Team:Heidelberg/Templates/Del week11 overview

From 2013.igem.org

(Difference between revisions)

Latest revision as of 18:21, 4 October 2013

Strategy

Vector map of pFSN plasmid including Primers FS_01 to FS_16 used for assembly of the desired genes from the D. acidovorans genome as well as the partsregistry backbone pSB4K5 .

We had various problems with the amplification of the fragments located in theregion DelF-G and DelO-P. For these particular PCRs long primers containing the Gibson overlaps had to be used. As these long primers often form complex secondary structures decreasing annealing efficiency we designed short version of these primers, having the same sequence region complementary to the genomic target, but lacking any longer overhangs. Consequently these primesrs will serve only for amplification of the desired genes from the genome of D. Acidovorans to obtain specific templates. This specific template afterwards will be used to introduce the designated overlap using the long primers again. In total 3 short primer versions FS_11s, FS_13s and FS_15s were ordered.

Primer pairs, corresponding sequences and usage

Identifier	Order date	Note	Sequence
FS_11: DelAG_5_short_rv	2013-05-07	Amplification of DelAG from Delftia acidovorans. Gibson Primer	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_13: DelOP_short_rv	2013-05-07	Amplification of DelOP from Delftia acidovorans. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-05-07	Amplification of DelL. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG

Amplification of Del Genes from DSM-39 genome

Goals

The PCRs which worked in the previous week will be repeated to obtain higher product yields, as high concentrations of the long amplicons are needed for a successfull Gibson Assembly. Furthermore we will try to establish PCRs for the obtained short Primers and thereby provide specific templates for the second amplification step using the corresponding primers introducing the required Gibson overlaps. Amplifications of the sequence region DelF-G will be tried with different protocols to optimize PCR conditions, as we did not obtain any amplicons at all last week. Therefore it is likely that these primers are only able to bind in a very small frame of annealing temperature or even that the used primer combination do not posses a common annealing temperature and therefore amplification with the desired combinations is not possible.

As the amplification of DelO-P also turned out to be difficult, we decided to try a backup strategy which not only includes the desired genes DelO and DelP but also DelL and, since they are located between DelP and DelL, DelM and DelN. These two genes would increase our amplicon size by only 2.2 kb, but we hoped that on the other hand the corresponding primers would work better.

Results

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelE-G	FS_04 and FS_11s
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
		FS_06 and FS_11s
	DelG	FS_08 and FS_11s
		FS_10 and FS_11
		FS_10 and FS_11s
DelO DelP DelL	DelO-P	FS_12 and FS_13
	DelO-P	FS_12 and FS_13s
	DelL	FS_14 and FS_15
	DelL-P	FS_13 and FS_15s
pSB4K5	pSB4K5	FS_01 and FS_16

Re-PCRs
Gene(s)	Fragment	Primer combination	Successful?
DelF DelG	DelF-G	Primer FS_06 and FS_09
DelO DelP DelL	DelL-P	Primer FS_13_short and FS_15_short

@@ Line 9: / Line 9: @@
 <div style="clear:both"></div>
-The ordered primers, their functions and sequences are listed below:
+====Primer pairs, corresponding sequences and usage====
 {| class="wikitable"
 |-
@@ Line 30: / Line 30: @@
 ====Results====
-In the following table the outcomes of this weeks PCRs are summarized.
 {| class="wikitable"