Team:Heidelberg/Tyrocidine week16 ov

From 2013.igem.org

(Difference between revisions)
(Primers ordered for Interspecies Fusion Experiments)
(Primers ordered for RFC 10 Standardization of Modules)
 
Line 33: Line 33:
|}
|}
-
==Primers ordered for RFC 10 Standardization of Modules==
+
==Primers ordered for RFC_10 Standardization of Modules==
{|class="wikitable"
{|class="wikitable"
|-
|-

Latest revision as of 17:09, 4 October 2013


Primers ordered for Interspecies Fusion Experiments

Identifier Order date Note Sequence
PW14:C(TycC2)-indC_rev 2013-08-16 Amplification of C-domain from TycC2 from Brevibacillus parabrevis; Gibson overhang to IndC; for construct 1, 2 & 3 ACATTGTGTAATATTATTTTCTAACAT CGTTTTGCTGCTGGCAGGCTG
PW15:C(TycC2)-indC_fwd 2013-08-16 Amplification of indC from Photorhabdus luminescens; Gibson overhang to C-domain from TycC2; for construct 1, 2 & 3 CAGCCTGCCAGCAGCAAAACG ATGTTAGAAAATAATATTACACAATGT
PW16:indC_rev 2013-08-16 Amplification of indC from Photorhabdus luminescens; no Gibson overhang; for construct 1, 2 & 3 TTAGATTATTTTCTCAATCTCAGCAACACCTTC
PW17:TycAdE-C(TycC2)_rev 2013-08-16 Amplification of TycAdE from Brevibacillus parabrevis; Gibson overhang to C-domain from TycC2; for construct 1 CGAAAGGAAGCGGGCCAGCTC AGCAACCTGCTCGATCGTCGGGTA
PW18:TycAdE-C(TycC2)_fwd 2013-08-16 Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycAdE; for construct 1 TACCCGACGATCGAGCAGGTTGCT GAGCTGGCCCGCTTCCTTTCG
PW19:TycC4dC_fwd 2013-08-16 Amplification of TycC4-module from Brevibacillus parabrevis without the C-domain; no Gibson overhang, ATG added; for construct 3 ATGTATCCGCGCGATCTGACGATTC
PW20:TycC4dC-C(TycC2)_rev 2013-08-16 Amplification of TycC4-module from Brevibacillus parabrevis without the C-domain; Gibson overhang to C-domain form TycC2; for construct 3 GGTGTACTCGGTTTTTTCCGA AATATGCGCAGCCAACTCATG
PW21:TycC4dC-C(TycC2)_fwd 2013-08-16 Amplification of C-domain from TycC2-module from Brevibacillus parabrevis; Gibson overhang to TycC4dC; for construct 3 CATGAGTTGGCTGCGCATATT TCGGAAAAAACCGAGTACACC
PW22:pSB1C3-TycC4dC_rev 2013-08-16 Insertion of construct 3 into pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC4dC; for construct 3 GAATCGTCAGATCGCGCGGATACAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG
PW23:indC-pSB1C3_fwd 2013-08-16 Insertion of either fragments into pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to indC from Photorhabdus luminescens; for constructs 1, 2 & 3 GGTGTTGCTGAGATTGAGAAAATAATCTAA TAATAACGCTGATAGTGCTAGTGTAGATC
PW24:TycC1dC_fwd 2013-08-16 Amplification of the TycC1-module from Brevibacillus parabrevis without the C-domain; no Gibson overhang, ATG added; for construct 2 ATGCAGACGAACAAACAACAGACG
PW25:pSB1C3-TycC1dC 2013-08-16 Insertion of construct 2 in pSB1C3-backbone, amplification of pSB1C3; Gibson overhang to TycC1-module without C-domain; for construct 2 CGTCTGTTGTTTGTTCGTCTGCAT CTAGTATTTCTCCTCTTTCTCTAGTATGTG

Primers ordered for RFC_10 Standardization of Modules

Identifier Order date Note Sequence
AT01:RFC10prefix_TycA_fw 2013-08-12 Fw primer for amplification of TycAdCom; introduction of RFC10 prefix TTTT GAATTC GCGGCCGC T TCTAG ATG TTA GCA AAT CAa GCC AAT C
AT02:RFC10suffix_TycA_rv 2013-08-12 Rv primer for amplification of TycAdCom; introduction of RFC10 suffix TTTT CTGCAG CGGCCGC T ACTAGT A aGT TCG tTC TAC TTC TTT TTT C
AT03:RFC10prefix-TycB1_fw 2013-08-12 Fw primer for amplification of TycB1dCom; introduction of RFC10 prefix TTTT GAATTC GCGGCCGC T TCTAG ATG AGT GTA TTT AGC AAA GAA CAA G
AT04:RFC10suffix_TycB1_rv 2013-08-12 Rv primer for amplification of TycB1dCom; introduction of RFC10 suffix TTTT CTGCAG CGGCCGC T ACTAGT A TTC CTC CCC aCC TTC
AT05:RFC10prefix-TycC5_fw 2013-08-12 Fw primer for amplification of TycC5; introduction of RFC10 prefix TTTT GAATTC GCGGCCGC T TCTAG AG GCG CAT ATT GCa GAG AG
AT06:RFC10suffix_TycC5_rv 2013-08-14 Rv primer for amplification of TycC5; introduction of RFC10 suffix TTTT CTGCAG CGGCCGC T ACTAGT A TTT GGC TGT CTC TTC GAT GAA C
AT07:RFC10prefix-TycC6_fw 2013-08-12 Fw primer for amplification of TycC6; introduction of RFC10 prefix TTTT GAATTC GCGGCCGC T TCTAG AG GGG AAT GTC TTC TCG ATC
AT08:RFC10suffix_TycC6_rv 2013-08-14 Rv primer for amplification of TycC6; introduction of RFC10 suffix TTTT CTGCAG CGGCCGC T ACTAGT A TTA TTT CAG GAT aAA CAG TTC TTG
AT09:R10_B1_fw_longer 2013-08-18 Fw primer (longer) for amplification of TycB1dCom; introduction of RFC10 prefix TTTT GAA TTC GCG GCC GCT TCT AG ATG AGT GTA TTT AGC AAA GAA CAA GTT C
AT10:R10_B1_rv_longer 2013-08-18 Rv primer (longer for amplification of TycB1dCom; introduction of RFC10 suffix TTTT CTG CAG CGG CCG CTA CTA GTA ATA CGC aCT TTC CTC CCC GCC
AT11:R10_C5_fw_rpos 2013-08-18 Fw primer (repositioned) for amplification of TycC6; introduction of RFC10 prefix TTTT GAATTC GCGGCCGC T TCTAG AG GAGCAGTTCGAGACGATCCAGCC