Team:ETH Zurich/Experiments
From 2013.igem.org
(13 intermediate revisions not shown) | |||
Line 4: | Line 4: | ||
<h1>Final Circuit</h1> | <h1>Final Circuit</h1> | ||
- | <p align="justify">For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the | + | <p align="justify">For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.</p> |
<br clear="all"/> | <br clear="all"/> | ||
Line 13: | Line 13: | ||
- | <img src="https://static.igem.org/mediawiki/2013/ | + | <img src="https://static.igem.org/mediawiki/2013/d/d0/ETHZ_plasmidmaps.png" usemap="#map3" id="imagemap3" width="100%"> |
- | <map id="imagemap3" name="map3"><area shape="rect" alt="" title="constitutive promoter: BBa_J23100" coords="223,104,337,136" href="http://parts.igem.org/Part:BBa_J23100" target="" /><area shape="rect" alt="" title="NagZ: BBa_K1216003" coords="364,92,482,146" href="http://parts.igem.org/Part:BBa_K1216003" target="" /><area shape="rect" alt="" title="constitutive promoter: BBa_J23110" coords="218,333,334,365" href="http://parts.igem.org/Part:BBa_J23110" target="" /><area shape="rect" alt="" title="LuxI: BBa_K805016" coords="359,311,465,360" href="http://parts.igem.org/Part:BBa_K805016" target="" /><area shape="poly" alt="" title="constitutive promoter pLac in BBa_J09855" coords="839,134,946,116,952,154,844,168" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="rect" alt="" title="LuxR in BBa_J09855" coords="970,92,1088,147" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="poly" alt="" title=" | + | <map id="imagemap3" name="map3"><area shape="rect" alt="" title="constitutive promoter: BBa_J23100" coords="223,104,337,136" href="http://parts.igem.org/Part:BBa_J23100" target="" /><area shape="rect" alt="" title="NagZ: BBa_K1216003" coords="364,92,482,146" href="http://parts.igem.org/Part:BBa_K1216003" target="" /><area shape="rect" alt="" title="constitutive promoter: BBa_J23110" coords="218,333,334,365" href="http://parts.igem.org/Part:BBa_J23110" target="" /><area shape="rect" alt="" title="LuxI: BBa_K805016" coords="359,311,465,360" href="http://parts.igem.org/Part:BBa_K805016" target="" /><area shape="poly" alt="" title="constitutive promoter pLac in BBa_J09855" coords="839,134,946,116,952,154,844,168" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="rect" alt="" title="LuxR in BBa_J09855" coords="970,92,1088,147" href="http://parts.igem.org/Part:BBa_J09855" target="" /><area shape="poly" alt="" title="Lux promoter with high sensitivity: BBa_R0062" coords="1114,105,1225,114,1222,149,1107,138" href="http://parts.igem.org/Part:BBa_R0062" target="" /><area shape="poly" alt="" title="GusA: BBa_K1216000" coords="1255,105,1372,122,1366,172,1244,155" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><area shape="poly" alt="" title="SM1 Lux promoter with low sensitivity: BBa_K1216008" coords="824,363,936,343,943,381,827,395" href="http://parts.igem.org/Part:BBa_K1216007" target="" /><area shape="rect" alt="" title="Aes: BBa_K1216002" coords="959,320,1052,376" href="http://parts.igem.org/Part:BBa_K1216002" target="" /><area shape="rect" alt="" title="promoter pLuxL: BBa_R0063" coords="1092,333,1208,366" href="http://parts.igem.org/Part:BBa_R0063" target="" /><area shape="rect" alt="" title="LacI: BBa_J24679" coords="1241,333,1358,382" href="http://parts.igem.org/Part:BBa_K1216000" target="" /><!-- Created by Online Image Map Editor (http://www.maschek.hu/imagemap/index) --></map> |
+ | <br clear="all"/> | ||
+ | <b>Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.</b> | ||
+ | <script type="text/javascript"> | ||
+ | (function($) { | ||
+ | function img(url) { | ||
+ | var i = new Image; | ||
+ | i.src = url; | ||
+ | return i; | ||
+ | } | ||
+ | |||
+ | if ('naturalWidth' in (new Image)) { | ||
+ | $.fn.naturalWidth = function() { return this[0].naturalWidth; }; | ||
+ | $.fn.naturalHeight = function() { return this[0].naturalHeight; }; | ||
+ | return; | ||
+ | } | ||
+ | $.fn.naturalWidth = function() { return img(this[0].src).width; }; | ||
+ | $.fn.naturalHeight = function() { return img(this[0].src).height; }; | ||
+ | })(jQuery); | ||
- | |||
- | |||
- | + | function onWindowResize() | |
+ | { | ||
+ | var curWidth = $(window).width(), | ||
+ | curHeight = $(window).height(), | ||
+ | checking=false; | ||
+ | if (checking) { | ||
+ | return; | ||
+ | } | ||
+ | checking = true; | ||
+ | window.setTimeout( | ||
+ | function() { | ||
+ | var newWidth = $(window).width(), | ||
+ | newHeight = $(window).height(); | ||
+ | if (!(newWidth !== curWidth || | ||
+ | newHeight !== curHeight)) { | ||
+ | resize(false); | ||
+ | } | ||
+ | checking=false; | ||
+ | }, 300); | ||
+ | } | ||
+ | function resize(initial) { | ||
+ | if (navigator.userAgent.match(/msie/i)) | ||
+ | { | ||
+ | if ($("#bxsliderText").parent().css("height") != $("#bxslider").parent().css("height")) | ||
+ | setTimeout(function() {$( "#bxsliderText" ).parent().css({"height": $("#bxslider").parent().css("height")});}, 100); | ||
+ | } | ||
+ | |||
+ | if (!initial) | ||
+ | { | ||
+ | var container = $('#bxslider > li'); | ||
+ | var imgWidth = container.width(); | ||
+ | |||
+ | $( "#imagemap3" ).each(function() { | ||
+ | $(this).css('height', 'auto', 'width', 'auto'); | ||
+ | $(this).mapster('resize',Math.min(imgWidth, $(this).naturalWidth()) ,0,0); | ||
+ | }); | ||
+ | } | ||
+ | |||
+ | } | ||
+ | |||
+ | |||
+ | $(document).ready(function(){ | ||
+ | sliderText = $('#bxsliderText').bxSlider({'mode': 'fade', 'controls': false, 'pager': false, 'auto': false, "responsive": false, 'touch': false}); | ||
+ | slider = $('#bxslider').bxSlider({ 'auto': false, onSlideAfter: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}, onSlideBefore: function(slideElement, oldIndex, newIndex){sliderText.goToSlide(newIndex);}}); | ||
+ | $('#bxsliderText').parent().css({"height": "100%", 'min-height' : '430px'}); | ||
+ | $('#bxsliderText').parent().parent().css({"height": "100%"}); | ||
+ | $('.bx-viewport #bxslider').bind('mousewheel', function(event, delta, deltaX, deltaY) { | ||
+ | event.preventDefault(); | ||
+ | if (delta < 0) {slider.goToNextSlide();} | ||
+ | else {slider.goToPrevSlide();} | ||
+ | }); | ||
+ | $('#imagemap3').mapster({ | ||
+ | fillColor: 'c2d8f1', | ||
+ | fillOpacity: 0.6, /* | ||
+ | stroke: true, | ||
+ | strokeColor: 'c2d8f1', | ||
+ | strokeOpacity: 0.7, | ||
+ | strokeWidth: 2, */ | ||
+ | clickNavigate: true | ||
+ | }); | ||
+ | |||
+ | |||
+ | $(window).resize( | ||
+ | function() | ||
+ | { | ||
+ | onWindowResize(); | ||
+ | }); | ||
+ | resize(true); | ||
+ | }); | ||
+ | </script> | ||
+ | </html> | ||
<br><h1>Cloned Constructs</h1> | <br><h1>Cloned Constructs</h1> | ||
Line 41: | Line 127: | ||
<td>1</td> | <td>1</td> | ||
<td>Receiver cell construct for GFP diffusion experiments</td> | <td>Receiver cell construct for GFP diffusion experiments</td> | ||
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_E0840 BBa_E0840] insert (XbaI, PstI)</td> |
<td>[[File:Pla1.png|300px]<br>[File:Pla2.png|300px]]</td> | <td>[[File:Pla1.png|300px]<br>[File:Pla2.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 48: | Line 134: | ||
<td>2</td> | <td>2</td> | ||
<td>Library of the Receiver cell constructs</td> | <td>Library of the Receiver cell constructs</td> | ||
- | <td>Using the BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities<br>Primers:<br>5'-tatactagagac<b>nnn</b>taggatcgtacag<br>5'-gatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagac<b>nnn</b>taggatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.</td> | + | <td>Using the Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct a library with mutated pLux promoters was created through site-saturation mutagenesis to screen for promoters with changed sensitivities<br>Primers:<br>5'-tatactagagac<b>nnn</b>taggatcgtacag<br>5'-gatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagac<b>nnn</b>taggatcgta<b>nnn</b>gtttacgcaagaaaatg<br>5'-tagagacc<b>nn</b>taggatcgta<b>n</b>a<b>n</b>gtttacgcaagaaaatg<br>5'-tagagacct<b>n</b>taggatcgtaca<b>n</b>gtttacgcaagaaaatg<br>Interesting versions of the promoter were sequenced and inserted into pSB1C3 backbone using custom-made oligos. They could then be used for further cloning.</td> |
<td>[[File:Pla3.png|300px]]</td> | <td>[[File:Pla3.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 62: | Line 148: | ||
<td>4</td> | <td>4</td> | ||
<td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td> | <td>Receiver cell construct for GFP experiments with positive feedback loop to reduce leakiness</td> | ||
- | <td>BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga | + | <td>Plac-LuxR-pLuxR BBa_J09855.BBa_E0840 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga |
<br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | <br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | ||
<td>[[File:Pla6.png|300px]]</td> | <td>[[File:Pla6.png|300px]]</td> | ||
Line 131: | Line 217: | ||
<td>10</td> | <td>10</td> | ||
<td>constitutive LuxR generating biobrick</td> | <td>constitutive LuxR generating biobrick</td> | ||
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855]</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855]</td> |
<td>[[File:Pla10.png|250px]]</td> | <td>[[File:Pla10.png|250px]]</td> | ||
</tr> | </tr> | ||
Line 145: | Line 231: | ||
<td>12</td> | <td>12</td> | ||
<td>negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system</td> | <td>negatively regulated pLuxL-LacI construct to improve the leakiness problem of the LuxR system</td> | ||
- | <td>[http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part: | + | <td>[http://parts.igem.org/Part:BBa_R0063 BBa_R0063] backbone (SpeI, PstI) and [http://parts.igem.org/Part:BBa_J24679 BBa_J24679] insert (XbaI, PstI)</td> |
<td>[[File:Pla12.png|225px]]</td> | <td>[[File:Pla12.png|225px]]</td> | ||
</tr> | </tr> | ||
Line 155: | Line 241: | ||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
- | <th colspan="4" height="30px">pLuxR | + | <th colspan="4" height="30px"> pLuxR constructs </th> |
<tr> | <tr> | ||
<th width="20px" height="30px"> </th> | <th width="20px" height="30px"> </th> | ||
Line 169: | Line 255: | ||
<td>[[File:Pla13.png|225px]]</td> | <td>[[File:Pla13.png|225px]]</td> | ||
</tr> | </tr> | ||
+ | </table> | ||
+ | |||
<table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | <table style="float:left;margin-top:10px;width:auto;height:auto;font-size:12px"> | ||
Line 245: | Line 333: | ||
<tr> | <tr> | ||
<td>23</td> | <td>23</td> | ||
- | <td> | + | <td>AHL inducible expression of GusA</td> |
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000]insert (XbaI, PstI)</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216000 BBa_K1216000]insert (XbaI, PstI)</td> |
<td>[[File:Pla25.png|300px]]<br>[[File:Pla26.png|300px]]</td> | <td>[[File:Pla25.png|300px]]<br>[[File:Pla26.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 252: | Line 340: | ||
<tr> | <tr> | ||
<td>24</td> | <td>24</td> | ||
- | <td> | + | <td>AHL inducible expression of GusA with positive feedback loop for LuxR expression</td> |
- | <td></td> | + | <td>Plac-LuxR-pLuxR BBa_J09855.BBa_K1216000 construct where the pLac promoter was replaced with pLuxR to build a positive feedback loop. The promoter was inserted with two pairs of custom-made oligos using XbaI and HindIII restriction sites.<br>Oligos:<br>5’-ctagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactaga |
+ | <br>5’-gattaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaa<br>5’-aatctctagtatttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggtct<br>5’-agctttaattttattaattattctgtatgtgtcgtcggcatttatgtttttcatctagtatttctcctcttt</td> | ||
<td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td> | <td>[[File:Pla27.png|300px]]<br>[[File:Pla28.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 260: | Line 349: | ||
<tr> | <tr> | ||
<td>25</td> | <td>25</td> | ||
- | <td> | + | <td>AHL inducible expression of Aes</td> |
- | <td>[http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002]insert (XbaI, PstI)</td> | + | <td>Plac-LuxR-pLuxR [http://parts.igem.org/Part:BBa_J09855 BBa_J09855] (SpeI, PstI) backbone and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002]insert (XbaI, PstI)</td> |
<td>[[File:Pla29.png|300px]]</td> | <td>[[File:Pla29.png|300px]]</td> | ||
</tr> | </tr> | ||
Line 267: | Line 356: | ||
<tr> | <tr> | ||
<td>26</td> | <td>26</td> | ||
- | <td> | + | <td>AHL inducible expression of Aes with mutant pLux promoter</td> |
- | <td></td> | + | <td>Library of mutated pLux promoters (see above) backbone (SpeI,PstI) and [http://parts.igem.org/Part:BBa_K1216002 BBa_K1216002] (SpeI,PstI) insert</td> |
<td>[[File:Pla30.png|225px]]</td> | <td>[[File:Pla30.png|225px]]</td> | ||
</tr> | </tr> | ||
Line 298: | Line 387: | ||
<h1>Groupparts / Biobricks</h1> | <h1>Groupparts / Biobricks</h1> | ||
- | <p> In the following table you can find | + | <p> In the following table you can find all the biobricks that were submitted by our group. </p> |
<br> | <br> | ||
- | <groupparts> | + | <groupparts>iGEM2013 ETH_Zurich</groupparts> |
<br clear="all"/> | <br clear="all"/> | ||
+ | |||
{{:Team:ETH_Zurich/templates/footer}} | {{:Team:ETH_Zurich/templates/footer}} |
Latest revision as of 19:22, 28 October 2013
Contents |
Final Circuit
For the final Colisweeper circuit we plan a four plasmid system. The mine cells constitutively express LuxI for signal generation and NagZ as identifier hydrolase. In the non-mine cells LuxR is expressed constitutively to process the AHL signal. To reduce the leakiness of the system we introduced the LacI repressor to reduce expression of LuxR in the uninduced state. At high AHL concentrations the pLuxL reporter is repressed leading to a positive feedback loop motif. PhoA as reporter for safe cells is expressed constitutively from the chromosome and is therefore not necessary as a plasmid. Aes and GusA are expressed from pLux promoters with different sensitivities. You can find all the biobricks we used and our own new biobricks in the figure below.
Figure 1. Plasmids in mine and non-mine cells: move the cursor over the separate parts to check which biobricks we used.
Cloned Constructs
To get to the circuit mentioned above we tested different versions of the circuit. For example we started our experiments using GFP as a reporter instead of the hydrolases. Then we also tested different LuxI and LuxR generating constructs. In the following table we list all the biobricks we used, the plasmids we cloned and what experiments we used them for. In general we used standard biobrick cloning techniques as described in the methods section. Whenever we used PCR gene amplification for cloning, we list the primers used in the following table. To be able to co-transform different plasmids we used backbones with compatible origins of replication and resistance genes. In the table you can find which backbone versions we used for which constructs.
Groupparts / Biobricks
In the following table you can find all the biobricks that were submitted by our group.
<groupparts>iGEM2013 ETH_Zurich</groupparts>