Team:ETH Zurich/Experiments
From 2013.igem.org
(29 intermediate revisions not shown) | |||
Line 4: | Line 4: | ||
<h1>Final Circuit</h1> | <h1>Final Circuit</h1> | ||
- | <p align="justify">For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the | + | <p align="justify">For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.</p> |
<br clear="all"/> | <br clear="all"/> | ||
Line 10: | Line 10: | ||
<html> | <html> | ||
- | |||
- | |||
+ | |||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2013/d/d0/ETHZ_plasmidmaps.png" usemap="#map3" id="imagemap3" width="100%"> | ||
+ | |||
+ | <map id="imagemap3" name="map3"><area shape="rect" alt="" title="constitutive promoter: BBa_J23100" coords="223,104,337,136" href="http://parts.igem.org/Part:BBa_J23100" target="" /><area shape="rect" alt="" title="NagZ: BBa_K1216003" coords="364,92,482,146" href="http://parts.igem.org/Part:BBa_K1216003" target="" /><area shape="rect" alt="" title="constitutive promoter: BBa_J23110" coords="218,333,334,365" href="http://parts.igem.org/Part:BBa_J23110" target="" /><area shape="rect" alt="" title="LuxI: BBa_K805016" coords="359,311,465,360" href="http://parts.igem.org/Part:BBa_K805016" target="" /><area shape="poly" alt="" title="constitutive promoter pLac in BBa_J09855" coords="839,134,946,116,952,154,844,168" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="rect" alt="" title="LuxR in BBa_J09855" coords="970,92,1088,147" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="poly" alt="" title="Lux promoter with high sensitivity: BBa_R0062" coords="1114,105,1225,114,1222,149,1107,138" href="http://parts.igem.org/Part:BBa_R0062" target="" /><area shape="poly" alt="" title="GusA: BBa_K1216000" coords="1255,105,1372,122,1366,172,1244,155" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><area shape="poly" alt="" title="SM1 Lux promoter with low sensitivity: BBa_K1216008" coords="824,363,936,343,943,381,827,395" href="http://parts.igem.org/Part:BBa_K1216007" target="" /><area shape="rect" alt="" title="Aes: BBa_K1216002" coords="959,320,1052,376" href="http://parts.igem.org/Part:BBa_K1216002" target="" /><area shape="rect" alt="" title="promoter pLuxL: BBa_R0063" coords="1092,333,1208,366" href="http://parts.igem.org/Part:BBa_R0063" target="" /><area shape="rect" alt="" title="LacI: BBa_J24679" coords="1241,333,1358,382" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><!-- Created by Online Image Map Editor (http://www.maschek.hu/imagemap/index) --></map> | ||
+ | <br clear="all"/> | ||
<b>Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.</b> | <b>Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.</b> | ||
<script type="text/javascript"> | <script type="text/javascript"> | ||
+ | (function($) { | ||
+ | function img(url) { | ||
+ | var i = new Image; | ||
+ | i.src = url; | ||
+ | return i; | ||
+ | } | ||
+ | |||
+ | if ('naturalWidth' in (new Image)) { | ||
+ | $.fn.naturalWidth = function() { return this[0].naturalWidth; }; | ||
+ | $.fn.naturalHeight = function() { return this[0].naturalHeight; }; | ||
+ | return; | ||
+ | } | ||
+ | $.fn.naturalWidth = function() { return img(this[0].src).width; }; | ||
+ | $.fn.naturalHeight = function() { return img(this[0].src).height; }; | ||
+ | })(jQuery); | ||
+ | |||
+ | |||
+ | |||
+ | function onWindowResize() | ||
+ | { | ||
+ | var curWidth = $(window).width(), | ||
+ | curHeight = $(window).height(), | ||
+ | checking=false; | ||
+ | if (checking) { | ||
+ | return; | ||
+ | } | ||
+ | checking = true; | ||
+ | window.setTimeout( | ||
+ | function() { | ||
+ | var newWidth = $(window).width(), | ||
+ | newHeight = $(window).height(); | ||
+ | if (!(newWidth !== curWidth || | ||
+ | newHeight !== curHeight)) { | ||
+ | resize(false); | ||
+ | } | ||
+ | checking=false; | ||
+ | }, 300); | ||
+ | } | ||
+ | |||
+ | function resize(initial) { | ||
+ | |||
+ | if (navigator.userAgent.match(/msie/i)) | ||
+ | { | ||
+ | if ($("#bxsliderText").parent().css("height") != $("#bxslider").parent().css("height")) | ||
+ | setTimeout(function() {$( "#bxsliderText" ).parent().css({"height": $("#bxslider").parent().css("height")});}, 100); | ||
+ | } | ||
+ | |||
+ | if (!initial) | ||
+ | { | ||
+ | var container = $('#bxslider > li'); | ||
+ | var imgWidth = container.width(); | ||
+ | |||
+ | $( "#imagemap3" ).each(function() { | ||
+ | $(this).css('height', 'auto', 'width', 'auto'); | ||
+ | $(this).mapster('resize',Math.min(imgWidth, $(this).naturalWidth()) ,0,0); | ||
+ | }); | ||
+ | } | ||
+ | |||
+ | } | ||
+ | |||
+ | |||
$(document).ready(function(){ | $(document).ready(function(){ | ||
+ | sliderText = $('#bxsliderText').bxSlider({'mode': 'fade', 'controls': false, 'pager': false, 'auto': false, "responsive": false, 'touch': false}); | ||
+ | slider = $('#bxslider').bxSlider({ 'auto': false, onSlideAfter: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}, onSlideBefore: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}}); | ||
+ | $('#bxsliderText').parent().css({"height": "100%", 'min-height' : '430px'}); | ||
+ | $('#bxsliderText').parent().parent().css({"height": "100%"}); | ||
+ | $('.bx-viewport #bxslider').bind('mousewheel', function(event, delta, deltaX, deltaY) { | ||
+ | event.preventDefault(); | ||
+ | if (delta < 0) {slider.goToNextSlide();} | ||
+ | else {slider.goToPrevSlide();} | ||
+ | }); | ||
$('#imagemap3').mapster({ | $('#imagemap3').mapster({ | ||
fillColor: 'c2d8f1', | fillColor: 'c2d8f1', | ||
Line 26: | Line 100: | ||
clickNavigate: true | clickNavigate: true | ||
}); | }); | ||
- | |||
- | + | ||
+ | $(window).resize( | ||
+ | function() | ||
+ | { | ||
+ | onWindowResize(); | ||
+ | }); | ||
+ | resize(true); | ||
+ | }); | ||
</script> | </script> | ||
</html> | </html> | ||
- | |||
- | |||
<br><h1>Cloned Constructs</h1> | <br><h1>Cloned Constructs</h1> | ||
Line 38: | Line 116: | ||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
- | <th colspan="4" height="30px"> | + | <th colspan="4" height="30px">Fluorescent protein reporter constructs</th> |
<tr> | <tr> | ||
<th width="20px" height="30px"> </th> | <th width="20px" height="30px"> </th> | ||
Line 49: | Line 127: | ||
<td>1</td> | <td>1</td> | ||
<td>Receiver cell construct for GFP diffusion experiments</td> | <td>Receiver cell construct for GFP diffusion experiments</td> | ||
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> |
- | <td>[[File: | + | <td>[[File:Pla1.png|300px]<br>[File:Pla2.png|300px]]</td> |
</tr> | </tr> | ||
Line 56: | Line 134: | ||
<td>2</td> | <td>2</td> | ||
<td>Library of the Receiver cell constructs</td> | <td>Library of the Receiver cell constructs</td> | ||
- | <td>Using the | + | <td>Using the Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities<br>Primers:<br>5'-tatactagagac<b>nnn</b>taggatcgtacag<br>5'-gatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagac<b>nnn</b>taggatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.</td> |
- | <td>[[File: | + | <td>[[File:Pla3.png|300px]]</td> |
</tr> | </tr> | ||
Line 64: | Line 142: | ||
<td>Receiver cell construct for GFP experiments without the LuxR generating part</td> | <td>Receiver cell construct for GFP experiments without the LuxR generating part</td> | ||
<td>[http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> | <td>[http://parts.igem.org/Part:BBa_R0062 BBa_R0062] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> | ||
- | <td>[[File: | + | <td>[[File:Pla4.png|225px]]<br>[[File:Pla5.png|225px]]</td> |
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>4</td> | ||
+ | <td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td> | ||
+ | <td>Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga | ||
+ | <br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | ||
+ | <td>[[File:Pla6.png|300px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>5</td> | ||
+ | <td>Receiver cell construct with mutated pLux promoter library and RFP reporter to test together with wild-type pLux GFP receiver cells in one cell</td> | ||
+ | <td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and RFP (SpeI,PstI) insert from [http://parts.igem.org/Part:BBa_J23118 BBa_J23118]</td> | ||
+ | <td>[[File:Pla7.png|225px]]</td> | ||
</tr> | </tr> | ||
Line 82: | Line 175: | ||
<tr> | <tr> | ||
- | <td> | + | <td>6</td> |
<td>Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | <td>Sender cell construct with a very strong constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | ||
<td>[http://parts.igem.org/Part:BBa_J23100 BBa_J23100] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | <td>[http://parts.igem.org/Part:BBa_J23100 BBa_J23100] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | ||
- | <td>[[File: | + | <td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td> | + | <td>7</td> |
<td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | <td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | ||
<td>[http://parts.igem.org/Part:BBa_J23118 BBa_J23118] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | <td>[http://parts.igem.org/Part:BBa_J23118 BBa_J23118] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | ||
- | <td>[[File: | + | <td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td> | + | <td>8</td> |
<td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | <td>Sender cell construct with an intermediate constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | ||
<td>[http://parts.igem.org/Part:BBa_J23110 BBa_J23110] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | <td>[http://parts.igem.org/Part:BBa_J23110 BBa_J23110] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | ||
- | <td>[[File: | + | <td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td> | + | <td>9</td> |
<td>Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | <td>Sender cell construct with a weak constitutive promoter from the BBa_J23100 promoter library for GFP and Hydrolase experiments</td> | ||
<td>[http://parts.igem.org/Part:BBa_J23114 BBa_J23114] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | <td>[http://parts.igem.org/Part:BBa_J23114 BBa_J23114] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_K805016 BBa_K805016] insert (XbaI, PstI)</td> | ||
- | <td>[[File: | + | <td>[[File:Pla8.png|225px]]<br>[[File:Pla9.png|225px]]</td> |
</tr> | </tr> | ||
Line 122: | Line 215: | ||
<tr> | <tr> | ||
- | <td> | + | <td>10</td> |
<td>constitutive LuxR generating biobrick</td> | <td>constitutive LuxR generating biobrick</td> | ||
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855]</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855]</td> |
- | <td>[[File: | + | <td>[[File:Pla10.png|250px]]</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
- | <td> | + | <td>11</td> |
<td>constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations</td> | <td>constitutive LuxR generating biobrick, with negative feedback-loop at high OHHL concentrations</td> | ||
<td>[http://parts.igem.org/Part:BBa_F2621 BBa_F2621]</td> | <td>[http://parts.igem.org/Part:BBa_F2621 BBa_F2621]</td> | ||
- | <td>[[File: | + | <td>[[File:Pla11.png|250px]]</td> |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>12</td> | <td>12</td> | ||
- | + | <td>negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system</td> | |
- | + | <td>[http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert (XbaI, PstI)</td> | |
- | + | <td>[[File:Pla12.png|225px]]</td> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | <td>negatively regulated pLuxL-LacI construct to improve leakiness of LuxR system</td> | + | |
- | <td>[http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert ( | + | |
- | <td>[[File: | + | |
</tr> | </tr> | ||
Line 169: | Line 241: | ||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
- | <th colspan="4" height="30px"> | + | <th colspan="4" height="30px"> pLuxR constructs </th> |
<tr> | <tr> | ||
<th width="20px" height="30px"> </th> | <th width="20px" height="30px"> </th> | ||
Line 178: | Line 250: | ||
<tr> | <tr> | ||
- | <td> </td> | + | <td>13</td> |
- | <td> </td> | + | <td>Library of pLuxR promoter variants in pSB1C3 backbone for cloning</td> |
- | <td> </td> | + | <td> The promoter variants were chosen after characterization and sequencing with the GFP receiver library. The sequences were ordered as custom-made oligos and inserted into pSB1C3 using EcoRI and PstI restriction sites.<br>Oligos:<br>5'-accagtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accggtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-acccgtaggatcgtagaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accagtaggatcgtaaaggtttacgcaagaaaatggtttgttatagtcgaataaa<br>5'-accagtaggatcgtataggtttacgcaagaaaatggtttgttatagtcgaataaa<br></td> |
- | <td> </td> | + | <td>[[File:Pla13.png|225px]]</td> |
</tr> | </tr> | ||
</table> | </table> | ||
- | + | ||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
Line 196: | Line 268: | ||
<tr> | <tr> | ||
- | <td> </td> | + | <td>14</td> |
<td>Aes coding region with RBS in SB1C3 backbone</td> | <td>Aes coding region with RBS in SB1C3 backbone</td> | ||
- | <td>BBa_K1216002</td> | + | <td>[http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs.<br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br>5'-gtttcttcctgcagcggccgctactagtattattaaagctgagcggtaaagaactgag</td> |
- | <td> </td> | + | <td>[[File:Pla14.png|225px]]</td> |
</tr> | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>15</td> | ||
+ | <td>Aes-His coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216006 BBa_K1216006] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br> | ||
+ | 5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td> | ||
+ | <td>[[File:Pla15.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>16</td> | ||
+ | <td>GusA coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattattgtttgcctccctgctgcg</td> | ||
+ | <td>[[File:Pla16.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>17</td> | ||
+ | <td>GusA-His coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216004 BBa_K1216004] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td> | ||
+ | <td>[[File:Pla17.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>18</td> | ||
+ | <td>PhoA coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattacttcaggcccagcgccgctttc</td> | ||
+ | <td>[[File:Pla18.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>19</td> | ||
+ | <td>PhoA-His coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216005 BBa_K1216005] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagagtttgtttaactttaagaaggagatatacat<br>5'-gtttcttcctgcagcggccgctactagtattattagtggtggtggtggtggtgctc</td> | ||
+ | <td>[[File:Pla19.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>20</td> | ||
+ | <td>NagZ coding region with RBS in SB1C3 backbone</td> | ||
+ | <td>[http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003] was built through touchdown PCR amplification. Biobrick prefix and suffix were added with overhangs. <br>Primers:<br>5'-gtttcttcgaattcgcggccgcttctagaggtttaactttaagaaggagatatagctagc<br>5'-gtttcttcctgcagcggccgctactagtattattactcgtgacctgctttctcttc</td> | ||
+ | <td>[[File:Pla20.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>21</td> | ||
+ | <td>constitutive expression of PhoA for non-mine cells</td> | ||
+ | <td>constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216001 BBa_K1216001]insert (XbaI, PstI)</td> | ||
+ | <td>[[File:Pla21.png|225px]]<br>[[File:Pla22.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>22</td> | ||
+ | <td>constitutive expression of NagZ for mine cells</td> | ||
+ | <td>constitutive promoter [http://parts.igem.org/Part:BBa_J23100 BBa_J23100] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216003 BBa_K1216003]insert (XbaI, PstI)</td> | ||
+ | <td>[[File:Pla23.png|225px]]<br>[[File:Pla24.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>23</td> | ||
+ | <td>AHL inducible expression of GusA</td> | ||
+ | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000]insert (XbaI, PstI)</td> | ||
+ | <td>[[File:Pla25.png|300px]]<br>[[File:Pla26.png|300px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>24</td> | ||
+ | <td>AHL inducible expression of GusA with positive feedback loop for LuxR expression</td> | ||
+ | <td>Plac-LuxR-pLuxR BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga | ||
+ | <br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | ||
+ | <td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | |||
+ | <tr> | ||
+ | <td>25</td> | ||
+ | <td>AHL inducible expression of Aes</td> | ||
+ | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002]insert (XbaI, PstI)</td> | ||
+ | <td>[[File:Pla29.png|300px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>26</td> | ||
+ | <td>AHL inducible expression of Aes with mutant pLux promoter</td> | ||
+ | <td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] (SpeI,PstI) insert</td> | ||
+ | <td>[[File:Pla30.png|225px]]</td> | ||
+ | </tr> | ||
+ | |||
+ | |||
</table> | </table> | ||
Line 226: | Line 387: | ||
<h1>Groupparts / Biobricks</h1> | <h1>Groupparts / Biobricks</h1> | ||
- | <p> In the following table you can find | + | <p> In the following table you can find all the biobricks that were submitted by our group. </p> |
<br> | <br> | ||
- | <groupparts> | + | <groupparts>iGEM2013 ETH_Zurich</groupparts> |
<br clear="all"/> | <br clear="all"/> | ||
+ | |||
{{:Team:ETH_Zurich/templates/footer}} | {{:Team:ETH_Zurich/templates/footer}} |
Latest revision as of 19:22, 28 October 2013
Contents |
Final Circuit
For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.
Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.
Cloned Constructs
To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.
Groupparts / Biobricks
In the following table you can find all the biobricks that were submitted by our group.
<groupparts>iGEM2013 ETH_Zurich</groupparts>