"
Team:Heidelberg/Templates/DelH overview13
From 2013.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | |||
===Vector Map and Primers=== | ===Vector Map and Primers=== | ||
| - | [[File:Heidelberg_Construct-plasmid. | + | [[File:Heidelberg_Construct-plasmid.png|300px|left|thumb|Vector map of the [[File:Heidelberg_PSB6A1+DelH.gb|pHM03:DelH-pSB6A1-lacZ-mRFP Gibson plasmid]].]] |
{| class="wikitable" | {| class="wikitable" | ||
|- | |- | ||
Revision as of 23:01, 3 October 2013
Vector Map and Primers
| Identifier | Order date | Note | Sequence |
|---|---|---|---|
| HM_11:lacI_RBS(1)_DelH_rev | 22-07-2013 | Amplification of Backbone pSb6A1-lacZ-mRFP | TCGGCGATTTGGCGCAGGCGGCCACGGTCCAT ctagtatttctcctctttctctagtatgtgtg |
| HM_12:DelH_RBS(1.2)_mRFP_fw | 22-07-2013 | Amplification of Backbone pSb6A1-lacZ-mRFP | ATTGGCGCTGGAGTACGCGCTGGACTGA tcaaagtATTAAAGAGGAGAAagttaaat ggcttcctccgaagacgttatcaAagag |
