Team:Heidelberg/Templates/DelH overview22

From 2013.igem.org

(Difference between revisions)

Latest revision as of 02:58, 29 October 2013

Results

Colonies	Alignment File	Sequence
III F7	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F7.clustal.txt	Mutation
III F9	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b F9.clustal.txt	Mutation
III G3	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G3.clustal.txt	Mutation
III G4	File:Heidelberg Sequencing Result pHM04 VF2 colony DH10b G4.clustal.txt	Mutation

Vector Maps and Primers

Strategy A: weak Promotor, weak RBS
Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.

Vector map of the weak promotor and weak RBS DelH plasmid pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid.

Identifier	Order date	Note	Sequence
FS_78:BB_HPLC_rev	26-09-2013	Gibson-Primer rev, amplify the Backbone pSB6A1 introducing the RBS BBa_B0032 and the promotor BBa_J23114 and creating an overlap to the first fragment of DelH amplified with primer DN_11	GATTTGGCGCAGGCGGCCACGG TCCATCTAGTACTTTCCTGTGTGACTCTA GAGCTAGCATTGTACCTAGGACTGAGCT AGCCATAAACTCTAGAAGCGGCCGCGAATTC
FS_84:BB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify first fragment of DelH introducing the RBS BBa_B0032 and creating an overlap to primer FS_85 thereby partially introducing the promotor BBa_J23114	GCTCAGTCCTAGGTACAATGCTAGC TCTAGAGTCACACAGGAAAGTACTAGATGGA CCGTGGCCGCCTGCG
FS_85:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH	GCGATTTGGCGCAGGCGGCCACGGT CCATCTAGTATTTCTCCTCTTTC

Strategy B: ccdB Construct
Selection for mutated and thus truncated DelH sequences will be minimized by using a ccdB strategy. DelH will be integrated in a pSB4K5 backbone flanked by KpnI and BamHI sites (pFS02). The pSB6A1 backbone will be assembled with a ccdB cassette flanked by KpnI and BamHI sites (pFS03). The final DelH plasmid will be assembled by restriction - ligation of pFS02 and pFS03 to pFS05.

Identifier	Order date	Note	Sequence
FS_85:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB6A1, partially introducing the promotor BBa_B0032 with overlap to primer FS_84 and therefore the promotor BBa_J23114, it creates an overlap to the beginning of DelH	GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
FS_86:BB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the Backbone pSB4K5 without any promotor introducing a KpnI cutting site for restriction cloning, creates an overlap to DelH and will be used for the ccdB strategy	GGCGATTTGGCGCAGGCGGCCACGGTCCATGTACTTCGAGTCACTAAGGGCTAAC
FS_87:BB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify the Backbone pSB6A1 introducing a BamHI cutting site for restriction cloning and creating an overlap to the last fragment of DelH	CGCTGGAGTACGCGCTGGACTGAGATCCCAGGCATCAAATAAAACG
FS_90:ccdB_HPLC_fw	26-09-2013	Gibson-Primer fw to amplify the ccdB cassette from the template pDonor Plasmid introducing a KpnI cutting site for restriction cloning, creates an overlap to the promotor BBa_J23114 and will be used for the ccdB strategy	CTCAGTCCTAGGTACAATGCTAGCTCTAGAGTCACACAGGAAAGCAGTAC ACTGGCTGTGTATAAGGGAG
FS_93:ccdB_HPLC_rev	26-09-2013	Gibson-Primer rev to amplify the ccdB cassette from the template pDonor Plasmid introducing a BamHI cutting site for restriction cloning, creates an overlap to the backbone pSB6A1 and will be used for the ccdB strategy	GTTCACCGACAAACAACAGATGATCCGCGTGGATCCGGCTTAC
FS_94:BB_HPLC_fw	26-09-2013	Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy	ATCTGTTGTTTGTCGGTGAACGC

Vector map of the DelH plasmid without promoter in pSB4K5 pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid.

Vector map of the pSB6A1 backbone with ccdB cassette pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid.

Vector map of the final DelH plasmid in pSB6A1 pFS05 (DelH_final_pSB6A1_BBa_J23114_BBa_B0032_KpnI_DelH_BamHI) Gibson plasmid.

@@ Line 1: / Line 1: @@
 ===Results===
 {| class="wikitable"
@@ Line 4: / Line 5: @@
 ! Colonies !! Alignment File || Sequence
 |-
-| III F7 || [[File:Sequencing Result pHM04 VF2 colony DH10b F7.clustal | Sequencing of clone III F7 with VF2]] || Mutation
+| III F7 || [[File:Heidelberg_Sequencing Result pHM04 VF2 colony DH10b F7.clustal.txt | Sequencing of clone III F7 with VF2]] || Mutation
 |-
-| III F9 || [[File:Sequencing Result pHM04 VF2 colony DH10b F9.clustal | Sequencing of clone III F9 with VF2]] || Mutation
+| III F9 || [[File:Heidelberg_Sequencing Result pHM04 VF2 colony DH10b F9.clustal.txt | Sequencing of clone III F9 with VF2]] || Mutation
 |-
-| III G3 || [[File:Sequencing Result pHM04 VF2 colony DH10b G3.clustal | Sequencing of clone III G3 with VF2]] || Mutation
+| III G3 || [[File:Heidelberg_Sequencing Result pHM04 VF2 colony DH10b G3.clustal.txt | Sequencing of clone III G3 with VF2]] || Mutation
 |-
-| III G4|| [[File:Sequencing Result pHM04 VF2 colony DH10b G4.clustal | Sequencing of clone III G4 with VF2]] || Mutation
+| III G4|| [[File:Heidelberg_Sequencing Result pHM04 VF2 colony DH10b G4.clustal.txt | Sequencing of clone III G4 with VF2]] || Mutation
 |}
 <div style="clear:both"></div>
 <br/>
 ===Vector Maps and Primers===
 '''Strategy A: weak Promotor, weak RBS'''
 <br/>
 Expression of the possibly toxic DelH module on pFS02 is minimized by usage of a weak promoter: BBa_J23114 as well as a weak RBS: BBa_0032.
-[[File:pFS_02.png|300px|left|thumb|Vector map of the weak promotor and weak RBS DelH plasmid [[:File:pFS_02.gb|pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid]].]]
+[[File:Heidelberg_pFS_02.png|300px|left|thumb|Vector map of the weak promotor and weak RBS DelH plasmid [[:File:Heidelberg_pFS_02.gb|pFS02 (pSB6A1_BBa_J23114_BBa_B0032_DelH) Gibson plasmid]].]]<div style="clear:both"></div>
 {| class="wikitable"
 |-
@@ Line 49: / Line 52: @@
 |-
 | FS_94:BB_HPLC_fw ||  26-09-2013 || Primer fw to amplify the backbone pSB6A1, will be used for the ccdB strategy|| ATCTGTTGTTTGTCGGTGAACGC
-|}
+|}<div style="clear:both"></div>
-[[File:pFS_03.png|300px|left|thumb|Vector map of the DelH plasmid without promoter in pSB4K5 [[:File:pFS_03.gb|pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid]].]]
+[[File:Heidelberg_pFS_03.png|300px|left|thumb|Vector map of the DelH plasmid without promoter in pSB4K5 [[:File:Heidelberg_pFS_03.gb|pFS03 (pSB4K5min_KpnI_DelH_BamHI) Gibson plasmid]].]]
-[[File:pFS_04.png|300px|none|thumb|Vector map of the pSB6A1 backbone with ccdB cassette [[:File:pFS_04.gb|pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid]].]]
+[[File:Heidelberg_pFS_04.png|300px|none|thumb|Vector map of the pSB6A1 backbone with ccdB cassette [[:File:Heidelberg_pFS_04.gb|pFS04 (pSB6A1_BBa_J23114_BBa_B0032_ccdB_cassette) Gibson plasmid]].]]
-[[File:pFS_05.png|300px|none|thumb|Vector map of the final DelH plasmid in pSB6A1 [[:File:pFS_05.gb|pFS05 (DelH_final_pSB6A1_BBa_J23114_BBa_B0032_KpnI_DelH_BamHI) Gibson plasmid]].]]
+[[File:Heidelberg_pFS_05.png|300px|none|thumb|Vector map of the final DelH plasmid in pSB6A1 [[:File:Heidelberg_pFS_05.gb|pFS05 (DelH_final_pSB6A1_BBa_J23114_BBa_B0032_KpnI_DelH_BamHI) Gibson plasmid]].]]
 <div style="clear:both"></div>
 <br/>