Team:Heidelberg/Templates/DelH overview21
From 2013.igem.org
(Difference between revisions)
Line 1: | Line 1: | ||
- | |||
===Results=== | ===Results=== | ||
{| class="wikitable" | {| class="wikitable" | ||
Line 5: | Line 4: | ||
! Colonies !! Alignment File || Sequence | ! Colonies !! Alignment File || Sequence | ||
|- | |- | ||
- | | I C5 || [[File:Heidelberg_Sequencing Result pHM04 DN07 colony 05 old.clustal | Sequencing of clone I C5 with DN_07]] || Amino Acid Substitution | + | | I C5 || [[File:Heidelberg_Sequencing Result pHM04 DN07 colony 05 old.clustal.txt | Sequencing of clone I C5 with DN_07]] || Amino Acid Substitution |
|- | |- | ||
| I C7 || sequencing insufficient || - | | I C7 || sequencing insufficient || - |
Revision as of 23:11, 3 October 2013
Results
Colonies | Alignment File | Sequence |
---|---|---|
I C5 | File:Heidelberg Sequencing Result pHM04 DN07 colony 05 old.clustal.txt | Amino Acid Substitution |
I C7 | sequencing insufficient | - |
I C12 | sequencing insufficient | - |
Vector Maps and Primers
As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.
Identifier | Order date | Note | Sequence |
---|---|---|---|
HM_20:BB_HPLC_rev | 11-09-2013 | HPLC version of HM11 Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH | GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc |
FS_77:BB_HPLC_rev | 11-09-2013 | Gibson-Primer rev, amplify the Backbone with overlap with the RBS and the lacI-promotor and it creates and overlap to the start of DelH | GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC |
HM21:fw_lacI_BbsI_Xba | 2013-09-15 | Forward primer for cutting out mutated fragment for mutagenesis | TTTTGAAGACAA CTAGGCAATACGCAA |
HM22:rev_RBS | 2013-09-15 | Reverse Primer in RBS for mutagenesis | TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG |
HM23:fw_RBS | 2013-09-15 | Forward Primer in RBS for mutagenesis | TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC |
HM24:rev_BbsI_MfeI | 2013-09-15 | Reverse primer for cutting out mutated fragment for mutagenesis | TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG |