"
Team:Heidelberg/Templates/DelH overview1
From 2013.igem.org
(Difference between revisions)
(→Restriction Digest and Ligation Strategy) |
(→Vector Maps, Primers and BioBricks) |
||
| (6 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| + | [[File:Heidelberg_Del Cluster.png|400px|right|thumb|Schematic representation of DelH cluster and structure of delftibactin.]] | ||
=== Restriction Digest and Ligation Strategy === | === Restriction Digest and Ligation Strategy === | ||
| - | |||
* PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb) | * PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb) | ||
* Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks | * Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks | ||
| Line 11: | Line 11: | ||
=== Vector Maps, Primers and BioBricks=== | === Vector Maps, Primers and BioBricks=== | ||
| - | [[File: | + | [[File:Heidelberg_Res-DelH-finalplasmid.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_DelH-pSB6A1-AraC-lacZ.gb.txt|pHM01:DelH plasmid]].]] |
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
| Line 31: | Line 31: | ||
! Identifier !! Order date !! Note !! Sequence | ! Identifier !! Order date !! Note !! Sequence | ||
|- | |- | ||
| - | | DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || | + | | DN01:DelH_f1_PacI_fw || 03-05-2013 || Amplification of DelH F1, with RBS and adding PacI restriction site || TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG |
|- | |- | ||
| - | | DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI || | + | | DN02:DelH_f1_SalI_rev || 03-05-2013 || Amplification of DelH F1 until SalI || TTTT GTCGACCAACACCTGTGCCTGC |
|- | |- | ||
| - | | DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting SalI|| | + | | DN03:DelH_f2_SalI_fw || 03-05-2013 || Amplification of DelH F2 starting SalI|| TTTT GTCGACTGGATGGAGCCTGGTGAAAG |
|- | |- | ||
| - | | DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || | + | | DN04:DelH_f2_KpnI_rev || 03-05-2013 || Amplification of DelH F2, adding KpnII restriction site || TTTT GGTACC TCAGTCCAGCGCGTACTCCAG |
|- | |- | ||
| - | | DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || | + | | DN05:AraCbb_KpnI_fw || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site || TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG |
|- | |- | ||
| - | | DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || | + | | DN08:AraCbb_PacI_rev || 03-05-2013 || Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site || TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG |
|} | |} | ||
<br/> | <br/> | ||
Latest revision as of 11:03, 23 October 2013
Restriction Digest and Ligation Strategy
- PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
- Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
- Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
- Transformation of E. coli TOP10 with DelH plasmid
- Characterization of positive (blue) colonies by colony PCR
Vector Maps, Primers and BioBricks
| Backbone | Part | Distribution | Plate | Well | Usage | Resistance |
|---|---|---|---|---|---|---|
| pSB4K5 | J04450 | Spring 2012 | 1 | 5G | Backbone for DelA-G,OP,L | Kanamycin |
| pSB1AK3 | I732019 | Spring 2012 | 4 | 12G | lacZ reporter gene | Kanamycin, Ampicillin |
| pSB2K3 | I0500 | Spring 2012 | 1 | 14N | AraC promoter | Kanamycin |
| pSB6A1 | J04450 | Spring 2012 | 1 | 1K | Backbone for DelH | Ampicillin |
| pSB1C3 | J04450 | Spring 2012 | 1 | 3A | Backbone for Indigoidine | Chloramphenicol |
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| DN01:DelH_f1_PacI_fw | 03-05-2013 | Amplification of DelH F1, with RBS and adding PacI restriction site | TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG |
| DN02:DelH_f1_SalI_rev | 03-05-2013 | Amplification of DelH F1 until SalI | TTTT GTCGACCAACACCTGTGCCTGC |
| DN03:DelH_f2_SalI_fw | 03-05-2013 | Amplification of DelH F2 starting SalI | TTTT GTCGACTGGATGGAGCCTGGTGAAAG |
| DN04:DelH_f2_KpnI_rev | 03-05-2013 | Amplification of DelH F2, adding KpnII restriction site | TTTT GGTACC TCAGTCCAGCGCGTACTCCAG |
| DN05:AraCbb_KpnI_fw | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site | TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG |
| DN08:AraCbb_PacI_rev | 03-05-2013 | Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site | TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG |
