Team:UC Chile/Team Members

From 2013.igem.org

(Difference between revisions)
Line 170: Line 170:
                     <div class="text_imgMenu">
                     <div class="text_imgMenu">
                         <div id="imgMenu_cont0" class="imgMenu_cont in_the_flow">
                         <div id="imgMenu_cont0" class="imgMenu_cont in_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_maida.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/1/17/Team_UC_Chile_Team_maida.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Magdalena Ribbeck</h1>
                                 <h1>Magdalena Ribbeck</h1>
Line 185: Line 185:
                         </div>
                         </div>
                         <div id="imgMenu_cont1" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont1" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_Vale.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/c/c7/Team_UC_Chile_Team_Vale.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Valentina Frenkel</h1>
                                 <h1>Valentina Frenkel</h1>
Line 200: Line 200:
                         </div>
                         </div>
                         <div id="imgMenu_cont2" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont2" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_Chino.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/f/f3/Team_UC_Chile_Team_Chino.jpg">
                             <div class="imgMenu_text">                 
                             <div class="imgMenu_text">                 
                                 <h1>Felipe Ignacio Erices Canales</h1>
                                 <h1>Felipe Ignacio Erices Canales</h1>
Line 215: Line 215:
                         </div>
                         </div>
                         <div id="imgMenu_cont3" class="imgMenu_cont off_the_flow">             
                         <div id="imgMenu_cont3" class="imgMenu_cont off_the_flow">             
-
                             <img class="foto_Team" src="Imagenes/Team_Ile.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/4/44/Team_UC_Chile_Team_Ile.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Ilenne Del Valle.</h1>
                                 <h1>Ilenne Del Valle.</h1>
Line 230: Line 230:
                         </div>
                         </div>
                         <div id="imgMenu_cont4" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont4" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_jose.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/1/13/Team_UC_Chile_Team_jose.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Josefina Philippi</h1>
                                 <h1>Josefina Philippi</h1>
Line 245: Line 245:
                         </div>
                         </div>
                         <div id="imgMenu_cont5" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont5" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_seba2.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/d/da/Team_UC_Chile_Team_seba.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Sebastián Álvarez</h1>
                                 <h1>Sebastián Álvarez</h1>
Line 260: Line 260:
                         </div>
                         </div>
                         <div id="imgMenu_cont6" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont6" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_lero.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/7/7f/Team_UC_Chile_Team_lero.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Javier Cillero</h1>
                                 <h1>Javier Cillero</h1>
Line 275: Line 275:
                         </div>
                         </div>
                         <div id="imgMenu_cont7" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont7" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_Belen.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/9/9f/Team_UC_Chile_Team_Belen.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Belén Céspedes</h1>
                                 <h1>Belén Céspedes</h1>
Line 290: Line 290:
                         </div>
                         </div>
                         <div id="imgMenu_cont8" class="imgMenu_cont off_the_flow">
                         <div id="imgMenu_cont8" class="imgMenu_cont off_the_flow">
-
                             <img class="foto_Team" src="Imagenes/Team_manuel.jpg">
+
                             <img class="foto_Team" src="https://static.igem.org/mediawiki/2013/1/1b/Team_UC_Chile_Team_manuel.jpg">
                             <div class="imgMenu_text">
                             <div class="imgMenu_text">
                                 <h1>Manuel Álamo</h1>
                                 <h1>Manuel Álamo</h1>

Revision as of 11:13, 26 September 2013

Wiki-IGEM

Team Members

Magdalena Ribbeck

XX - ATGGCAGGCGATGCACTGGAAAACGCA  AGAATTTAATAAGAGTGTAAG

Occupation:Civil Engineer in Biotechnology.
iGEM:Videogame realization and lab work.
Likes to:Write, read about psychology, to draw and to practice Judo.
Frustrated Dream:To be a writer.
Fun fact:Reads “Origin of species”, Charles Darwin, for fun.
Lab mistake:Spill chloroform on Valentina.

Valentina Frenkel

XX - GTCGCCCTTGAGAACACAATTAATGCC TTCAGAGAGAATAAAGAGCTC

Occupation:Civil Engineer in Biotechnology.
iGEM:Primer design. Wiki and videogame development. Lab work.
Likes to:Draw, watch anime and series, play Lucas arts games (Monkey island, Grim fandango, Full throttle, etc) and Pokemon.
Frustrated Dream:To be able to do better illustrations and play an instrument professionally.
Fun fact:She does not believe in photographs, she thinks she can get a better capture of the essence of people through her cute drawings.
Lab mistake:Use the whole stock pHnCBS1D instead of the dilution.

Felipe Ignacio Erices Canales

XY - TTTGAGCTTATACCCGAG GAAAGAATTTGTGAGTCT

Occupation:Civil Engineer in Biotechnology.
iGEM:Human translator to 1&0 and hunter of optimal sequences. Wiki programing and lab work.
Likes to:Do sports, eat pineapple and corn pizza, random Youtube videos, eat Inca Gold, share food, solve puzzles and do origami.
Frustrated Dream:Not to be ignored, try to keep the lab neat and be able to hibernate.
Fun fact:He can split an apple in half just with his hands.
Lab mistake:Run an important gel without the ladder.

Ilenne Del Valle.

XX - ATACTTGAAAACAACGAG GATGAATTG GTAGCGTTGCTAGAA

Occupation:Biochemist
iGEM:Prevention of future complications. Lab work organization and administration. Experimental design.
Likes to:Practice Judo and read.
Frustrated Dream:That the iGEM team doesn’t think that she is sending the emails while angry at them.
Fun fact:She has a really high rate of paper reading. She did an exchange program in US. She suffers for being the only vegetarian in a carnivorous group.
Lab mistake:Break a huge ellermeyer flask the very first day in the lab and in front of the boss.

Josefina Philippi

XX - TAATAAAGCGAATTTATAAACGCG CCACACATCCTGATACCTCCAATA

Occupation:Economist and Biologist.
iGEM:Team’s boss. Bureaucratics and lab experiment management.
Likes to:Cook, sitcom series, "The Little Prince" and the beach.
Frustrated Dream:To be a good singer.
Fun fact:She makes the lab explode with dry ice.
Lab mistake:Make a high concentrated RedGel Agarose and stain Lab notebook with chloroform.

Sebastián Álvarez

XY - AGCGAGTAAGCGTCTACTATTGCCAAT GCGTTGGTGGCCAGGGAGTAA

Occupation:Biologist.
iGEM:More that he can handle, but not enough to get credit for it.
Likes to:Swim (male marmaid aka marman), eat sushi, the amazing word of science fiction with authors like Isaac Asimov, comedy and staff.
Frustrated Dream:To grow a majestic beard, the manliest ever seen.
Fun fact:He won a masculinity contest of napkin folding and burnt a part of his hair trying to hear fire.
Lab mistake:Leave the centrifuge working with no tubes inside … all night long.

Javier Cillero

XY - TAAGCAGTTATTGAAAGG TGCATCCTACTTGAGCGCTAA

Occupation:Biologist.
iGEM:Lab work and experimental design.
Likes to:Play soccer, go to the stadium, walk under the rain and feel like a fish.
Frustrated Dream:To be a soccer player and be able to play any instrument.
Fun fact:He can make cigarette smoke rings. Has a collection of beer cans, USA, prepare!.
Lab mistake:He told us “I’m immune to those mistakes … noobies”. The next day he dropped ALL THE IMPORTANT TUBES, that took us months to do, and broke the containing box.

Belén Céspedes

XX - TAAGAGTTAGAAAAC TGCGAATCTCCCGAGGACGAGAGT

Occupation:Physicist.
iGEM:Mathematical modelling, Human Practices and paper traffic.
Likes to:Play with animals and plants, eat deserts and collect stuff. Drink Quatro Guaraná.
Frustrated Dream:To make a sound biosensor and cure the world from Malaria. Join Cirque du Soleil.
Fun fact:She can talk with animals, juggles and rides a monocycle. She’s allergic to everything.
Lab mistake:She transplant the Nicotianas and change the order of the plants so, we didn’t know which plants had the GFP. We had to redo all genomic extraction.

Manuel Álamo

XY - ATGGCCAACTAAGAGTTG GCACTCGCCATGTAA

Occupation:Physicist.
iGEM:Mathematical modeling and Human Practice organization.
Likes to:Argue and annoy. Watch Slam Dunk and Captain Tsubasa, drink “mate” and read about politics.
Frustrated Dream:Have a good voice, be able to draw, recognize colors, have good eyesight and more time.
Fun fact:Not a funny guy.
Lab mistake:Nobody knows how he made a gel that didn’t solidify.