"
Team:Heidelberg/Templates/DelH overview11
From 2013.igem.org
(Difference between revisions)
| (2 intermediate revisions not shown) | |||
| Line 8: | Line 8: | ||
<br/> | <br/> | ||
===Vector Map and Primers=== | ===Vector Map and Primers=== | ||
| - | [[File:Heidelberg_FinalPlasmid. | + | [[File:Heidelberg_FinalPlasmid.png|300px|left|thumb|Vector map of the [[:File:Heidelberg_DelH-BB(Gibson-pSB6A1-AraC-lacZ).gb|pHM02:DelH-pSB6A1-AraC-lacZ Gibson-plasmid]].]] |
{| class="wikitable" style="float" | {| class="wikitable" style="float" | ||
|- | |- | ||
Latest revision as of 00:05, 5 October 2013
Gibson Strategy
- PCR amplification of entire 18 Kb DelH fragment G0, as well as sub fragments G1a and G1b
- PCR amplification of backbone pSB6A1-lacI-mRFP, simultaneously inserting Gibson
- Gibson assembly of construct DelH + backbone to DelH plasmid
- Electroporation of E. coli TOP10 with DelH plasmid
- Characterization of positive (red) colonies by colony PCR
Vector Map and Primers
| Identifier | Order Date | Note | Sequence |
|---|---|---|---|
| HM02_DelH_Gib1.1_rev | 09-07-2013 | Gibson-Primer DelH | TGCTGCGCCTGCATACGGCCAAACA |
| HM03_DelH_Gib1.2_fw | 09-07-2013 | Gibson-Primer DelH | AGCGGCAGGGACGACGTGGT |
| HM04_DelH_Gib1.2_rev | 09-07-2013 | Gibson-Primer DelH | CATAGAGGTTGTAGAGA |
| HM05_DelH_Gib2.1_fw | 09-07-2013 | Gibson-Primer DelH | AGAACGCCGTCTTCAGGCTCCTG |
| HM06_DelH_Gib2.1_rev | 09-07-2013 | Gibson-Primer DelH | CAATGCTTTG CCGCTCGAA |
| HM07_DelH_Gib2.2_fw | 09-07-2013 | Gibson-Primer DelH | TCGCCACGGCAGCTGTTCGA |
| HM08_DelH_Gib2_end_rev | 09-07-2013 | Gibson-Primer DelH | TCAGTCCAGCGCGTACTCCAG |
| HM09_AraC_RBS_DelH_rev | 09-07-2013 | Gibson-Primer rev, introduces a new RBS and has the AraC promotor and the beginning of DelH | TTGCAAAGCGCTCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ttaactTTCTCCTCTTTAATactttgagctagcccaaAaaaacggtatggagaa acagtagagagtt |
| HM10_RBS_lacZ | 09-07-2013 | Gibson-Primer fw for the pSB6A1 Backbone with the end of DelH, RBS(1) and the beginning of lacZ | TGGAGTACGCGCTGGACTGA TCTAGAG AAAGAGGAGAAA TACTAG ATGACCATGATTA |
