"
Team:Heidelberg/Templates/DelH overview21
From 2013.igem.org
(Difference between revisions)
(→Results) |
|||
| (One intermediate revision not shown) | |||
| Line 5: | Line 5: | ||
! Colonies !! Alignment File || Sequence | ! Colonies !! Alignment File || Sequence | ||
|- | |- | ||
| - | | I C5 || [[File:Heidelberg_Sequencing Result pHM04 DN07 colony 05 old.clustal | Sequencing of clone I C5 with DN_07]] || Amino Acid Substitution | + | | I C5 || [[File:Heidelberg_Sequencing Result pHM04 DN07 colony 05 old.clustal.txt | Sequencing of clone I C5 with DN_07]] || Amino Acid Substitution |
|- | |- | ||
| I C7 || sequencing insufficient || - | | I C7 || sequencing insufficient || - | ||
| Line 13: | Line 13: | ||
<div style="clear:both"></div> | <div style="clear:both"></div> | ||
<br/> | <br/> | ||
| + | |||
===Vector Maps and Primers=== | ===Vector Maps and Primers=== | ||
As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis. | As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis. | ||
Latest revision as of 11:43, 4 October 2013
Results
| Colonies | Alignment File | Sequence |
|---|---|---|
| I C5 | File:Heidelberg Sequencing Result pHM04 DN07 colony 05 old.clustal.txt | Amino Acid Substitution |
| I C7 | sequencing insufficient | - |
| I C12 | sequencing insufficient | - |
Vector Maps and Primers
As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| HM_20:BB_HPLC_rev | 11-09-2013 | HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH | GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc |
| FS_77:BB_HPLC_rev | 11-09-2013 | Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH | GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC |
| HM21:fw_lacI_BbsI_Xba | 2013-09-15 | Forward primer for cutting out mutated fragment for mutagenesis | TTTTGAAGACAA CTAGGCAATACGCAA |
| HM22:rev_RBS | 2013-09-15 | Reverse Primer in RBS for mutagenesis | TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG |
| HM23:fw_RBS | 2013-09-15 | Forward Primer in RBS for mutagenesis | TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC |
| HM24:rev_BbsI_MfeI | 2013-09-15 | Reverse primer for cutting out mutated fragment for mutagenesis | TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG |
