 Agar plate with it
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Tuesday_25th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>25<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | choosing a nice colony and launching overnight culture 37° in LB
| |
| - | </p>
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Wednesday_26th_June.html"</div></html>
| |
| - | <html><div id="sabotage_Thursday_27th_June.html"</div></html>
| |
| - | <html><div id="sabotage_Friday_28th_June.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>28<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <p lang="en-US">
| |
| - | sRNA design
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <img src="" name="Picture" alt="A description..." align="BOTTOM" border="0" height="197" width="304"/>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | red sequences:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pACYCDuet-1 (CmR) : ATATCCAGTGATTTTTTTCTCCAT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pCOLADuet-1 (KanR) : CGTTTCCCGTTGAATATGGCTCAT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | We decided that targeting only two different antibiotic resistance will be enough for a proof of concept. We give up AmpR because otherwise they might be
| |
| - | experimental issues with AmpR that is also on phagemid litmus28i.
| |
| - | </p>
| |
| - |
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Tuesday_2nd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>2<sup>nd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <p lang="en-US">
| |
| - | <em>Aude and Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>glycerol stock</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | from overnight culture of MG1655-6300 O/N : T001
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Centrifuge 4000rpm, 10 minutes,
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | take out liquid
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | resuspend cells in 1mL glycerol, 2mL LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | separate in two cryotubes, one for the -80°C, one for the -20°C
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <strong>Electroporation</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - making MG1655-6300 competent (Aude’s protocol for electrocompetent cells & electroporation [ref needed])
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - test of the competent cells (negative
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -transforming with pCOLADuet-1 : Ec2 =>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -transforming with pACYCDuet-1 : Ec2 =>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - plating 3 different quantity of cells (20ul, 50uL, 100uL) respectively on Cm and Kan plates (dilution 1000x for the antibiotics)
| |
| - | </p>
| |
| - | </div></html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_3rd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>3<sup>rd</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <p lang="en-US">
| |
| - | <em>Aude and Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Transfo results :
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | negative controls are negative.
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Transformed cells grew on plates
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | in the evening launch of 5mL Lb cultures from clones on the plates
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <strong>Igem Buffer for chemical competent cells</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Igem protocol for chemical competent cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Launch overnight culture of NEB turbo</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5mL LB inoculated with a clone from plate of drug team
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_4th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>4<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Aude</em>
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Glycerols of the overnight cultures of the transformation
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | sT002 : MG1655 pCOLADuet-1
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | sT003 : MG1655 pACYCDuet-1
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <em>Aude and Clovis</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Making stocks of electro competent NEB turbo</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Prepare 10% glycerol solution
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Put on Ice 1L of Sterile water, 10% glycerol solution and 10 falcon tubes
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cool down centrifuge to 4°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Prepare a rack with 50 microtubes at -80°C
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Dilute in 500 mL LB (in a 1000mL flask) 500 ul of NEB turbo pre cultured
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Check the OD until it reached 0,5
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Put 500mL cultures in 10 50mL falcon tubes in ice
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Wait for 20 minutes for the culture to cool down
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Centrifuge at 3400 rpm 4°C for 10 minutes
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Take out liquid and resuspend in 50 mL ice cold water (resuspend content of two tubes in one tube)
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Centrifuge 10 minutes, 4°C , 3400 rpm
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Take out liquid and resuspend in 25 mL ice cold water
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Centrifuge 10 minutes, 4°C, 3400 rpm
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Resuspend all the content of the tubes in 20mL ice cold glycerol
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Centrifuge 10 minutes, 4°C, 3400rpm
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Resuspend in 5mL ice cold 10°C glycerol solution
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Aliquot in 50 tubes (100uL per microtubes)
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Store at -80°C
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Monday_15th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>15<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Clovis and Anne</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Primer Design</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Geneious files in the dropbox: LacZ primers, KanR primers
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Tuesday_16th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>16<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Anne with Nico, Marguerite and Yonatan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Transformation of pUC18 (NEB, NEB CC, BL21)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1) Thaw competent cells on ice.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) Place 20 ul of cells in a pre-chilled Eppendorf tube.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3) add o.5ul of plasmid to the cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Mix gently by flicking the tube.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Chill on ice for 10 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Heat shock at 42 °C for 30 seconds.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Return to ice for 2 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 6) Add 200 ul LB medium and recover the cells by shaking at 37 °C for 30 min (AmpR)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7) Plate out the cells (10 ul) on Amp LB plates as well as a control (untransformed cells)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 8. Incubate at 37 °C. Transformants should appear within 12 hrs.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Result: Colonies (around 10)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent and Aude</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>In silico cloning: sRNA gBlocks into pUC18 and litmus28-GFP</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Successful with both Gibson assembly and regular cloning.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | See file: “in silico cloning trojan horse.geneious”
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent </em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | streaking Ortiz’s strain ELS-41 and ELS-13 containing Litmus28i_J23115-B0032-GFP and M13K07, respectively.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_17th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>17<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Anne</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Redsign of Primers</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Design primers to PCR KanR out of Duet and LacZalpha out of pUC18 to then clone them into the DUET containing Chloramphenicol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Geneious files in the dropbox: LacZ primers, KanR primers
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Clovis and Anne</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Liquid Cultures (for Miniprep)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7ml LB with proper antibiotics
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | adding: 1) NEB with pUC18 (AmpR)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) sT002 : MG1655 pCOLADuet-1 (KanR)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3) sT003 : MG1655 pACYCDuet-1 (ChlaR)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cultivate over night in the 37°C shaker
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Check: GFP expressed as expected in ELS-41
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Lauching O/N</strong>
| |
| - | of ELS-41 and ELS-13 with Amp and Kan, respectively.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Aude
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Lauching O/N of MGZ1 </strong>
| |
| - | (Glycerol from lab upstairs) with Spec (500X)
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_18th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>18<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent and Aude</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Glycerol stock</strong>
| |
| - | of ELS-41 and ELS-13 and MGZ1 now renamed sT004, sT005, sT006 respectively:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sT004: RP437, F+ Litmus28i_J23115-B0032-GFP AmpR
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sT005: XL1-Blue, M13K07 KanR
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Making electrocompetent cells</strong>
| |
| - | from strain sT004, sT005 and MGZ1 => Bad old water => could not obtain competent cells.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Conjugation :</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sT004: RP437, F+ Litmus28i_J23115-B0032-GFP + conjugate with MGZ1.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | F+ comes from XL1 Blue (Ortiz paper) => F+ is tetR
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol :
| |
| - | </p>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | From O/N cultures Dilute both strains 1/100 , in LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Wait for OD to reach O,2
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Prepare 4 tubes (in BD tubes) :
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <ol start="4">
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Incubate 2 hours at 37°C
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Plate 100ul for controls, 100uL, 50ul, 20ul for mixed tubes on LB antiobiotics (here tet and spec)
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Incubate overnight at 37°C
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <p lang="en-US">
| |
| - | <em>Aude</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Miniprep pT005 (Litmus28i_J23115-B0032-GFP) pT006 (M13K07) (<strong>Thermo Scientific Miniprep Kit)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pT005 : 280 ng /uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pT006 : 61 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Aude Vincent Sebastian and Yonatan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Work on the model
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Define the players, the processes in place (more in Modeling file)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <img src="" name="graphics1" alt="A description..." align="BOTTOM" border="0" height="452" width="603"/>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Anne and Clovis</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Miniprep (sT002, sT003, NEB+pUC18) using the Thermo Scientific Miniprep Kit</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1) Pellet 5ml of liquid culture (max speed, 1 min)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) Discard supernatant
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3) resuspend the cells in 250ul of resuspension olution
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) add 250ul of lysis solution, mix by inverting 4-6 times
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) add 350ul of neutralization solution
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) centrifuge for 5 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) transfer supernatant to spin column
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 6) centrifuge for 1 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7) discard flow through
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 8) add 500 ul wash solution and centrifuge for 1 min , discard flow through(repeat this step)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 9) centrifuge for 1 min to remove left over liquid
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10) transfer the column on a 1.5ml tube
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 11) add 50ul of elution buffer and incubate for 2 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 12) centrifuge for 2 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 13) Nanodrop the concentration and freeze at -20°
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pT.002: 53.9ng/ul -> redo with more liquid culture, it is only a low copy plasmid
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pT.003: 53.8ng/ul -> redo with more liquid culture, it is only a low copy plasmid
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pT.007: 214ng/ul
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Friday_19th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>19<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <dl>
| |
| - | <dt><b>Conjugation results :</b></dt>
| |
| - | <dd>Controls => no colonies</dd>
| |
| - | <dd>Mix = <i>tapis</i> </dd>
| |
| - | </dl>
| |
| - | Ie worked really well.<br />
| |
| - | To be sure to start only with one clone => restreak some colonies on tet/spec plates<br />
| |
| - | <br />
| |
| - | <dl>
| |
| - | <dt><b>Transformation by electroporation : goal = get a<i> phage factory</i></b>.</dt>
| |
| - | <dt>We do it three different ways in order to see which one works (best). </dt>
| |
| - | <dd>Transform strain containing helper plasmid with phagemid</dd>
| |
| - | <dd>Transform strain containing helper plasmid with phagemid</dd>
| |
| - | <dd>Co Transform strain with both plasmids at the same time</dd>
| |
| - | </dl><br />
| |
| - | <dl>
| |
| - | <dt><b>From strain sT004, sT005, sT006</b></dt>
| |
| - | <dd>Transform sT004 with pT006</dd>
| |
| - | <dd>Transform sT005 with pT005</dd>
| |
| - | <dd>Co Transform sT006 with pT005 and pT006</dd>
| |
| - | <br />
| |
| - | <b>Tubes :</b>
| |
| - | <ol>
| |
| - | <li>sM13KO7 (control) : 5,60
| |
| - | <li>sM13KO7 + pLitmus : 5,70
| |
| - | <li>sM13KO7 + pLitmus : 5,70
| |
| - | <li>sLITMUS (control) : 5,60
| |
| - | <li>sLITMUS + pM13K07 : 5,60
| |
| - | <li>sLITMUS + pM13K07 : 5,60
| |
| - | <li>MG16165 : control = 5.70
| |
| - | <li>MG16165 + p (M13K07) and p(LITMUS) = 5.60
| |
| - | <li>MG16165 + p (M13K07) and p(LITMUS)= 5.60
| |
| - | </ol>
| |
| - | <br />
| |
| - | Recovery 2h<br />
| |
| - | <br />
| |
| - | Plate everything on Kan/ Amp<br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Saturday_20th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>20<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <b>Results of transformation</b><br />
| |
| - | <ul>
| |
| - | <li>Controls : no colonies
| |
| - | <li>Colonies on plates : every transformation worked
| |
| - | </ul>
| |
| - | <br />
| |
| - | Put plates of conjugation and transformation in the fridge.<br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Monday_22nd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>22<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | Check Colonies of transformation under iLumina tools: colonies are fluorescent.<br />
| |
| - | <br />
| |
| - | Launch culture.<br />
| |
| - | <br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Tuesday_23rd_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>23<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <b>Infectiveness characterization experiments</b><br />
| |
| - | <ul>
| |
| - | <li>The night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
| |
| - | <li>Centrifugate phagemid producing cells
| |
| - | <li>Filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
| |
| - | <li>Dilute 200x MGZ1, F+ from O/N
| |
| - | <li>Wait until OD600 = 0.7
| |
| - | <li>Immediately mix MGZ1 and the supernatant in different proportions
| |
| - | <br />
| |
| - | <br />
| |
| - | </ul>
| |
| - | Here we tried 1/1 (vol supernatant/vol cells), 1/10 and 1/100
| |
| - | <ul>Immediately dilute each of them to 10-3, 10-4, 10-5, 10-6
| |
| - | <li>Plate 100uL of those dilutions on LB-agar, AMP, KAN, AMP+KAN
| |
| - | <li>Incubate O/N
| |
| - | <li>Count colonies
| |
| - | <li>Interpretation:
| |
| - | Colonies on AMP: infected by litmus28i<br />
| |
| - | Colonies on KAN: infected by M13K07<br />
| |
| - | Colonies on AMP+KAN: coinfected by litmus28i and M13K07 phagemid producing cells<br />
| |
| - | </ul>
| |
| - | <p>Results</p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/a/a5/Table.png">
| |
| - | <br />
| |
| - | Conclusions:
| |
| - | <ul>
| |
| - | <li>Cells that were mixed with 1/1 supernatant didn't survive the excess of antibiotics that were present in the supernatant.
| |
| - | <li>Even at low ratio like 1/100 the infection rate of litmus28i-GFP is about 100%. GFP detection confirmed this result: almost 100% of cells were fluorescent.
| |
| - | <li>Co-infection did occur. It would be interesting to test if those colonies are indeed producing phages.
| |
| - | </ul>
| |
| - | <br />
| |
| - | <br />
| |
| - | Start O/N culture of M13K07
| |
| - | Start O/N culture of MGZ1,F+
| |
| - | <br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_24th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>24<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | Glycerol stock:
| |
| - | <ul>
| |
| - | <li>sT008: MGZ1, F+
| |
| - | <li>sT009: XL1-Blue Litmus28i
| |
| - | </ul>
| |
| - | <br />
| |
| - | <b>Infectiveness characterization experiments</b><br />
| |
| - | <ul>
| |
| - | <li>Dilute 1/100 MGZ1, F+ O/N culture in 5mL LB => wait OD(600) = 0.7
| |
| - | <li>Centrifuge M13K07 4000rpm, 10 minutes
| |
| - | <li>Retrieve surnageant and filter it with 0.2 filter
| |
| - | </ul>
| |
| - | <ul>
| |
| - | <li>Once OD 0.7 is reached, make 4 tubes
| |
| - | <ol>
| |
| - | <li> 1mL MGZ1,F+ + 100ul LB (not done, not enough cells left ofter OD test)
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | </ol>
| |
| - | <li>Incube 37°C for 45 minutes
| |
| - | <li>Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
| |
| - | <ul>
| |
| - | <li>4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
| |
| - | </ul>
| |
| - | <li>Plate on LB (10^-6), Kan(10^-2 and 10^-3), Amp(10^-6), Kan and Amp(10^-2 and 10^-3)
| |
| - | </ul>
| |
| - | <br />
| |
| - | Experiment fail due to manipulation error (wrong dilution of the supernageant and plating of wrong dilutions)
| |
| - | <br />
| |
| - | <br />
| |
| - | Start O/N culture of MGZ1,F+ (T008) + Tet 1/500<br />
| |
| - | Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000<br />
| |
| - | <br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_25th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>25<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | O/N culture of T007 didn't grow (100 ul instead of 10ul of antibiotics, Kan and Amp)<br />
| |
| - | Start O/N culture of MGZ1,F+ (T008) + Tet 1/500<br />
| |
| - | Start O/N culture of M13K07 (T007) + Amp and Kan 1/1000<br />
| |
| - | <br />
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Friday_26th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>26<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <br />
| |
| - | <b>Infectiveness characterization experiments</b><br />
| |
| - | <ul>
| |
| - | <li>Dilute 1/100 MGZ1, F+ O/N culture in 10mL LB => wait OD(600) = 0.7
| |
| - | <li>Centrifuge M13K07 4000rpm, 10 minutes
| |
| - | <li>Retrieve surnageant and filter it with 0.2 filter
| |
| - | </ul>
| |
| - | <ul>
| |
| - | <li>Once OD 0.7 is reached, make 4 tubes
| |
| - | <ol>
| |
| - | <li> 1mL MGZ1,F+ + 100ul LB
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | <li> 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | </ol>
| |
| - | <li>Incube 37°C for 45 minutes
| |
| - | <li>Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
| |
| - | <ul>
| |
| - | <li>4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
| |
| - | </ul>
| |
| - | </ul>
| |
| - | <li>Plate on LB (10^-6), Kan(10^-2), Amp(10^-6), Kan and Amp(10^-3)
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Tuesday_30th_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>Tuesday 30<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - |
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | Transformed the bl21 (DE3) strain with the pET21b (plated the transformation culture on 2 amp plates).
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_31st_July.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>31<sup>th</sup> July</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent and Aude</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Conjugation MGZ1, F+ & MG1655:</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol :
| |
| - | </p>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | From O/N cultures Dilute both strains 1/100 , in LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Wait for OD to reach O,2
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Prepare 4 tubes (in BD tubes) :
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 = 0,5mL LB with Strain 1 (Here MGZ1) + O,5mL LB = control
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 = 0,5mL LB with Strain 2 (here sT004) + 0,5mL LB = control
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 and 4= 0,5mL LB with Strain 1 (Here MGZ1) + 0,5mL LB with Strain 2 (here sT004
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <ol start="4">
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Incubate 2 hours at 37°C
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Plate 50ul for controls, 50uL, 20ul, 10ul for mixed tubes on LB antiobiotics (here tet and spec)
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Incubate overnight at 37°C
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Infectiveness characterization experiments</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -centrifugate phagemid producing cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -dilute 200x MGZ1, F+ from O/N
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -wait until OD600 = 0.7
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -immediately mix MGZ1 and the supernatant in different proportions
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Unfortunately the supernatant was dropped on the bench.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_1st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>1<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Aude & Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Cloning Kanamycin resistance gene into pACYCDuet-1:</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -PCR of Kanamycin resistance gene from pCOLADuet-1 with primer iT.0003 and iT.0004
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -electrophoresis of PCR product: 1 band between 900 and 1000bp: coherent with KanR length
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/4/4c/ParisB2013TH_1_08.jpg" width="200" height="300">
| |
| - | <p lang="en-US">
| |
| - | -cutting KanR bands:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -digestion with ECOR1 and Xho1:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR product digest for cloning
| |
| - | </p>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified PCR Product
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 16 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 20.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | Digest for 0.5 - 1 hours at 37 °C with shaking.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -digestion of pACYCDuet-1 with ECOR1 and Xho1:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector backbone digest for cloning<strong> </strong>
| |
| - | </p>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified Plasmid
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 20 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 65 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastAP Phosphatase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 100.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | Digest for 2 - 4 hours at 37 °C with shaking.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -electrophoresis of pACYCDuet-1 digestion products:
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/3/36/ParisB3013TH_1_08_3.jpg" width="200" height="250">
| |
| - | <p lang="en-US">
| |
| - | column 1: 1kb plus marker
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | column 2 & 3: digestion product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | column 4: undigested pACYCDuet-1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | nothing appear on gel after digestion, therefore we will miniprep pACYCDuet-1 and try again to digest it.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Monday_12th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>12<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | Clovis
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Start 2 cultures of MG1655 pACYCDuet-1 strain (ST003), 5mL each for further miniprep
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Phusion PCR of lacZalpha out of pUC18 (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | with primers :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | iT.0001 (Fw, added NcoI cut site) CCATGGCTGGCTTAACTATGCGG
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | iT.0002 (Rv, added BglII cutsite) AGATCTGTGAGTTAGCTCACTCATTAGG
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/7a/ParisB2013TH_12_08.jpg" width="200" height="250">
| |
| - | <p lang="en-US">
| |
| - | Column 1; 100kb plus ladder
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Column 2,3,4,5,6; PCR product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Gel purification of column 5 and 6 → 19,2 ng/ul
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Tuesday_13th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>13<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | Clovis
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of the PCR product (LacZalpha) with NcoI and BglII
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR purification using Thermo Scintific Kit of the digestion → 6,2 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Miniprep of pACYADuet-1 (pT002) using Thermo Scientific Kit → 132,7 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Start O/N sT005 and sT010
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006 </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Gradient of 8 tubes +-5°C around 54°C for both PCRs (pUC18 and Litmus18i-GFP)
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/e7/ParisB2013TH_13_08.jpg" width="400" height="250">
| |
| - | <p lang="en-US">
| |
| - | Failure, no bands appear on the gel.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Infectiveness characterization experiments</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -centrifugate phagemid producing cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -dilute 200x MGZ1, F+ from O/N
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -wait until OD600 = 0.7
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -immediately mix MGZ1 and the supernatant in different proportions
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000
| |
| - | </p>
| |
| - | <ul>
| |
| - | </ul>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul surnageant diluted 1/1000
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <p lang="en-US">
| |
| - | -incubate 45 minutes at 37°C for the protein to be expressed.
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
| |
| - | </p>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 4 times 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Plate on LB (10^-6), Kan( 10^-3), Amp(10^-5 - 10^-6), Kan and Amp(10^-2 - 10^-3)
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Wednesday_14th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>14<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>PCR of pUC18 (pT007) with iT0007 & iT0008 / PCR of litmus28i-GFP (pT005) with iT0005 & iT0006 (Aude):</strong>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/cb/ParisB2013TH_14_08.jpg" width="400" height="250">
| |
| - | <p lang="en-US">
| |
| - | <strong>Gel Purif (Aude)</strong>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/cc/ParisB2013TH_14_08_2.jpg" width="400" height="250">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/2/2c/ParisB2013TH_14_08_3.jpg" width="400" height="250">
| |
| - | <p lang="en-US">
| |
| - | Using QiaGen Kit
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 tubes (combined the band)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 : 13,2 ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 : 14 ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 : 2O ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Digestions (</strong>
| |
| - | <em><strong>Aude</strong></em>
| |
| - | <strong>)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)
| |
| - | </p>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified Plasmid
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 75 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Green Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | EcoRI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | XhoI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastAP Phosphatase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 100.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)
| |
| - | </p>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified Plasmid
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 15 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 75 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Green Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | EcoRI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | XhoI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastAP Phosphatase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 100.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | => 2h30 à 37°C
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Run on a a gel.
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/64/ParisB2013TH_14_08_4.jpg" width="250" height="200">
| |
| - | <p lang="en-US">
| |
| - | only see a smear, Everything was digested ,
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | redigest but just 25 minutes as said on the thermoscientific protoc.
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <strong>Digestions (</strong>
| |
| - | <em><strong>CLovis</strong></em>
| |
| - | <strong>)</strong>
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Digestion pACY par Xho EcoRI (pour le clonage de Kan dans ACY)
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified Plasmid
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 75 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Green Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | EcoRI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | XhoI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastAP Phosphatase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 100.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Digestion pACY par NcoI BgIII (pour le clonage de lacZalpha dans ACY)
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified Plasmid
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 15 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 75 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Green Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 10 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | EcoRI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | XhoI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2.5 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastAP Phosphatase
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 100.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | <strong>25 minutes at 37°C</strong>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d4/ParisB2013TH_14_08_5.jpg" width="200" height="250">
| |
| - | <p lang="en-US">
| |
| - | It worked!
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Gel purification (Clovis)</strong>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f7/ParisB2013TH_14_08_6.jpg" width="200" height="250">
| |
| - | <p lang="en-US">
| |
| - | ACY Nco Dig : 6,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | ACY Xho Dig : 7,8 ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Gradient of 8 tubes +10°C around 54°C for both PCRs (Litmus18i-GFP) but start not from the miniprep ut from a fresh culture of litmus GFp
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/53/ParisB2013TH_14_08_7.jpg" width="200" height="250">
| |
| - | <p lang="en-US">
| |
| - | Only see the primer => try again with new miniprep
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_15th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>15<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Miniprep (Clovis)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pACY (pT002) : 109ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmus (pT005) : 610 ng/Ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Ligation (Aude, Clovis ,Vincent)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | CHosen Vector mass = 50 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <u>lacZ : </u>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 6,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*449/3770*50 = 59 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Kan : </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 7,8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 12ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert mass = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocole Ligation
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 11 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Transformation : (in chemical competent NEB turbo (made on the …) </strong>
| |
| - | <em>Aude Clovis</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1) Thaw competent cells on ice.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | These can be prepared using the CaCl2 protocol.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) Add 5 ul of ligation product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Mix gently by flicking the tube.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Chill on ice for 30 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Heat shock at 42 °C for 30 seconds.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Return to ice for 2 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7) Plate on selective media
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate on :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 : ligation Kan-pACY (5uL) Kan Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>PCR (litmus = Backbone) Vincent</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 8 tubes, gradient 10°C around 64°C , started from a new miniprep
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | We see the plasmid => too concentrated
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>PCR (litmus pour la gibbson) Clovis</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sTOO5 primer 005 006 protocol phusion (gradient around 64 + or – 5 °C)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Elongaiton time 2min10. Started with the new miniprep diluted.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Infectiveness characterization experiments (Vincent)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | After checking GFP fluorescence of sT007 and its negative result, we decided to make a new sT007 glycerol stock. We used a colony from the first successful
| |
| - | Infectiveness characterization experiments that was both AMP+KAN resistant and expressed GFP.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | The following experiment was conducted with this new sT007 (strain MGZ1).
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -centrifugate phagemid producing cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -This experiment was conducted both on MGZ1(F+) and MG1655(F+)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -dilute 200x MGZ1 and MG1655 from O/N
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -wait until OD600 = 0.7
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -immediately mix MGZ1 and the supernatant in different proportions
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | here we planned to try 1/10 (vol supernatant/vol cells)
| |
| - | </p>
| |
| - | <ul>
| |
| - | </ul>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MGZ1,F+ + 100ul surnageant diluted 1/100
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <p lang="en-US">
| |
| - | -incubate 45 minutes at 37°C for the protein to be expressed.
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5, 10^-6
| |
| - | </p>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 6 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | Plate on LB (10^-4 10^-5 10^-6), Kan(10^-1 10^-2 10^-3), Amp(10^-4 10^-5 - 10^-6), Kan and Amp(10^-1 10^-2 - 10^-3)
| |
| - | <br/>
| |
| - | <br/>
| |
| - | <br/>
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Friday_16th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>16<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Results from Infectiveness characterization experiments (Vincent)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - |  See file “phage infectivness 15_08.xlsx”
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Results</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Transformations : (Aude)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Lac : “tapis” on all the plates even the negative control => plates were not done correctly, antibio added to early => do another
| |
| - | transformation
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Kan : Some colonies on the plates , but also colonies on the negative control => launch few colonies on liquid media (with Kan, Cm)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Phage infectiveness : (Vincent)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Run PCR</strong>
| |
| - | (Litmus-Gibbson) (Aude)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Small point around 3000-3500bp
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Run another gel with large holes to check if it is correct and purify => Not correct, nothing on the new gel
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Transformation : (in chemical competent NEB turbo )</strong>
| |
| - | <em>Aude Clovis</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Rest of ligation product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1) Thaw competent cells on ice.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | These can be prepared using the CaCl2 protocol.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) Add 5 ul of ligation product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Mix gently by flicking the tube.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Chill on ice for 30 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Heat shock at 42 °C for 30 seconds.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Return to ice for 2 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7) Plate on selective media
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate on :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 : ligation lacZ-pacy (5uL) Xgal /IPTG /Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 : ligation Kan-pACY (5uL) Kan Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Gel from PCR litmus (Clovis)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1kB ladder / triple puit (3*50uL) from column 2,3,4 of PCR
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50V
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/e9/ParisB2013TH_618.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | <strong>Infectiveness characterization experiments (Aude)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -the night before: prepare O/N of F+ cells, prepare O/N of phagemid producing cells (in this case : sT007 )
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -centrifugate phagemid producing cells
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -filter the supernatant 0.45um, stock it at 4°C (it contains the phages)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -dilute 200x MG, F+ from O/N
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -wait until OD600 = 0.7
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -immediately mix MG and the supernatant in different proportions
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | here we planned to try 1/100 (vol supernatant/vol cells), 1/1000 and 1/10000
| |
| - | </p>
| |
| - | <ul>
| |
| - | </ul>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MG,F+ + 100ul LB
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MG,F+ + 100ul surnageant diluted 1/10
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MG,F+ + 100ul surnageant diluted 1/100
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MG,F+ + 100ul surnageant diluted 1/1000
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 1mL MG,F+ + 100ul surnageant diluted 1/10000
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | <p lang="en-US">
| |
| - | -incubate 45 minutes at 37°C for the protein to be expressed.
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Serial dilute the tubes 10^-1, 10^-2, 10^-3, 10^-4, 10^-5
| |
| - | </p>
| |
| - | <ol>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | 4 times 5 tubes with 900uL LB, add 100ul of one previously made tube, mix and transfert 100ul to next tube.
| |
| - | </p>
| |
| - | </li>
| |
| - | </ol>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | Plate on LB (10^-5), Kan( 10^-2), Amp(10^-5), Kan and Amp(10^-2)
| |
| - | <br/>
| |
| - | <br/>
| |
| - | <br/>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Ligation (Vincent)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = ration (svt 10) * (taille insert / taille vecteur) * masse vecteur (50-100ng)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | CHosen Vector mass = 50 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <u>lacZ : </u>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 6,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*449/3770*50 = 59 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Kan : </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 7,8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 12ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert mass = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocole Ligation
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 11 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Transformation : (in chemical competent NEB turbo (made on the …) </strong>
| |
| - | <em>vincent</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1) Thaw competent cells on ice.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | These can be prepared using the CaCl2 protocol.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2) Add 5 ul of ligation product
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Mix gently by flicking the tube.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Chill on ice for 30 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4) Heat shock at 42 °C for 30 seconds.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5) Return to ice for 2 minutes.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 6) Add 300 ul LB medium and recover the cells by shaking at 37 °C for one hour
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7) Plate on selective media
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate on :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 : negative control Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 : ligation lacZ-pacy (10uL) Xgal /IPTG /Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 : ligation Kan-pACY (10uL) Kan Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 4 : native plasmid (pACY) (1uL) Xgal /IPTG /Cm ; Kan/Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR pUC18 (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 34 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 FW iT007
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 RV iT008
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 55°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 2min10
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/2/29/ParisB2013TH_619.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | no bands
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Litmus (Clovis):
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Trouble shooting : since the temperature does not help, that it was not the mini prer = but that we see homodimere between the primers => try with less
| |
| - | primers
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR litmus (pT005)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 40 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 FW iT005
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 RV iT006
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 64°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 2min10
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/7a/ParisB2013TH_620.JPG" width="200" height="200">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/e/e2/ParisB2013TH_621.JPG" width="200" height="200">
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Saturday_17th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>17<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Results</strong>
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Phage infectiveness : Experiment worked => results here
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <strong>Repcr inserts / redigest vector</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR KanR out of pCOLA (pT003)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 34 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 FW iT003
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 RV iT004
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pCOLA
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 54°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 45sec
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR LacZ out of pUC18 (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 34 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 FW iT001
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 RV iT002
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 54°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 45sec
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Gel of PCR Kan and LacZ
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5 puits LacZ / 100bP+ / 5 puits Kan
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d4/ParisB2013TH_622.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | <strong>Preparaiton of the vectors to clone the sRNA</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR litmus (pT005)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 40 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 FW iT003
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 RV iT004
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pCOLA (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 64°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 2min10
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Results</strong>
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Transformation worked but no clone with the ligation product =>restart from the beginning, problem must be with one of the digested products.
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | Phage infectiveness : Experiment worked => results here
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | <strong>Repcr inserts / redigest vector</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR KanR out of pCOLA (pT003)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 34 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 FW iT003
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 RV iT004
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pCOLA
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 54°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 45sec
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR LacZ out of pUC18 (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 34 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 FW iT001
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2.5 RV iT002
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 54°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 45sec
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Gel of PCR Kan and LacZ
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5 puits LacZ / 100bP+ / 5 puits Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -->img 622<--
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Preparaiton of the vectors to clone the sRNA</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR litmus (pT005)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 5*50ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 40 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 FW iT003
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 RV iT004
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 pCOLA (pT007)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 50ul Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tm = 64°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | te = 2min10
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - |
| |
| - | <html><div id="sabotage_Monday_19th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>19<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <p lang="en-US">
| |
| - | <strong>CLONING the target Plasmids (Kan and lacZ)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of LacZ using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | lacZ : 83 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of Kan using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Kan : 80ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of pACYC (pT002) with EcoRI and XhoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 pACYC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 EcoRI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 XhoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of pACYC (pT002) with BglII and NcoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 pACYC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 BglII
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 NcoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Kan insert with EcorI and XhoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 Kan insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 EcoRI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 XhoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of LacZ insert with BglII and NcoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 LacZ insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 BglII
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 NcoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel of digestions</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/5f/ParisB2013TH_625.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | <em>Colum purification of Kan insert digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Column purification of LacZ insert digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Colum purification of pACYC digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Heat inactivation of Kan digestion</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 65°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6.8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 14
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7.35 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6.8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 40/2 = 20
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7.35 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 7 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 4 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 10? ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 33
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*449/3770*50 = 59 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 1.8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 11 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Chemical transformation in NEB turbo</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Reference protocol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Recovery 1 hour.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate on
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 = negative control
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 : Kan (purif) Kan / Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 : Kan (heat inactivated) Kan/ Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Cloning the Weapon (ie sRNA into Litmus and pUC 18)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel of litmus PCR</em>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/6e/ParisB2013TH_624.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of litmus PCR using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>PCR from mini Gene sRNA anti Kan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 35 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 FW iT009
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 RV iT0010
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 minigene-plasmid amp from IDT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Phusion Gradient around 53 °C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Time : 30 secondes
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Gibson Assembly</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop =
| |
| - | 26,7)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene
| |
| - | (nanodrop = 26,7)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Regular cloning using biobricks</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert sRNA cut by XbaI & PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector Litmus cut by PstI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert sRNA cut by EcoRI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector Litmus cut by EcoRI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Vectors</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 Vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Enz 1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Enz 2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Inserts</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 Enz 1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 Enz 2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Heat inactivation before ligation
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 80°C for 20 minutes
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pUC= 40ng in 20 uL => 3ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmus 340ng =>17ng /ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | insert 420 ng => 14 ng / uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <u>Litmus : </u>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7uL vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 8 ul insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 uL Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | O,2 uLT4 DNA ligase
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3ul Water
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vtot = 20 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pUC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20 uL vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 9 uL insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 uL Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0,4 T4 DNA
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7 uL water
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vtot = 40uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Chemical transformation in NEB turbo</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 : negative control
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 lig litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 lig pUC
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | plate everything on amp
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Tuesday_20th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>20<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>CLONING the target Plasmids (Kan and lacZ)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of LacZ using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | lacZ : 83 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of Kan using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Kan : 80ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of pACYC (pT002) with EcoRI and XhoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 pACYC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 EcoRI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 XhoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of pACYC (pT002) with BglII and NcoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 pACYC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 BglII
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 NcoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Kan insert with EcorI and XhoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 Kan insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 EcoRI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 XhoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of LacZ insert with BglII and NcoI</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 LacZ insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 BglII
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 NcoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel of digestions</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 100Bp+ / pACYC+EcoRI+XhoI / pACYC+EcoRI+XhoI / pACYC+BglII+NcoI /pACYC+BglII+NcoI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/5f/ParisB2013TH_625.JPG" width="200" height="200">
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Colum purification of Kan insert digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Column purification of LacZ insert digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Colum purification of pACYC digestions using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Heat inactivation of Kan digestion</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 65°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation Kan insert purif + pACYC (digestion EcoRI + XhoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6.8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 14
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7.35 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation Kan insert heat desactivated + pACYC (digestion EcoRI + XhoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 6.8 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 40/2 = 20
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*1052/3770*50 = 140 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 7.35 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 7 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 4 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation LacZ insert purif + pACYC (pigestion BglII + NcoI)</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 10? ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 33
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*449/3770*50 = 59 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 1.8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 0,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 11 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Chemical transformation in NEB turbo</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Reference protocol
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Recovery 1 hour.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate on
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 = negative control
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 : Kan (purif) Kan / Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 : Kan (heat inactivated) Kan/ Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 4 : lac(purify, enzyme cannot be heat inactivated) Cm/ IPTG/ Xgal
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Cloning the Weapon (ie sRNA into Litmus and pUC 18)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Gel of litmus PCR</em>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/6/6e/ParisB2013TH_624.JPG" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | <em>Gel purification of litmus PCR using Thermo Scientific Kit</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>PCR from mini Gene sRNA anti Kan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 35 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 FW iT009
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 RV iT0010
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 minigene-plasmid amp from IDT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Phusion Gradient around 53 °C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Time : 30 secondes
| |
| - | </p>
| |
| - |
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Gibson Assembly</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Protocol from the Kit, quantities are divided by 2: final volume of reaction = 10uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Assembly of pUC18-SRNA_KAN : 5uL MasterMix, 0.5uL H2O, 3uL pUC18 with overhang from PCR (nanodrop = 13,4), 1,5uL sRNA from PCR of minigene (nanodrop =
| |
| - | 26,7)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Assembly of Litmus28i-GFP-SRNA_KAN : 5uL MasterMix, 3,6uL H2O, 0,5uL Litmus28i-GFP with overhang from PCR (nanodrop = 85), 0,9uL sRNA from PCR of minigene
| |
| - | (nanodrop = 26,7)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Heat shock Transformation into provided competent cells. 60 min recovery, plate on AMP.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Regular cloning using biobricks</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert sRNA cut by XbaI & PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector Litmus cut by PstI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert sRNA cut by EcoRI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector Litmus cut by EcoRI & SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Vectors</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 Vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Enz 1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Enz 2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Digestion of Inserts</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 Enz 1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 Enz 2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Heat inactivation before ligation
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 80°C for 20 minutes
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Ligation</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pUC= 40ng in 20 uL => 3ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmus 340ng =>17ng /ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | insert 420 ng => 14 ng / uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <u>Litmus : </u>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7uL vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 8 ul insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 uL Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | O,2 uLT4 DNA ligase
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3ul Water
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vtot = 20 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | pUC
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20 uL vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 9 uL insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 4 uL Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0,4 T4 DNA
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 7 uL water
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vtot = 40uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Chemical transformation in NEB turbo</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 1 : negative control
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 2 lig litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Tube 3 lig pUC
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | plate everything on amp
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_21st_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>21<sup>st</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Results of assemblies</strong>
| |
| - | (Colonies on the transformation plates):
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA –Kan into Litmus by Gibson: Success
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA – Kan into Litmus by biobrick assembly: Success
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA – Kan into pUC18 by Gibson: Failure
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA – Kan into pUC18 by biobrick assembly: Success
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Colony PCR to check if sRNA-KAN is in our Litmus phagemid: positive band between 400 and 500: (expected length 419bp)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Check the design of primers to clone out Kan => problem => redesign them
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Design of the primers to sequence all the cloning
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Launch 3 colonies of each successful cloning
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Glycerol and mini prep of all the launched colonies / need 3 before we have</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Construction of target strain</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Electroporation of pCOLA in MGZ1 F+
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Construction of weapon strains</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Electroporation of litmus-GFP-sRNA in XL1 Blue-M13KO7-Helper
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Electroporation of Litmus-GFP-sRNA and M13K07 in MGZ1 F+
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Chemical transformation of minigene+vector-sRNA anti Kan in NEB turbo</strong>
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Thursday_22nd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>22<sup>nd</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Results : </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | All the transformation worked
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Launch cultures (to do experiment)
| |
| - | </p>
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | mGZ1 F+ -Cola
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | MGZ1 F+ litmus + Helper
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <p lang="en-US">
| |
| - | Launch overnigh culture to do glycerols.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>exploring the parameters in play in the phage infectiveness of our new phagemid construct </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -mix with 1/10 vol of supernatant containing phagemids with the cells with the following combination of parameters:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | OD600 : 0.3 0.6 0.9
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate at different time (min) after first contact with the supernatant: 2, 30, 60
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Silencing experiments</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 : 4 tubes : Ctrl, P1, P2 ,P3. Put 1 mL of cells in each tube. Centrifuge. Take out supernatant, resuspend in 1mL of LB. Add in tubes
| |
| - | respectively : nothing, 100uL phages of Miniprep 1, Miniprep 2, miniprep 3.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 45 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 dilutions on Kan and LB and 100 ul of 10-2 and 10-3 dilution on Kan.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Friday_23rd_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>23<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | Results: failure: as much GFP+ colonies growing on Kan than on LB
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>PCR from mini Gene sRNA anti Cm</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 35 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 FW iT009
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 RV iT0010
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 minigene-plasmid amp from IDT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Phusion Gradient around 53 °C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Time : 30 secondes
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/9/93/ParisB2013TH_IMG-PCR_sRNA_Cm_.jpg" width="200" height="200">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/76/ParisB2013TH_IMG-Cut_sRNA_Cm.jpg" width="200" height="200">
| |
| - |
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Monday_26th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>26<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | Digestion of litmus miniprep (C=280ng/uL)with PstI and SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 13 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 litmus miniprep
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of sRNA_Cm insert (C=31ng/uL) with XbaI and PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 sRNA_Cm insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 XbaI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR purification of litmus digestion using Thermo Scientific Kit
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA_Cm insert purif + litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 13,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 10
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*376/3626*50 = 52 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3.8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 5.2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation control litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3.8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 0 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 13,2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of pUC18 PCR (C=13ng/uL) with EcorI and SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 pUC18 PCR
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 EcorI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of sRNA_Cm insert (C=31ng/uL) with SpeI and EcorI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 sRNA_Cm insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 EcorI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR purification of pUC18 digestion using Thermo Scientific Kit
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR purification of sRNA_Cm insert digestion using Thermo Scientific Kit
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA_Cm insert purif + pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 4,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 9,4
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*362/2175*50 = 83 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 11,6 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 8,8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 7,1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation control pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 11,6 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 0 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 15,9 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo only (control -)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo of ligation control litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo of ligation sRNA_Cm insert purif + pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo of ligation control pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Chemical transformation in NEB-Turbo of litmus (control +)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plate all 5 on Amp
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>PCR from mini Gene sRNA anti LacZ</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 35 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 Buffer 5x
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 dNTP
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 FW iT009
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 2 RV iT0010
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.2 minigene-plasmid amp from IDT
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 0.5 phusion
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | PCR Phusion Gradient around 53 °C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Time : 30 secondes
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/70/ParisB2013TH_IMG-PCR_sRNA_LacZ.jpg" width="200" height="200">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/5/56/ParisB2013TH_IMG-Cut_sRNA_LacZ.jpg" width="200" height="200">
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Tuesday_27th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>27<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Building anti LacZ weapons:</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Gibson assembly of litmus (sT005) and sRNA_LacZ</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 56 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 9,6
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 5*376/3626*50 = 26 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Master Mix : 5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Heat shock following Gibson assembly kit protocole.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Biobrick assembly</strong>
| |
| - | <strong>of sRNA_LacZ in litmus-GFP and pUC18</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Using digested vectors (litmus-GFP and pUC18) from 26/08
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of sRNA_LacZ insert (C=48ng/uL) with XbaI and PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 sRNA_LacZ insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 PstI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 XbaI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion of sRNA_LacZ insert (C=45ng/uL) with SpeI and EcorI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 10 H2O
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 15 sRNA_LacZ insert
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 3 Buffer
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 EcorI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 1 SpeI
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 30uL Tot
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | 20min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Purification on column
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | ligation:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA_LacZ insert purif + pUC18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 4,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 18
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*362/2175*50 = 83 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 11,6 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 4,6 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 11 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA_LacZ insert purif + litmus
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion vector : 13,3 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Digestion insert : 11,4
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*376/3626*50 = 52 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3.8 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 4,56 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 8,64 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Preparing experiments of LacZ silencing</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Plating MGZ1, F+ ; MG1655, F+ ; NEB Turbo on IPTG+Xgal
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_28th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>28<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f3/ParisB2013TH_28_08.jpg" width="200" height="200">
| |
| - | <p lang="en-US">
| |
| - | as expected MGZ1 and MG1655 turn blue.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Result from assemblies:</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Gibson sRNA LacZ in litmus-GFP: failure
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Biobrick assembly sRNA LacZ in Litmus-GFP : success
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Biobrick assembly sRNA LacZ in pUC18 : success
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Miniprep of Litmus-GFP-sRNACm ,Litmus-GFP-sRNALacZ, pUC18-sRNACm , pUC18-sRNALacZ</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>
| |
| - | Building phagemid weapon producing cells: Transformation of electrocompetent MGZ1, F+ with M13K07 + Litmus-GFP-sRNALacZ / Litmus-GFP-sRNACm
| |
| - | </strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Transforming:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -1) negative control : 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -2) IDT plasmid with sRNALacZ ( should form white colonies of MGZ1 on Xgal+IPTG):5,1
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -3) Litmus-GFP-sRNALacZ1 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -4) Litmus-GFP-sRNALacZ3 ( should form white colonies of MGZ1 on Xgal+IPTG): 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -5) Litmus-GFP-sRNACm1 (control XGal ) : 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -6) Litmus-GFP-sRNACm1 + M13K07: 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -7) Litmus-GFP-sRNACm2 + M13K07 : 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -8) Litmus-GFP-sRNACm3 + M13K07: 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -9) Litmus-GFP-sRNALacZ1 + M13K07 : 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -10) Litmus-GFP-sRNALacZ3 + M13K07: 5,2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | plate on AMP+IPTG+Xgal ( silencing of LacZ on MGZ1 strain) and KAN+AMP (phage factories cells)
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_29th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>29<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | silencing of LacZ failed on MGZ1: the sequence of LacZ might have mutation compared to MG1655 for which the sRNA was designed or the test is not
| |
| - | quantitative enough (one sRNA => several proteins). Try to find a way to get quantitative data about the silencing => Miller Assay
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Friday_30th_August.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>30<sup>th</sup> August</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | attempt to silence LacZ on MG1655, F+ with litmusGFP-LacZ1 & litmusGFP-LacZ2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | XXXXX
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Silencing experiments (LacZ)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 : 5 tubes. Put 1 mL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2,
| |
| - | litmusGFP-Cm1 & litmusGFP-Cm2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmusGFP-Cm1 & litmusGFP-Cm2 are used as negative control.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 45 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate for each tube 100ul of 10-5 and 10-3 dilutions on IPTG+Xgal and LB and 100uL on AMP+IPTG+Xgal and LB.
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Tuesday_3rd_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>3<sup>rd</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Silencing experiments (Cm)</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1 & litmusGFP-LacZ2,
| |
| - | litmusGFP-Cm1 & litmusGFP-Cm2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 45 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table
| |
| - | </p>
| |
| - | <table width="500" cellpadding="5" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | LB
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 25 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 250ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 500 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA anti lacz
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Wednesday_4th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>4<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | <img src="https://static.igem.org/mediawiki/2013/4/45/ParisB2013TH_4_09.png" width="600" height="100">
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p><b>Results of silencing experiments</b></p>
| |
| - |
| |
| - | <p>It works !</b>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Miller assay</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>XXXXXX</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Redo the silencing experiment</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 : 5 tubes. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 &
| |
| - | litmusGFP-Cm2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | litmusGFP-lacZ1 & litmusGFP-lacZ2 are used as negative control.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 45 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table
| |
| - | </p>
| |
| - | <table width="600" cellpadding="5" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | LB
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 25 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 125 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 250ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 500 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA anti lacz
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Thursday_5th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>5<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>Confirmation of silencing (CmR)</strong>
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/c/cb/ParisB2013TH_5_09.png" width="600" height="100">
| |
| - | <p lang="en-US">
| |
| - | <strong>Cloning biobricks : ie clone sRNAs (Cm, Kan, lacZ) in pB1C3</strong>
| |
| - | </p>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified PCR Product
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 16 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | FastDigest Enzyme 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 20.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | Digest for 0.5 - 1 hours at 37 °C with shaking
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA into biobrick vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/2000*100 = 210 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 2uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Transformation in NEB turbo chemical competent . Plate on Cm
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Friday_6th_September.html"</div></html>
| |
| - | <html><div id="sabotage_Saturday_7th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>7<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <strong>07/09/13</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Results Transformation</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Colonies on the different paltes (no colonies on the negative controls)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>PCR Colonies</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Primer from Phage sensor team : XXXXX
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Gel :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | XXXXX
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Tuesday_10th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>10<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Experiment Silencing Cm (try to reduce the noise, aka the variability)</strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pACYc in LB-Cm (25 ug/ul)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Cm1 & litmusGFP-Cm2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -3 replicates for each condition. Plate each Dilution 2 times to limit the variability
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Non infected cells (1,2,3)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti lacZ (1,2,3)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti CmA (1,2,3)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with antiCmB (1,2,3
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 45 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table
| |
| - | </p>
| |
| - | <table width="500" cellpadding="5" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | LB
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 25 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 250ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Cm 500 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm A 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm A 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm A 3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm B 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm B 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm B 3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-2/1
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_11th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>11<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d2/ParisB2013TH_11_09.png" width="600" height="100">
| |
| - | <p lang="en-US">
| |
| - | Results experiment Silencing
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/7b/ParisB2013TH_11_09_2.png" width="600" height="100">
| |
| - | </br>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/0/09/ParisB2013TH_11_09_3.png" width="600" height="200">
| |
| - | <img src="https://static.igem.org/mediawiki/2013/f/f4/ParisB2013TH_11_09_4.png" width="300" height="200">
| |
| - | <p lang="en-US">
| |
| - | AT a concentration of 500mg/ul, we get <strong>99,1% of killing</strong> (on 12 replicates) with a standard déviation of 1,19
| |
| - | </p>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/7/78/ParisB2013TH_11_09_5.png" width="300" height="200">
| |
| - | <ul>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | When you try to understand why are the cells surviving, it is mainly due to the non silencing of the cells
| |
| - | </p>
| |
| - | </li>
| |
| - | <li>
| |
| - | <p lang="en-US">
| |
| - | This problem can be due to the necessity of the sRNA to match to the plasmid sequence perfectly (and therefore problemsof mutations, especially on
| |
| - | phage).
| |
| - | </p>
| |
| - | </li>
| |
| - | </ul>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/4/42/ParisB2013TH_11_09_6.png" width="300" height="200">
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Saturday_14th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>14<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | Place your twit here
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Cloning two sRNA on the same phagemid</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | P009 (litmus Kan) + sRNA Cm :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | P027 (litmus Cm) + sRNA Kan :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <strong>Inserts</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA Cm : 35 ng/uL Final (16*35/20) = 28 ng/uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan : 16 ng/uL Final (16*16/20) = 12,8 ng/uL
| |
| - | </p>
| |
| - | <center>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified PCR Product
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 16 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | XbaI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Pst1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 20.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | </center>
| |
| - | <p lang="en-US">
| |
| - | <strong>Vectors</strong>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Kan : 350 ng /uL Final (3*350/20) = 52,5 75 ng/ul
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Cm : 750 ng /ul Final (2*750/20) = 75 ng/uL
| |
| - | </p>
| |
| - | <center>
| |
| - | <table width="232" cellpadding="1" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="158"/>
| |
| - | <col width="68"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Reagent</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | <strong>Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Purified PCR Product
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | H<sub>2</sub>O
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 13 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | 10x FastDigest Buffer
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 2 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | Pst1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | SpeI
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 1 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr>
| |
| - | <td width="158">
| |
| - | <p lang="en-US">
| |
| - | <strong>Total Volume</strong>
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="68">
| |
| - | <p lang="en-US">
| |
| - | 20.0 ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | </center>
| |
| - | <p lang="en-US">
| |
| - | Ligation sRNA into biobrick vector
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Kan + sRNA anti Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 4 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 10uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Cm + sRNA anti Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 5,5uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em><strong>Launch cultures : </strong></em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Glycerol of the different biobricks : sT040 ; sT041 ; sT042 sT043 ; sT044 ; sT045 ; sT046 ; sT047 on Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | MG F+ + pCola sT027 on Kan :
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | MGZ1, F+ Litmus-GFP-sRNA antiKan + M13KO7 Helper col : sT022 sT023 sT024 on Kan Amp
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Sunday_15th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>15<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Exp Silencing Kan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -2 replicates for each condition. Plate each Dilution 2 times to limit the variability
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Non infected cells (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti lacZ (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti KanA (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti KanB (1,2,)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 70 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table
| |
| - | </p>
| |
| - | <table width="500" cellpadding="5" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | LB
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 25 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 250ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 500 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan A 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan A 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan B 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan B 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <p lang="en-US">
| |
| - | <em>Miniprep biobricks</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Kan + sRNA anti Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 4 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 10uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Cm + sRNA anti Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 5,5uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Transformation in chemical competent 10G cells : plate on Amp;
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html><div id="sabotage_Wednesday_18th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>18<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | <em>Exp Silencing Kan</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Launch O/N culture of producing phages cells ; centrifuge ; take supernatant and filter it.
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -diluting 100x O/N of MGZ1, F+ -pCola in LB-Kan (25 ug/ul)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - At OD 0,7 :. Put 900 uL of cells in each tube. Add in tubes respectively : nothing, 100uL phages of litmusGFP-LacZ1, litmusGFP-Kan1 & litmusGFP-Kan2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | -2 replicates for each condition. Plate each Dilution 2 times to limit the variability
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Non infected cells (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti lacZ (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti KanA (1,2)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cells infected with anti KanB (1,2,)
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Incubate 70 minutes at 37°C
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | - Serial Dilute every tube until 10-5. Plate 100ul for each tube according to this dilution table
| |
| - | </p>
| |
| - | <table width="500" cellpadding="5" cellspacing="0">
| |
| - | <colgroup>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | <col width="90"/>
| |
| - | </colgroup>
| |
| - | <tbody>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | LB
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 25 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 250ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | Kan 500 ug/ul
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | non infected 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA lacZ 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan A 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan A 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan B 1
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | <tr valign="BOTTOM">
| |
| - | <td height="7" width="90">
| |
| - | <p lang="en-US">
| |
| - | sRNA Kan B 2
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-5/4
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-4/3
| |
| - | </p>
| |
| - | </td>
| |
| - | <td width="90">
| |
| - | <p lang="en-US">
| |
| - | 10^-3/2
| |
| - | </p>
| |
| - | </td>
| |
| - | </tr>
| |
| - | </tbody>
| |
| - | </table>
| |
| - | <img src="https://static.igem.org/mediawiki/2013/d/d3/ParisB2013TH_18_09_2.png" width="300" height="200">
| |
| - | <p lang="en-US">
| |
| - | <em>Miniprep biobricks</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Cm1 / Cm2 / Kan 1 / Kan 2 / Lac1 / Lac2
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <em>Cloning 2 sRNA on the same phage : Ligation sRNA into biobrick vector</em>
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Kan + sRNA anti Cm
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 3 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 4 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 10uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus Cm + sRNA anti Kan
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | masse insert = 10*419/4000*100 = 110 ng
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Vector : 1,5 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Insert : 10 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Buffer : 2 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | T4 DNA ligase : 1 uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | H2O : 5,5uL
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Let incubate at 22°C for 30 min
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Transformation in chemical competent 10G cells : plate on Amp;
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - | <html><div id="sabotage_Thursday_19th_September.html"</div></html>
| |
| - | <html><div id="sabotage_Friday_20th_September.html"</div></html>
| |
| - | <html>
| |
| - | <div class ="tbnote">
| |
| - | <h2>Sabotage</h2>
| |
| - | <a href="https://2013.igem.org/Team:Paris_Bettencourt/Project/Sabotage" target="_blank" class="tbnotelogo THlogo"> ASDF </a>
| |
| - | <div style="clear: both;"></div>
| |
| - | <h3>20<sup>th</sup> September</h3>
| |
| - | <p><b><em>
| |
| - | <!-- === Modify from here === -->
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </br></em></b></p>
| |
| - | <!-- === Modify from here === -->
| |
| - | <p lang="en-US">
| |
| - | results from sequencing:
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus-Anti LacZ: OK
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | Litmus-Anti Kan: OK
| |
| - | </p>
| |
| - | <p lang="en-US">
| |
| - | <a name="_GoBack"></a>
| |
| - | Litmus-Anti Cm: OK
| |
| - | </p>
| |
| - |
| |
| - | <!-- === To here === -->
| |
| - | </div>
| |
| - | </html>
| |
| - |
| |
| - | <html>
| |
| - | </div>
| |
| - | </div>
| |
| - | <div style="clear: both;"></div>
| |
| - |
| |
| - | <style>
| |
| - | #footer-box{
| |
| - | display:none;
| |
| - | }
| |
| - | </style>
| |
| - | </html>
| |
"
