Team:Heidelberg/Templates/DelH overview1

From 2013.igem.org

(Difference between revisions)
(Created page with "=== Restriction Digest and Ligation Strategy === Schematic representation of DelH cluster and structure of delftibactin. * PCR amplific...")
(Vector Maps, Primers and BioBricks)
 
(7 intermediate revisions not shown)
Line 1: Line 1:
 +
 +
[[File:Heidelberg_Del Cluster.png|400px|right|thumb|Schematic representation of DelH cluster and structure of delftibactin.]]
=== Restriction Digest and Ligation Strategy ===
=== Restriction Digest and Ligation Strategy ===
-
[[File:Del Cluster.png|300px|right|thumb|Schematic representation of DelH cluster and structure of delftibactin.]]
 
* PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
* PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
* Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
* Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
Line 8: Line 9:
<div style="clear:both"></div>
<div style="clear:both"></div>
<br/>
<br/>
 +
=== Vector Maps, Primers and BioBricks===
=== Vector Maps, Primers and BioBricks===
-
[[File:Res-DelH-finalplasmid.svg|300px|left|thumb|Vector map of the [[:File:DelH-pSB6A1-AraC-lacZ.gb|pHM01:DelH plasmid]].]]
+
[[File:Heidelberg_Res-DelH-finalplasmid.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_DelH-pSB6A1-AraC-lacZ.gb.txt|pHM01:DelH plasmid]].]]
{| class="wikitable"
{| class="wikitable"
|-
|-
Line 29: Line 31:
! Identifier !! Order date !! Note !! Sequence
! Identifier !! Order date !! Note !! Sequence
|-
|-
-
| DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || tttt ttaattaa    tcacacaggaaagtactag   ATGGACCGTGGCCGCCTGC    GCCAAATCG
+
| DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || TTTT  TTAATTAA  TCACACAGGAAAGTACTAG   ATGGACCGTGGCCGCCTGC    GCCAAATCG
|-
|-
-
| DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI || tttt GTCGACCAACACCTGTGCCTGC
+
| DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI || TTTT GTCGACCAACACCTGTGCCTGC
|-
|-
-
| DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting SalI|| tttt GTCGACTGGATGGAGCCTGGTGAAAG
+
| DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting SalI|| TTTT GTCGACTGGATGGAGCCTGGTGAAAG
|-
|-
-
| DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || tttt ggtacc   TCAGTCCAGCGCGTACTCCAG
+
| DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || TTTT GGTACC   TCAGTCCAGCGCGTACTCCAG
|-
|-
-
| DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || tttt ggtacc aaagaggagaaatactagatgaccatg
+
| DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
|-
|-
-
| DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || tttt   ttaattaa   gctagcccaaaaaaacgggtatg
+
| DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || TTTT   TTAATTAA   GCTAGCCCAAAAAAACGGGTATG
|}
|}
<br/>
<br/>

Latest revision as of 11:03, 23 October 2013

Schematic representation of DelH cluster and structure of delftibactin.

Restriction Digest and Ligation Strategy

  • PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
  • Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
  • Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
  • Transformation of E. coli TOP10 with DelH plasmid
  • Characterization of positive (blue) colonies by colony PCR


Vector Maps, Primers and BioBricks

Vector map of the pHM01:DelH plasmid.
Backbone Part Distribution Plate Well Usage Resistance
pSB4K5 J04450 Spring 2012 1 5G Backbone for DelA-G,OP,L Kanamycin
pSB1AK3 I732019 Spring 2012 4 12G lacZ reporter gene Kanamycin, Ampicillin
pSB2K3 I0500 Spring 2012 1 14N AraC promoter Kanamycin
pSB6A1 J04450 Spring 2012 1 1K Backbone for DelH Ampicillin
pSB1C3 J04450 Spring 2012 1 3A Backbone for Indigoidine Chloramphenicol
Identifier Order date Note Sequence
DN01:DelH_f1_PacI_fw 03-05-2013 Amplification of DelH F1, with RBS and adding PacI restriction site TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev 03-05-2013 Amplification of DelH F1 until SalI TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw 03-05-2013 Amplification of DelH F2 starting SalI TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev 03-05-2013 Amplification of DelH F2, adding KpnII restriction site TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev 03-05-2013 Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG