From 2013.igem.org
(Difference between revisions)
|
|
| Line 1: |
Line 1: |
| | { | | { |
| - | "date" : "2013-06-06", | + | "date" : "2013-06-18", |
| - | "author" : "thomas-emil", | + | "author" : "thomas", |
| - | "title" : "First SAMsynthase extraction attempt - FAILED ", | + | "title" : "Inocula of AraCpBAD and EFE in pSB1C3", |
| - | "content" : "We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.'''Foward:''' GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT'''Reverse:''' CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAGFor the protocol used see the <html><a href=\"https://2013.igem.org/Team:UNITN-Trento/Protocols#Phusion-PCR\">Phusion PCR protocol</a></html>..When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).<B>Results:</B>{{:Team:UNITN-Trento/Templates/Styles/Spoiler|Gel Image|<html><img id=\"post_img\" src=\"https://static.igem.org/mediawiki/2013/0/0a/Tn-20130605-gelschifo.jpg\" /></html>}}As you can see from our gel image, our product is not present.The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!", | + | "content" : "I inoculated the previously transformed EFE in pSB1C3 and AraCpBAD into 5ml of LB containing Chloramphenicol.", |
| - | "tags" : "SAMsynthetase" | + | "tags" : "EFE-AraCpBAD" |
| | } | | } |
Latest revision as of 07:50, 3 October 2013
{
"date" : "2013-06-18",
"author" : "thomas",
"title" : "Inocula of AraCpBAD and EFE in pSB1C3",
"content" : "I inoculated the previously transformed EFE in pSB1C3 and AraCpBAD into 5ml of LB containing Chloramphenicol.",
"tags" : "EFE-AraCpBAD"
}
"
