We choose promoters J23102、J23106 and J23116 to construct double tandem promoters from the current iGEM biobrick kit, taking the PAM region which is necessary for gRNA targeting into consideration. And because the three promoters have comparatively large divergence of transcript strength, which can provide us more regulation sites and a obvious expression difference to detect.

According to the standard of biobrick construction, we get these three promoters from biobrick BBa_J23102, BBa_J23106 and BBa_J23116 by restriction enzyme digestion. Then we combine two of them with different orders respectively and transfer the double tandem promoters with the report gene RFP to the expression vector pSB2K3. Through the analysis of the fluorescence/OD600 ratios, we identify the relevant transcription strength.

Improve strategy
To exclude the problem of the divergence of plasmid copy number in different sample groups, which would make the result not that accurate. We design a double fluorescence system to detect the expression level of each double tandem promoters, eliminating the instability of plasmids.

We construct the report protein mCherry and EYFP on the same plasmid pSB1C3. When at detection, we set the fluorescence of EYFP as the control, and use the fluorescencem/fluorescencee ratios to represent the relative transcription strength

Here we choose J23106-J23116 double tandem promoters as the final platform to conduct the following experiment, because this combination would have the most obviously different transcription strength.

Here show the J23106-J23116 double tandem promoters sequence:

dCas9

质粒构建 图！！！

We want to use dCas9 system as a flexible device to regulate gene transcription, either activation or repression, by the accurate targeting of guide RNA at different sites with different function.

It has reported that Cas9 nuclease mutant that retains DNA-binding activity and can be engineered as a programmable transcription repressor by preventing the binding of the RNA polymerase (RNAP) to promoter sequences or as a transcription terminator by blocking the running RNAP. In addition, a fusion between the omega subunit of the RNAP and a Cas9 nuclease mutant directed to bind upstream promoter regions can achieve programmable transcription activation.(Please refer to the background part)

Considering the omega subunit is a important part RNAP, we hypothesis that binding it directly to dCas9 might have negative effect on the elongation of transcription later.

So we design another device using the interaction through the fusion protein between dCas9 and alpha subunit of RNAP, because we do not find a suitable activator in procaryotic system, here is E.coli.

We choose three pairs of protein, cI-cI, Gal4-Gal11, Gal11-VP16, every two of them have a inter- attraction to other other, through searching and analyzing by bioinfomatics in serval database.

Here we sincerely thank Doudna Lab and Addgene because we get the plasmid which contains dCas9 gene which contained two silencing mutations of the RuvC1 and HNH nuclease domains (D10A and H841A) from Doudna Lab freely through Addgene. And from this plasmid we get the dCas9 gene through PCR.

Since dCas9 gene is very difficult to ligate to biobrick, we change to use Gibson assembly to add it to BBa_J13002 successfully. And deal it with restriction enzyme XbaI and PstI to get the dCas9 together with promoter.

After fusing dCas9 with the fusion protein or dCas9 alone, then we insert the gRNA, which is constructed by three-cycle overlap PCR, into the downstream of dCas9/dCas9-fusion subunit, to complete a whole regulation device on pSB1C3.

guide RNA

The accurate targeting of CRISPR system is relied on the complementary base pair of guide RNA and the targeted DNA, which leads the dCas9 device to function at the right region. However this targeting sites has a PAM region limitation, namely an NGG just downstream the N20 target gene.

Here we choose J23106-J23116 double tandem promoters as the platform to show the regulation of activation or repression based on dCas9 system we designed.


gaacctcttacgtgcccgatcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacg(active-4)aggcagaatttcagataaaaaaaatcct(active-2)tagctttcgctaaggatgatttc(active-3)tggaattcg(active-5)cggccg(CA6)cttctagag(106+116)TTTA(CI2)CGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAG AGTTGACAGCTAGCTCAGTCCTA(CI1)GGGACTATGCTAGCTACTAGGAAAGAGGAGAAATACTAGATG
（形式待定）


Then we find several targeting sites on this double tandem promotors, including both activation(A1,A2,A3,A4,A5) and repression(R1, R2) sites after searching the PAM region. Based on these sites, N20 regions of gRNA are designed, other parts of functional chimeric gRNA, namely dCas9 binding handle, promoter and terminator, are combined with N20 region as a whole guide RNA through three cycle-overlap PCR.