Team:IIT Delhi/Biobrick
From 2013.igem.org
(Difference between revisions)
Deepakmehta (Talk | contribs) |
Rohitsatija (Talk | contribs) |
||
(2 intermediate revisions not shown) | |||
Line 200: | Line 200: | ||
<ul> | <ul> | ||
<li><a href="https://2013.igem.org/Team:IIT_Delhi/Outreach" id="orientation">Orientation for Freshmen</a></li> | <li><a href="https://2013.igem.org/Team:IIT_Delhi/Outreach" id="orientation">Orientation for Freshmen</a></li> | ||
- | + | ||
<li><a href="https://2013.igem.org/Team:IIT_Delhi/BRAI" id="bill">BRAI Bill</a></li> | <li><a href="https://2013.igem.org/Team:IIT_Delhi/BRAI" id="bill">BRAI Bill</a></li> | ||
<li><a href="https://2013.igem.org/Team:IIT_Delhi/Biotoilet" id="biotoilets">Biotoilets</a></li> | <li><a href="https://2013.igem.org/Team:IIT_Delhi/Biotoilet" id="biotoilets">Biotoilets</a></li> | ||
Line 229: | Line 229: | ||
<hr style="width: 100%; height: 2px;"><br> | <hr style="width: 100%; height: 2px;"><br> | ||
- | <b><font size=3>BBa_K1170000</font></b><br><br> | + | <b><font size=3><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1170000">BBa_K1170000</a></font></b><br><br> |
Acid Shock Response (asr) promoter is an acid-inducible promoter sequence, present in the genome of E. coli K12 bacteria. <br><br> | Acid Shock Response (asr) promoter is an acid-inducible promoter sequence, present in the genome of E. coli K12 bacteria. <br><br> | ||
Line 249: | Line 249: | ||
<br><br> | <br><br> | ||
- | <b><font size=3>BBa_K1170001</font></b><br><br> | + | <b><font size=3><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1170001">BBa_K1170001</a></font></b><br><br> |
Following is the Super Folder Green Fluorescent Protein (SFGFP) encoding DNA sequence submitted to the registry:<br><br> | Following is the Super Folder Green Fluorescent Protein (SFGFP) encoding DNA sequence submitted to the registry:<br><br> | ||
ATGCGTAAAGGCGAGGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTG<br> | ATGCGTAAAGGCGAGGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTG<br> | ||
Line 267: | Line 267: | ||
- | <b><font size=3>BBa_K1170002</font></b><br><br> | + | <b><font size=3><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1170002">BBa_K1170002</a></font></b><br><br> |
This is a reporter gene that we planned to use in our pH sensor for detecting alkaline surroundings. LacZ gene, present in the ORF of the lac operon in E. coli, encodes for β-Galactosidase enzyme which hydrolyses the β-(1,4) bond between a glucose unit (α or β form) and a galactose unit (only β form). This intracellular enzyme can be used to react with X-Gal as substrate and produce a blue colored dye to act as a visible reporter of lacZ gene expression. Since our aim is to engineer bacteria so that it behaves akin to a Universal pH indicator, lacZ gene is ideal for expression under an alkali-inducible promoter and generate blue color at high pH. The sequence submitted to the iGEM registry is as follows:<br><br> | This is a reporter gene that we planned to use in our pH sensor for detecting alkaline surroundings. LacZ gene, present in the ORF of the lac operon in E. coli, encodes for β-Galactosidase enzyme which hydrolyses the β-(1,4) bond between a glucose unit (α or β form) and a galactose unit (only β form). This intracellular enzyme can be used to react with X-Gal as substrate and produce a blue colored dye to act as a visible reporter of lacZ gene expression. Since our aim is to engineer bacteria so that it behaves akin to a Universal pH indicator, lacZ gene is ideal for expression under an alkali-inducible promoter and generate blue color at high pH. The sequence submitted to the iGEM registry is as follows:<br><br> | ||
Line 306: | Line 306: | ||
- | <b><font size=3>BBa_K1170003</font></b><br><br> | + | <b><font size=3><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K1170003">BBa_K1170003</a></font></b><br><br> |
The 733bp Alkali-inducible promoter (P-atp2), present in the F¬¬0F1 ATPase operon in Corynebacterium glutamicum ATCC 13032, can be used to elicit a high pH-based response [2]. <br><br> | The 733bp Alkali-inducible promoter (P-atp2), present in the F¬¬0F1 ATPase operon in Corynebacterium glutamicum ATCC 13032, can be used to elicit a high pH-based response [2]. <br><br> | ||
<img src="https://static.igem.org/mediawiki/2013/c/c4/Iitdee3.jpg" align=middle><br><br> | <img src="https://static.igem.org/mediawiki/2013/c/c4/Iitdee3.jpg" align=middle><br><br> |
Latest revision as of 04:14, 28 September 2013
Biobricks Submitted BBa_K1170000 Acid Shock Response (asr) promoter is an acid-inducible promoter sequence, present in the genome of E. coli K12 bacteria. Fig 1: Position of acid shock response (asr) gene in the genome of E. coli K12. +1 site denotes the Transcriptional Start Site of the asr gene, -10 denotes the TATA box and the “Pho Box” denotes the TF site that is regulated by “Pho operon” in E. coli. When performed in LPM (Low Phosphate Minimal) media, induction due to asr promoter is almost 100 times at it’s most optimal pH, i.e. 4.8, as compared to pH 7.0 [1]. Fig 2: Northern Blot Analysis of the RNA isolated from E. coli K12 strain induction at two different pH at multiple time intervals, indicates significant production of mRNA transcribed under the P-asr promoter. We identified a minimal promoter region of 178bp, just before the ORF of the asr gene, that included the observable regulatory regions for acid induction. CGATCAAGACTACTATTATTGGTAGCTAAATTTCCCTTAAGTCACAATACGTTATTATCAACGCTGTAATTTATTCAGCGTTTGTACATAT CGTTACACGCTGAAACCAACCACTCACGGAAGTCTGCCATTCCCAGGGATATAGTTATTTCAACGGCCCCGCAGTGGGGTTAAATGA We designed the following primers for this sequence and PCR amplified the fragment from E. coli K12 genome (these are not in Standard Biobrick configuration as, initially, we used pUC19 as our vector for cloning): FP: GTCGAATTCCGATCAAGACTACTATTATTGGTAGCT (36) (EcoRI site) RP: GTAGGATCCTCATTTAACCCCACTGCGGGGCCGTTGAAATAAC (43) (BamHI site) BBa_K1170001 Following is the Super Folder Green Fluorescent Protein (SFGFP) encoding DNA sequence submitted to the registry: ATGCGTAAAGGCGAGGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTG GCGAGGGTGAAGGTGACGCAACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGT AACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGC TATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGGTAAACC GCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACAT CACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGATCACTAC CAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACG AGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAATGATGA (GenBank ID: HQ873313.1 GI: 321437460) This sequence is almost identical to that of BBa_I746916 (Designed by iGEM 2007 Team from Cambridge). However, on a quick BLAST alignment of the two sequences, we observe that there is a mutation at the 15th bp, making it a novel part in the registry. Following primers were designed for this part, for cloning it under P-asr in pUC19 plasmid: FP: GTAGGATCCATGCGTAAAGGCGAGGAGCTGTTCACTGGT (39) (BamHI) RP: GTACTGCAGTCATCATTTGTACAGTTCATCCATACCATG (39) (PstI) (Again, these are different from the standard Biobrick parts, as required by iGEM). BBa_K1170002 This is a reporter gene that we planned to use in our pH sensor for detecting alkaline surroundings. LacZ gene, present in the ORF of the lac operon in E. coli, encodes for β-Galactosidase enzyme which hydrolyses the β-(1,4) bond between a glucose unit (α or β form) and a galactose unit (only β form). This intracellular enzyme can be used to react with X-Gal as substrate and produce a blue colored dye to act as a visible reporter of lacZ gene expression. Since our aim is to engineer bacteria so that it behaves akin to a Universal pH indicator, lacZ gene is ideal for expression under an alkali-inducible promoter and generate blue color at high pH. The sequence submitted to the iGEM registry is as follows: >BBa_K1170002 Part-only sequence (3018 bp) atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacat ccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcc tggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatg cacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttac tcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgc aacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcg gtgatggtgctgcgttggagtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcat aaaccgactacacaaatcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactggaggctgaagttcagatgtgc ggcgagttgcgtgactacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaatt atcgatgagcgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctat cgtgcggtggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggt ctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacg atggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacgctgtgc gaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgctggcta ccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaatgaatcaggccac ggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccgacaccacggcc accgatattatttgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatcaaaaaatggctttcgcta cctggagagacgcgcccgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgt cagtatccccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaacggcaacccgtggtcggcttac ggcggtgattttggcgatacgccgaacgatcgccagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaa gcaaaacaccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagcgaatacctgttccgtcatagcgataacgag ctcctgcactggatggtggcgctggatggtaagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaa ctgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccggg cacatcagcgcctggcagcagtggcgtctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctgaccaccagc gaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgccagtcaggctttctttcacagatgtggattggcgataaaaaa caactgctgacgccgctgcgcgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgcattgaccctaacgcc tgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcgttgttgcagtgcacggcagatacacttgctgatgcggtgctgatt acgaccgctcacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggtagtggtcaaatggcgattacc gttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctc ggattagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgccattgtcagacatgtataccccgtac gtcttcccgagcgaaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagc cgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggctgaatatcgacggtttccatatg gggattggtggcgacgactcctggagcccgtcagtatcggcg [GI: J01636.1] BBa_K1170003 The 733bp Alkali-inducible promoter (P-atp2), present in the F¬¬0F1 ATPase operon in Corynebacterium glutamicum ATCC 13032, can be used to elicit a high pH-based response [2]. Fig: a) Organization of the F0F1 ATPase operon in C. glutamicum. Note that the operon apparently has two overlapping promoters, P-atp1 regulating the 1.2kb fragment (not well characterized alkali-induction) and P-atp2 inducing the 7.5kb fragment at high pH. b) Northern Hybridization analysis of alkali induction of the F0F1 operon in C. glutamicum. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- References: [1] Suziedeliené, E., Suziedélis, K., Garbenciūté, V., Normark, S. The acid-inducible asr gene in Escherichia coli: transcriptional control by the phoBR operon. J. Bacteriol. (1999) [2] Mo´nica Barriuso-Iglesias, Carlos Barreiro, Fabio Flechoso and Juan F. Martı´n, Transcriptional analysis of the F0F1 ATPase operon of Corynebacterium glutamicum ATCC 13032 reveals strong induction by alkaline pH. Microbiology January 2006 152:1 11-21 |
Feel Free to contact us at igemiitdelhi2013 at gmail dot com if you have queries; requests; suggestions et cetera. Thanks to iGEM and IIT Delhi, we had an awesome summer! |
Our
Project was supported by and done by the students of IIT Delhi, India. |
This
project was done as a part of iGEM: iGEM Main Website |