Team:Hong Kong HKUST/Project/module2

From 2013.igem.org

(Difference between revisions)
 
(32 intermediate revisions not shown)
Line 69: Line 69:
{visibility:hidden;}
{visibility:hidden;}
#globalWrapper
#globalWrapper
-
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:3500px;}
+
{position: relative;font-size:127%;width:100%;margin:0;padding:0;padding-bottom:10px;background-color:#494042;height:2750px;}
#content
#content
-
{width: 1000px;border:none;background-color:#ffffff;height:3400px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
+
{width: 995px;border:none;background-color:#ffffff;height:2700px;padding:0px;margin-top:0px;line-height: 1.5em;color: black;}
#top-section
#top-section
{height:2px;border:none;background-color:#494042;}
{height:2px;border:none;background-color:#494042;}
Line 167: Line 167:
top:141px;
top:141px;
width:100%;
width:100%;
 +
z-index:1;
}
}
#back-top {
#back-top {
Line 172: Line 173:
top: 10%;
top: 10%;
right: 2%;
right: 2%;
 +
z-index:16;
}
}
#back-top a {
#back-top a {
Line 239: Line 241:
width: 83.33333%;
width: 83.33333%;
top:192px;
top:192px;
-
z-index:-2;
+
 
}
}
.column, .columns {
.column, .columns {
Line 295: Line 297:
margin-bottom: 0;}
margin-bottom: 0;}
</style>
</style>
-
 
+
</head>
<body>
<body>
-
<p id="back-top" style=""display:none;>
+
<p id="back-top" style="display:none;">
<a href="#top"><span><img src="http://515alive.com/theme/img/up-arrow.png" style="width:90%;"><br><br>BACK TO TOP</span></a>
<a href="#top"><span><img src="http://515alive.com/theme/img/up-arrow.png" style="width:90%;"><br><br>BACK TO TOP</span></a>
</p>
</p>
Line 361: Line 363:
       <div class="row">
       <div class="row">
<div class="two columns">
<div class="two columns">
-
<ul class="side-nav">
+
<br><br>
 +
<ul class="side-nav">
<li>
<li>
-
<h6>FA Sensing Mechanism</h6>
+
<h6>Modules</h6>
</li>
</li>
<li class="divider"></li>
<li class="divider"></li>
-
<li>
+
<li>
-
<a href=#1>Overview</a>
+
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module4">Glyoxylate Shunt</a>
</li>
</li>
-
<li>
+
<li>
-
<a href=#2>FABP1 Promoter</a>
+
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module3">Protein Trafficking</a>
</li>
</li>
-
<li>
 
-
<a href=#3>PPAR-alpha Promoter</a>
 
-
                                               
 
-
</li>
 
-
 
-
<li>
 
-
<a href=#4>GRP78 Promoter</a>
 
-
 
-
                                </li>
 
-
<li>
 
-
<a href=#5><i>fadR</i> and pFadBA</a>
 
-
 
-
 
-
                                </li>
 
-
<li>
 
-
<a href=#6>References</a>
 
-
 
-
 
-
                                </li>
 
-
 
-
</ul>
 
-
<ul class="side-nav1">
 
<li>
<li>
-
<h6>Modules</h6>
+
FA Sensing Mechanism
-
</li>
+
<ul>
-
<li class="divider"></li>
+
 +
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module1">FA Quantification & Cell Viability</a>
+
<a href=#1>Overview</a>
</li>
</li>
-
<li>
+
<li>
-
FA Sensing Mechanism
+
<a href=#2>Four Promoters</a>
</li>
</li>
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module3">Protein Trafficking</a>
+
<a href=#3>Cell Viability</a>
 +
</li>
 +
<li>
 +
<a href=#4>Fatty Acid Quantification</a>
</li>
</li>
<li>
<li>
-
<a href="https://2013.igem.org/Team:Hong_Kong_HKUST/Project/module4">Glyoxylate Shunt</a>
+
<a href=#5>References</a>
 +
 +
 +
                                </li>
 +
</ul>
</li>
</li>
 +
 +
</ul>
</ul>
Line 424: Line 415:
<div class="nine columns"><p id="1"></p>
<div class="nine columns"><p id="1"></p>
<h3>Overview</h3>
<h3>Overview</h3>
-
In 2009, Prof. James Liao's research group at UCLA published their findings that mice expressing a synthetic glyoxylate shunt had increased resistance to diet-induced obesity. To engineer this behaviour in mice, they introduced glyoxylate shunt genes to mouse liver cells, employing a constitutive promoter for expression of the said genes. The aim of this module is to introduce an inducible system that allows tunable fatty acid uptake by sensing fatty acid concentrations. Such a system would reduce the risk of fatty acid deficiency when fatty acid concentration is below normal.
+
In 2009, Prof. James Liao's research group at UCLA published their findings that mice expressing synthetic glyoxylate shunt had increased resistance to diet-induced obesity. To engineer this behavior in mice, they introduced glyoxylate shunt genes to mouse liver cells, employing a constitutive promoter for expression of the said genes.  
-
<br><br>
+
-
Four different fatty acid induced promoters were investigated, namely: Liver Fatty Acid Binding Protein 1 (FABP1) promoter, Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) promoter, Glucose Regulated Protein (GRP78) promoter, Fatty Acid Metabolism Regulator Protein (FadR) and pFadBA promoter. 
+
-
<br>
+
-
</div>
+
-
</div>
+
-
<div class="row">
+
-
<div class="nine columns"><p id="2"></p>
+
-
<h3>Liver Fatty Acid Binding Protein 1 (FABP1) promoter </h3>
+
-
Fatty acid binding proteins (FABPs) are lipid-binding proteins that regulate fatty acid uptake and transfer between extra-and intracellular membranes. There are 9 different FABPs identified with tissue-specific distribution, including FABP1 in liver. All FABPs have a similar structure, and the FABP genes consist of 3 introns and 4 exons. Some, such as PPAR, are believed to transport fatty acids from the plasma membrane to intracellular receptors, and as such have a selective cooperation with the receptor.
+
-
<br>
+
-
<h5><b>Experiment flow</b></h5>
+
-
FABP1 was cloned from human genomic DNA (gDNA) (see gDNA extraction and PCR protocols) and engineered RFC10 prefixes and suffixes were attached for BioBrick submission. It was then ligated with the coding sequence for enhanced green fluorescence protein (eGFP) from pEGFP-N1 (Addgene), and cloned into <a href="http://parts.igem.org/Part:BBa_J176171">BBa_J176171</a> mammalian backbone. The promoter and eGFP were successfully cloned into BBa_J176171 by digestion and ligation.
+
-
<br><br>
+
-
The confirmed construct was transfected into both HEK293FT and HepG2 cells. pEGFP-N1 plasmids, which carry eGFP regulated by the constitutive CMV promoter, were also transfected as a positive control. Green fluorescence signals from both the constitutive control and FABP1-regulated cells were compared. However, no such signal could be detected from the latter.
+
-
<br><br>
+
-
Since the FABP1 promoter contained illegal restriction sites (namely EcoRI and PstI), we conducted multi site-directed mutagenesis to eliminate them from the DNA sequence. (See mutagenesis protocol 1,2 and 3).
+
-
<br><br>
+
-
The FABP1 promoter was to be characterized by over-expression of eGFP reporter proteins in the presence of high fatty acid concentration in the medium<sup>1</sup>. Again, however, no eGFP signal could be detected.
+
-
<br><br>
+
-
After several attempts of site-mutagenesis of the promoter in FABP1 – eGFP – BBa_J176171 construct, we found that the plasmid degrades at a high temperature. We tested heat sensitivity of the plasmid BBa_J176171 and found that the plasmid degrades during denaturation (95 °C) in the polymerase chain reaction (PCR). We then transferred the sequence, cloning FABP1 promoter into pBlueScript KS(+). Due to time constraints attempted just two mutagenesis attempts and neither of them was successful.<br>
+
-
</div>
+
Though not demonstrated in mice, we worry that this glyoxylate shunt, when constantly turned on in human cells, could incur a fitness cost by continuing to burn off energy when the environment is not so energy rich. Thus, we are working to put this glyoxylate shunt under regulation by an inducible system, which would allow tunable fatty acid uptake by sensing fatty acid concentrations. Such a system should reduce the risk of energy or fatty acid deficiency when the surrounding fatty acid concentration is not too high.
-
</div>
+
-
<div class="row">
+
To construct this inducible system, we searched for candidates that could regulate gene expression on the level of transcription while responding to fatty acid levels. Four different fatty acid induced promoters were then investigated, namely:<br>
-
<div class="nine columns"><p id="3"></p>
+
 
-
<h3>Cell Viability</h3>
+
<br>1. Liver Fatty Acid Binding Protein 1 (FABP1) Promoter;
-
We worked to introduce an inducible system that allows tunable fatty acid uptake regulated by fatty acid concentrations. Fatty acid uptake was to be quantified to compare the activity of wild type cells with the activity of our engineered cells expressing inducible glyoxylate shunt.
+
<br>2. Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter;
-
<br><br>
+
<br>3. Glucose Regulated Protein (GRP78) Promoter; and
-
High fatty acid levels are known to lead to apoptosis, so we conducted cell viability tests using MTT assay at different sodium palmitate concentrations. <br><br>
+
<br>4. Fatty Acid Metabolism Regulator Protein (FadR) and FadBA Promoter.<br>
-
The objective was to determine the range of fatty acid concentrations to be introduced into our cells that would allow more than 60% viability after 24 hours incubation and/or more than 50% in 48 hours.<br><br>
+
-
<h5><b>MTT assay description</b></h5>
 
-
The MTT assay measures the enzymatic activity of oxidoreductase enzymes that only show activity when the cells are alive. When the aforementioned enzymes are active, MTT, a tetrazolium dye, is reduced into an insoluble formazan, giving a purple color. Organic solvents such as DMSO can be used to dissolve the formazan. Absorbance at 570nm is measured using a spectrophotometer to quantitatively determine the amount of formazan formation.<br><br>
 
-
In our experiment, HepG2 cells were seeded into a 96-well plate. After one day of incubation, a gradient concentration of sodium palmitate from 0 mM to 1.0mM, and 2.0mM was added into each row of wells. After adding the sodium palmitate, we incubated the cells for 24 hours or 48 hours. MTT reagent was added and formazan formation was observed and measured using a spectrophotometer.
 
-
<br><br>
 
-
<h5><b>Results</h5></b>
 
-
From the MTT assay, we observed that after 24 hours of incubation with palmitic acid, around 45% viability can be maintained even at 2.0mM. For 48 hours incubation, cell viability varied for different concentrations. To maintain 50% viability after 48 hours incubation with palmitic acid, we decided to conduct subsequent experimentation within the range of 0mM to 0.32 mM palmitic acid. Click on the pictures to the side for our specific findings on cell viability.
 
<br>
<br>
</div>
</div>
</div>
</div>
 +
<div class="row">
 +
<div class="nine columns"><p id="2"></p>
-
                            <div class="row">
+
<h3>Biology Behind the Four Fatty Acid Responsive Promoters</h3>
-
<div class="nine columns"><p id="4"></p>
+
<h3>1. Liver Fatty Acid Binding Protein 1 (FABP1) Promoter</h3>
-
<h3>Fatty Acid Quantification</h3>
+
Fatty acid binding proteins (FABPs) are lipid-binding proteins that regulate fatty acid uptake and transfer between extra-and intracellular membranes. There are 9 different FABPs identified with tissue-specific distribution, including FABP1 in liver. Some, such as Peroxisome Proliferator-Activated Receptor (PPAR), are believed to transport fatty acids from the plasma membrane to intracellular receptors, and as such have a selective cooperation with the receptor to activate gene transcription.
-
Two fatty acid quantification methods were investigated to measure fatty acid uptake rate of our constitutive and inducible glyoxylate systems: 1) Gas Chromatography-Mass Spectrophotometry (GC-MS), and 2) fatty acid quantification kit (Sigma-Aldrich; St. Louis, MO). While we managed to measure the fatty acid quantity in cell culture medium using GC-MS, we were not able to try the fatty acid quantification kit due to time limitations.<br><br>
+
-
<h5><b>Fatty Acid Treatment</b></h5>
+
-
Fatty acid solution was mixed with ethanol and chloroform. After acidifying by hydrochloric acid and refluxing in a water bath for 30 min, the organic layer containing fatty acids was collected and extracted by diethyl ether and petroleum ether solution. Again the organic layer was extracted out to be dried before sodium hydroxide was added. Then after derivatisation by boron trifluoride and bromotetradecane, the organic layer was collected into GC-MS vials for analysis.
+
<br><br>
<br><br>
-
<h5><b>GC-MS</b></h5>
 
-
GC-MS is a very useful tool to quantify volatile compounds effectively. For our experiment, we conducted calibration tests using known concentrations of fatty acids. However, it was difficult to reach a conclusion due to lack of internal standards and an uncertain amount of sample loss.<br>
 
 +
 +
<h3>2. Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter</h3>
 +
The peroxisome proliferator – activated receptors (PPARs) function s transcription factors to regulate expression of genes. The expression of PPAR-alpha can be up-regulated by increased fatty acid concentration in mammalian liver cells. The promoter of PPAR-alpha has a basal expression level. However, when it is stimulated with an extracellular palmitate concentration of 150uM, the activity of the promoter will increase by over 4 folds within 48 hours. <br><br>
-
</div>
+
-
</div>
+
<h3>3. Glucose Regulated Protein (GRP78) Promoter</h3>
 +
GRP78 (HSPA5) is involved in the folding and assembly of proteins in the endoplasmic reticulum (ER). High concentration of fatty acids disrupts cell homeostasis, leading to endoplasmic reticulum stress (ERS). This in turn will activate the unfolded protein response (UPR) that consists of three trans-membrane proteins: IRE1, PERK and ATF6. The signals from these three proteins, when integrated together, will activate the GRP78 promoter. Other factors such as NF-Y, ERSF, YY1, which are normally acquired from the normal stress response followed by UPR, also play a role in activating the GRP78 promoter. <br><br>  
-
<div class="row">
+
-
<div class="nine columns"><p id="3"></p>
+
<h3>4. Fatty Acid Metabolism Regulator Protein (FadR) and FadBA Promoter</h3>
-
<h3>Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter</h3>
+
FadR is a bacterial transcription repressor that regulates lipid metabolism and determines the bi-stable switch between fatty acid biosynthesis and beta-oxidation. The binding of FadR to the operator is inhibited by fatty acyl-CoA compounds, which are intermediates of fatty acid degradation. When the cellular environment is deficient in fatty acids, FadR binds to P<sub><i>fad</sub></i> (promoter of operon <i>fadBA</i>) and shuts down the beta-oxidation pathway while turning on the biosynthesis pathway.
-
We planned to clone PPAR-alpha promoter from human genomic DNA using PCR. We designed three pairs of primers to amplify the promoter sequence for different polymerases and taking Pineda Torra's team’s experiment as a reference<sup>2</sup>. PCR amplification was conducted at different temperatures, primer concentrations and buffers. However, no combination of primers that we tried under those different conditions could successfully amplify the PPAR-alpha promoter.
+
-
<br><br>
+
-
Primers used to extract PPAR-alpha promoter from gDNA:<br>
+
-
Forward:<center><br> GATCATATTAATGAATTCGCGGCCGCTTCTAGAGTTCCCTCACCAAACACAACAGGATGA</center><br>
+
-
Reverse:<center><br> GATCATGGATCCTACTAGTAGCGGCCGCTGCAGCGCAAGAGTCCTCGGTGT</center><br>
+
-
Forward:<center><br> GATCAT ATTAATGAATTCGCGGCCGCTTCTAGAGGGTATGCCAGGTAATGTCTT</center><br>
+
-
Reverse:<center><br> GATCATGGATCCCTGCAGCGGCCGCTACTAGTACAAGAGTCCTCGGTGTGT</center><br>
+
-
Forward from reference paper:<br><br>
+
-
<center>GATCAT ATTAAT GAATTCGCGGCCGCTTCTAGAGGAGCGTCACGGCCCGAACAAAGC</center><br>
+
-
Reverse from reference papers+ RFC10 prefix and suffix:<br><br>
+
-
<center>GATCATGGATCCCTGCAGCGGCCGCTACTAGTAAGTCCTCGGTGTGTGTCCTCGCTCCTC</center><br>
+
-
Since the PPAR-alpha promoter coding sequence could not be obtained from human genomic DNA, further experimentation could not proceed.<br>
+
-
</div>
 
</div>
</div>
-
<div class="row">
+
</div>
-
<div class="nine columns"><p id="4"></p>
+
<div class="row">
-
<h3>Glucose Regulated Protein (GRP78) Promoter </h3>
+
<div class="nine columns"><p id="3"></p>
-
GRP78 (HSPA5) is involved in the folding and assembly of proteins in the endoplasmic reticulum (ER). The level of GRP78 is believed to be strongly correlated with the amount of secretory proteins (e.g. IgG) within the ER, which suggests its key role in monitoring protein transport through the cell.
+
<h3>Cell Viability</h3>
-
<br><br>
+
We are working towards to introducing an inducible system that allows tunable fatty acid uptake regulated by fatty acid concentrations. To test our promoters, fatty acid has to be added in the cell culture medium. It is however known that high fatty acid levels could lead to apoptosis by inducing stress responses. So in order to determine the range of fatty acid concentration suitable for testing, we conducted cell viability tests using MTT assay under different sodium palmitate concentrations. Our desired concentration range should keep at least 60% of cells alive after 24 hours incubation and/or at least 50% alive in 48 hours.
-
High concentration of fatty acids disrupts cell homeostasis, causing endoplasmic reticulum stress (ERS). This in turn activates the unfolded protein response (UPR) that consists of 3 transmembrane proteins: IRE1, PERK and ATF6. Three signals constitutively activate the GRP78 promoter with the help of other factors, such as NF-Y, ERSF, YY1 and cleaved ATF6, acquired from the normal stress response followed by UPR.
+
-
<br><br>
+
-
<h5><b>Experiment Flow</b></h5>
+
-
The commercial plasmid pDRIVE-hGRP78 (InvivoGen) was treated as per the manufacturer's instructions (see manufacturer's protocol). GRP78 promoter was amplified from gDNA by PCR with attachment of the engineered RFC10 prefix, suffix, AseI site upstream of prefix and XhoI site downstream of suffix by primer design. The AseI and XhoI sites were included to facilitate cloning into pEGFP-N1 backbone (Addgene). pEGFP-N1 is a mammalian vector that contains constitutive CMV promoter and enhanced green fluorescence protein (eGFP) as a reporter. We replaced the CMV promoter with inducible GFP78 promoter by digestion and ligation. Since GRP78 promoter contained illegal restriction sites, two kinds of mutagenesis were conducted (See Mutagenesis protocol 2 and 3) for the elimination of an internal XbaI site. Due to time constraints, preparation of the GRP78-eGFP construct for characterization could not be realized.
+
-
<br>
+
</div>
</div>
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns"><p id="5"></p>
+
<div class="nine columns"><p id="4"></p>
-
<h3>Fatty Acid Metabolism Regulator Protein (FadR) and pFadBA</h3>
+
<h3>Fatty Acid Quantification</h3>
-
FadR is a bacterial transcription factor that regulates lipid metabolism of fatty acid biosynthesis and beta-oxidation. The binding of FadR is inhibited by fatty acyl-CoA compounds, which are intermediates of fatty acid degradation. HKUST iGEM group has designed to use this protein in mammalian cell to sense the amount of fatty acid present in the cell.
+
To differentiate between the fatty acid amount added to the medium versus the actual fatty acid amount inside the medium, we investigated two fatty acid quantification methods: 1) Gas Chromatography-Mass Spectrophotometry (GC-MS), and 2) fatty acid quantification kit (Sigma-Aldrich; St. Louis, MO). While we managed to measure the fatty acid quantity in cell culture medium using GC-MS, we were not able to use the fatty acid quantification kit due to time limitations.
-
<br><br>
+
-
In terms of promoter efficiency, the difference in prokaryotic and eukaryotic transcription mechanisms gives this protein low possibility to be expressed in mammalian cell. However, HKUST group plans to investigate the efficiency of prokaryotic transcription factor in eukaryotic system and compare efficiency with other sensing mechanisms, which are believed to be present in mammalian cell.
+
-
<br><br>
+
-
In the absence of fatty acid, a constitutively expressed fatty acid metabolism regulator protein FadR binds to Pfad promoter (pFadBA) and inhibits the expression of aceA and aceB. In our project, we aim to use this sensing mechanism to regulate the transcription of aceA and aceB, genes for glyoxylate shunt. As a regulatory system, when fatty acid is introduced to HepG2 cell, fatty acid is converted into acyl-CoA, which binds to fadR and inhibits repression of PfadBA.
+
-
<br>
+
-
<h5><b>Experiment Flow</b></h5>
+
-
The FadR (<a href="http://parts.igem.org/Part:BBa_K817001">BBa_K817001</a>) and pFadBA (<a href="http://parts.igem.org/Part:BBa_K817002">BBa_K817002</a>) DNA were obtained from 2013 distribution kit, submitted by NTU-Taida 2012 team. For expression in mammalian cells, pFadBA was cloned into mammalian vector (BBa_J176171) with an enhanced green fluorescence protein (eGFP) as reporter. After successful construct of pFadBA – eGFP – BBa_J176171, the plasmid was transfected into HEK293FT cell.
+
-
<br><br>
+
-
For the promoter regulation, we cloned FadR into BBa_J176171 backbone, with Kozak sequence and Nuclear Leading Sequence (NLS) for transcription and translation efficiency in mammalian cell.
+
-
After confirmation of the construct, Kozak Sequence – FadR coding sequence – NLS was cloned into pEGFP-N1 that contains mammalian constitutive CMV promoter. The pFadBA promoter and FadR protein constructs were to be co-transfected in HEK293FT cell and selected using different drug selection markers – Puromycin for BBa_J176171 and Neomycin for pEGFP-N1.
+
-
<br><br>
+
-
After co-transfection of two constructs to HEK cell, no eGFP signal could be detected from fadBA promoter construct. We believed that even though we have introduced Kozak and nuclear leader sequences to protein coding sequence, difference in prokaryotic and eukaryotic transcription mechanism gives fadR protein low possibility to be expressed in mammalian cell.
+
-
<br><br>
+
-
After transfecting to mammalian cells, these promoters will be induced by Fatty Acids or its oxidation products, leading to expression of eGFP. By comparing the image of the intensity of eGFP using Fluorescent microscopy, we will be able to quantify their expression and determine the desired sensing mechanism which is most efficient for Glyoxylate genes expression.  
+
<br>
<br>
Line 536: Line 468:
</div>
</div>
<div class="row">
<div class="row">
-
<div class="nine columns"><p id="6"></p>
+
<div class="nine columns"><p id="5"></p>
<h3>References</h3>
<h3>References</h3>
<sup>1</sup> Guzman, Carla et al. "The human liver fatty acid binding protein (FABP1) gene is activated by FOXA1 and PPARα; and repressed by C/EBPα: Implications in FABP1 down-regulation in nonalcoholic fatty liver disease." <i>Biochemica et Biophysica Acta (BBA) - Molecular and Cell Biology.</i> 1831.4 (April 2013): 803-818. Web. 23 Sep. 2013. <http://www.sciencedirect.com/science/article/pii/S1388198113000036>.<br><br>
<sup>1</sup> Guzman, Carla et al. "The human liver fatty acid binding protein (FABP1) gene is activated by FOXA1 and PPARα; and repressed by C/EBPα: Implications in FABP1 down-regulation in nonalcoholic fatty liver disease." <i>Biochemica et Biophysica Acta (BBA) - Molecular and Cell Biology.</i> 1831.4 (April 2013): 803-818. Web. 23 Sep. 2013. <http://www.sciencedirect.com/science/article/pii/S1388198113000036>.<br><br>
-
<sup>2</sup> Ines Pineda Torra  et al. “Characterization of the human PPARalpha promoter: Identification of a functional Nuclear Receptor Response Element.”
+
<sup>2</sup> Ann Vogel Hertzel, et al (2000) “the Mammalian Fatty Acid-binding Protein Multigene Family: Molecular and Genetic Insights into Function” Elsevier Science<br><br>
 +
<sup>3</sup> Guor Mour Her, et al. (2003) “In vivo studies of liver-type fatty acid binding protein (L-FABP) gene expression in liver of transgenic zebrafish (Danio rerio)”<br><br>
 +
<sup>4</sup> Ines Pineda Torra  et al. “Characterization of the human PPARalpha promoter: Identification of a functional Nuclear Receptor Response Element.”<br><br>
 +
<sup>5</sup> Christopher D. Swagell et al. (2004) “Expression analysis of a human hepatic cell line in response to palmitate." <i>Biochemical and Biophysical Research Communications.</i><br><br>
 +
<sup>6</sup> Yibin Xu, et al. (2001) “The FadR-DNA Complex. Transcriptional control of fatty acid metabolism in Escherichia Coli.” <i>JBC Papers in Press</i><br><br>
 +
<sup>7</sup> Yuren Wei, et al. (2006) “Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells.” <i>Am J Physiol</i><br><br>
 +
<sup>8</sup> Do-Sung Kim, et al. (2007) “Effects of triglyceride on ER stress and insulin resistance” <i>Biochemical and Biophysical Research Communications.</i><br><br>
 +
<sup>9</sup> Mingqing LI, et al. “ATF6 as a Transcription Activator of the Endoplasmic Reticulum Stress Element: Thapsigargin Stress-Induced Changes and Synergistic Interactions with NF-Yand YY1.”<i> Department of Biochemistry and Molecular Biology, and the USC/Norris Comprehensive Cancer Center, Keck School of Medicine of the University of Southern California, Los Angeles.</i><br><br>
 +
<sup>10</sup> <a href="https://2012.igem.org/Team:NTU-Taida">https://2012.igem.org/Team:NTU-Taida</a><br><br>
 +
<sup>11</sup>Life Technologies. (n.d.). Vybrant® mtt cell proliferation assay kit. Retrieved from http://www.lifetechnologies.com/hk/en/home/references/protocols/cell-culture/mtt-assay-protocol/vybrant-mtt-cell-proliferation-assay-kit.html"<br><br>
 +
<sup>12</sup>Sigma-Adrich. (2012). Free fatty acid quantification kit. Retrieved from http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Bulletin/1/mak044bul.pdf<br><br>
 +
 
<br>
<br>

Latest revision as of 12:41, 28 October 2013



Fatty Acid Sensing Mechanism

Overview

In 2009, Prof. James Liao's research group at UCLA published their findings that mice expressing synthetic glyoxylate shunt had increased resistance to diet-induced obesity. To engineer this behavior in mice, they introduced glyoxylate shunt genes to mouse liver cells, employing a constitutive promoter for expression of the said genes. Though not demonstrated in mice, we worry that this glyoxylate shunt, when constantly turned on in human cells, could incur a fitness cost by continuing to burn off energy when the environment is not so energy rich. Thus, we are working to put this glyoxylate shunt under regulation by an inducible system, which would allow tunable fatty acid uptake by sensing fatty acid concentrations. Such a system should reduce the risk of energy or fatty acid deficiency when the surrounding fatty acid concentration is not too high. To construct this inducible system, we searched for candidates that could regulate gene expression on the level of transcription while responding to fatty acid levels. Four different fatty acid induced promoters were then investigated, namely:

1. Liver Fatty Acid Binding Protein 1 (FABP1) Promoter;
2. Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter;
3. Glucose Regulated Protein (GRP78) Promoter; and
4. Fatty Acid Metabolism Regulator Protein (FadR) and FadBA Promoter.

Biology Behind the Four Fatty Acid Responsive Promoters

1. Liver Fatty Acid Binding Protein 1 (FABP1) Promoter

Fatty acid binding proteins (FABPs) are lipid-binding proteins that regulate fatty acid uptake and transfer between extra-and intracellular membranes. There are 9 different FABPs identified with tissue-specific distribution, including FABP1 in liver. Some, such as Peroxisome Proliferator-Activated Receptor (PPAR), are believed to transport fatty acids from the plasma membrane to intracellular receptors, and as such have a selective cooperation with the receptor to activate gene transcription.

2. Peroxisome Proliferator-Activated Receptor-alpha (PPAR-alpha) Promoter

The peroxisome proliferator – activated receptors (PPARs) function s transcription factors to regulate expression of genes. The expression of PPAR-alpha can be up-regulated by increased fatty acid concentration in mammalian liver cells. The promoter of PPAR-alpha has a basal expression level. However, when it is stimulated with an extracellular palmitate concentration of 150uM, the activity of the promoter will increase by over 4 folds within 48 hours.

3. Glucose Regulated Protein (GRP78) Promoter

GRP78 (HSPA5) is involved in the folding and assembly of proteins in the endoplasmic reticulum (ER). High concentration of fatty acids disrupts cell homeostasis, leading to endoplasmic reticulum stress (ERS). This in turn will activate the unfolded protein response (UPR) that consists of three trans-membrane proteins: IRE1, PERK and ATF6. The signals from these three proteins, when integrated together, will activate the GRP78 promoter. Other factors such as NF-Y, ERSF, YY1, which are normally acquired from the normal stress response followed by UPR, also play a role in activating the GRP78 promoter.

4. Fatty Acid Metabolism Regulator Protein (FadR) and FadBA Promoter

FadR is a bacterial transcription repressor that regulates lipid metabolism and determines the bi-stable switch between fatty acid biosynthesis and beta-oxidation. The binding of FadR to the operator is inhibited by fatty acyl-CoA compounds, which are intermediates of fatty acid degradation. When the cellular environment is deficient in fatty acids, FadR binds to Pfad (promoter of operon fadBA) and shuts down the beta-oxidation pathway while turning on the biosynthesis pathway.

Cell Viability

We are working towards to introducing an inducible system that allows tunable fatty acid uptake regulated by fatty acid concentrations. To test our promoters, fatty acid has to be added in the cell culture medium. It is however known that high fatty acid levels could lead to apoptosis by inducing stress responses. So in order to determine the range of fatty acid concentration suitable for testing, we conducted cell viability tests using MTT assay under different sodium palmitate concentrations. Our desired concentration range should keep at least 60% of cells alive after 24 hours incubation and/or at least 50% alive in 48 hours.

Fatty Acid Quantification

To differentiate between the fatty acid amount added to the medium versus the actual fatty acid amount inside the medium, we investigated two fatty acid quantification methods: 1) Gas Chromatography-Mass Spectrophotometry (GC-MS), and 2) fatty acid quantification kit (Sigma-Aldrich; St. Louis, MO). While we managed to measure the fatty acid quantity in cell culture medium using GC-MS, we were not able to use the fatty acid quantification kit due to time limitations.

References

1 Guzman, Carla et al. "The human liver fatty acid binding protein (FABP1) gene is activated by FOXA1 and PPARα; and repressed by C/EBPα: Implications in FABP1 down-regulation in nonalcoholic fatty liver disease." Biochemica et Biophysica Acta (BBA) - Molecular and Cell Biology. 1831.4 (April 2013): 803-818. Web. 23 Sep. 2013. .

2 Ann Vogel Hertzel, et al (2000) “the Mammalian Fatty Acid-binding Protein Multigene Family: Molecular and Genetic Insights into Function” Elsevier Science

3 Guor Mour Her, et al. (2003) “In vivo studies of liver-type fatty acid binding protein (L-FABP) gene expression in liver of transgenic zebrafish (Danio rerio)”

4 Ines Pineda Torra et al. “Characterization of the human PPARalpha promoter: Identification of a functional Nuclear Receptor Response Element.”

5 Christopher D. Swagell et al. (2004) “Expression analysis of a human hepatic cell line in response to palmitate." Biochemical and Biophysical Research Communications.

6 Yibin Xu, et al. (2001) “The FadR-DNA Complex. Transcriptional control of fatty acid metabolism in Escherichia Coli.” JBC Papers in Press

7 Yuren Wei, et al. (2006) “Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells.” Am J Physiol

8 Do-Sung Kim, et al. (2007) “Effects of triglyceride on ER stress and insulin resistance” Biochemical and Biophysical Research Communications.

9 Mingqing LI, et al. “ATF6 as a Transcription Activator of the Endoplasmic Reticulum Stress Element: Thapsigargin Stress-Induced Changes and Synergistic Interactions with NF-Yand YY1.” Department of Biochemistry and Molecular Biology, and the USC/Norris Comprehensive Cancer Center, Keck School of Medicine of the University of Southern California, Los Angeles.

10 https://2012.igem.org/Team:NTU-Taida

11Life Technologies. (n.d.). Vybrant® mtt cell proliferation assay kit. Retrieved from http://www.lifetechnologies.com/hk/en/home/references/protocols/cell-culture/mtt-assay-protocol/vybrant-mtt-cell-proliferation-assay-kit.html"

12Sigma-Adrich. (2012). Free fatty acid quantification kit. Retrieved from http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Bulletin/1/mak044bul.pdf


Retrieved from "http://2013.igem.org/Team:Hong_Kong_HKUST/Project/module2"