"
Team:Paris Bettencourt/BioBricks
From 2013.igem.org
Zmarinkovic (Talk | contribs) |
|||
| Line 33: | Line 33: | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
<p> | <p> | ||
| - | TDMH is a trehalose 6,6’ dimycolate (TDM) esterase serine esterase superfamily that can hydrolyze purified TDM from various mycobacterial species. TDM is one of the most potent immunomodulatory and granulomatogenic surface glycolipids and it is highly abundant in at least ten species of pathogenic and non-pathogenic mycobacteria. Additonally TDM is crucial to the structural integrity of the mycobacterial envelope. As such, TDMH triggers rapid and extensive lysis of mycobacterial species due to the release of free mycolic acids from the non-covalently associated mycolyl-containing glycolipids. | + | TDMH is a trehalose 6,6’ dimycolate (TDM) esterase serine esterase superfamily that can hydrolyze purified TDM from various mycobacterial species. TDM is one of the most potent immunomodulatory and granulomatogenic surface glycolipids and it is highly abundant in at least ten species of pathogenic and non-pathogenic mycobacteria. Additonally TDM is crucial to the structural integrity of the mycobacterial envelope. As such, TDMH triggers rapid and extensive lysis of mycobacterial species due to the release of free mycolic acids from the non-covalently associated mycolyl-containing glycolipids. |
</p> | </p> | ||
</div> | </div> | ||
<div class="rightparagraph"> | <div class="rightparagraph"> | ||
| - | <p>We biobricked TDMH as a method for lysing Mycobacteria including M. smegmatis and M. Tuberculosis. We have demonstrated experimentally that TDMH is effective at killing M. smegmatis when secreted by E. coli. We expressed TDMH on a T7 promoter within lacO sites inserted such that it could be induced by IPTG (Invitrogen Duet Vector) at a concentration of 1mM and found that TDMH was effective when the M. smegmatis to E. coli ratio 1:1 or 10:1. Higher ratios of M. smegmatis to E. coli were no longer effective. | + | <p> We biobricked TDMH as a method for lysing Mycobacteria including M. smegmatis and M. Tuberculosis. We have demonstrated experimentally that TDMH is effective at killing M. smegmatis when secreted by E. coli. We expressed TDMH on a T7 promoter within lacO sites inserted such that it could be induced by IPTG (Invitrogen Duet Vector) at a concentration of 1mM and found that TDMH was effective when the M. smegmatis to E. coli ratio 1:1 or 10:1. Higher ratios of M. smegmatis to E. coli were no longer effective. |
</p> | </p> | ||
</div> | </div> | ||
| Line 43: | Line 43: | ||
<h2>Part: BBa_K1137009 (sRNA anti Kan) </h2> | <h2>Part: BBa_K1137009 (sRNA anti Kan) </h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>This complex part contains everything necessary to express small RNA to inhibit expression of the Kanamycin resistance cassette encoding Aminoglycoside N6'-acetyltransferase. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CGTTTCCCGTTGAATATGGCT binds to the target sequence of ATGAGCCATATTCAACGGGAAACG including the start codon and the first 24 bp of the kanamycin ORF within the mRNA. It is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the kanamycin resistance cassette at this location, or a different kanamycin cassette is targeted the biobrick will not function correctly. | + | <p> This complex part contains everything necessary to express small RNA to inhibit expression of the Kanamycin resistance cassette encoding Aminoglycoside N6'-acetyltransferase. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CGTTTCCCGTTGAATATGGCT binds to the target sequence of ATGAGCCATATTCAACGGGAAACG including the start codon and the first 24 bp of the kanamycin ORF within the mRNA. It is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the kanamycin resistance cassette at this location, or a different kanamycin cassette is targeted the biobrick will not function correctly. |
</p> | </p> | ||
</div> | </div> | ||
| Line 52: | Line 52: | ||
<h2>Part: BBa_K1137010 (sRNA anti Cm)</h2> | <h2>Part: BBa_K1137010 (sRNA anti Cm)</h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>This complex part contains everything necessary to express small RNA to inhibit expression of the Chloramphenicol resistance cassette cat encoding chloramphenicol acetyltransferase. Very similar to BBa_K1137010, the biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence ATATCCAGTGATTTTTTTCTC binds to the target sequence of ATGGAGAAAAAAATCACTGGATAT which includes the start codon and the first 24 bp of the ORF within the chloramphenicol mRNA. As above, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the cat cassette at this location, or a different mechanism provides chloramphenicol resistance the biobrick will not function correctly. | + | <p> This complex part contains everything necessary to express small RNA to inhibit expression of the Chloramphenicol resistance cassette cat encoding chloramphenicol acetyltransferase. Very similar to BBa_K1137010, the biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence ATATCCAGTGATTTTTTTCTC binds to the target sequence of ATGGAGAAAAAAATCACTGGATAT which includes the start codon and the first 24 bp of the ORF within the chloramphenicol mRNA. As above, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the cat cassette at this location, or a different mechanism provides chloramphenicol resistance the biobrick will not function correctly. |
</p> | </p> | ||
</div> | </div> | ||
| Line 61: | Line 61: | ||
<h2>Part: BBa_K1137011 (sRNA anti Lac) </h2> | <h2>Part: BBa_K1137011 (sRNA anti Lac) </h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>Highly similar to BBa_K1137009 and BBa_K1137010, this part contains everything necessary to express small RNA to inhibit expression of lacZ. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CAGTGAATCCGTAATCATGGT bind to the target sequence of ATGACCATGATTACGGATTCACTG which includes the start codon and the first 24 bp of the ORF within the lacZ mRNA. As in the previously described biobricks, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within the lacZ gene or biobrick sequence the biobrick will not function correctly. Additionally, there will be some leakage of β-Galactosidase which will cause cleavage of X-Gal, however we observed that edges of colonies tended to be white while the center of colonies tended to be blue. | + | <p> Highly similar to BBa_K1137009 and BBa_K1137010, this part contains everything necessary to express small RNA to inhibit expression of lacZ. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CAGTGAATCCGTAATCATGGT bind to the target sequence of ATGACCATGATTACGGATTCACTG which includes the start codon and the first 24 bp of the ORF within the lacZ mRNA. As in the previously described biobricks, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within the lacZ gene or biobrick sequence the biobrick will not function correctly. Additionally, there will be some leakage of β-Galactosidase which will cause cleavage of X-Gal, however we observed that edges of colonies tended to be white while the center of colonies tended to be blue. |
</p> | </p> | ||
</div> | </div> | ||
| Line 69: | Line 69: | ||
<h2>Part:BBa_K1137000 (<i>M. Smegmatis</i> SirA)</h2> | <h2>Part:BBa_K1137000 (<i>M. Smegmatis</i> SirA)</h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>This biobrick encodes a Ferredoxin-dependent sulfite reductase SirA, which reduces sulfite to hydrogen sulfide in the cysteine metabolism pathway. Due to the sensitivity of sulfur contain amino acids to oxidative stress; they must constantly be replenished in mycobacteria while inside the phagosome. Thus sirA is one of the few genes that is upregulated even in latent mycobacterial infections. Additionally, SirA differs from E. coli and Human sulfite reductases in its use of ferredoxin as an electron done instead of NADPH. As a result sirA has been previously identified as a drug target candidate for M. Tuberculosis infections. SirA reduces sulfite in the following reaction (EC=1.8.7.1): | + | <p> This biobrick encodes a Ferredoxin-dependent sulfite reductase SirA, which reduces sulfite to hydrogen sulfide in the cysteine metabolism pathway. Due to the sensitivity of sulfur contain amino acids to oxidative stress; they must constantly be replenished in mycobacteria while inside the phagosome. Thus sirA is one of the few genes that is upregulated even in latent mycobacterial infections. Additionally, SirA differs from E. coli and Human sulfite reductases in its use of ferredoxin as an electron done instead of NADPH. As a result sirA has been previously identified as a drug target candidate for M. Tuberculosis infections. SirA reduces sulfite in the following reaction (EC=1.8.7.1): |
<center><img src="https://static.igem.org/mediawiki/2013/c/c4/PB_SirA_equation.png"></center> | <center><img src="https://static.igem.org/mediawiki/2013/c/c4/PB_SirA_equation.png"></center> | ||
</p> | </p> | ||
</div> | </div> | ||
<div class="rightparagraph"> | <div class="rightparagraph"> | ||
| - | <p>Thus this gene can be used to provide cysteine in E. coli strains that lack a native cysI gene and allow for growth on minimal media. However, to do so it requires co-expression of biobricks BBa_K1137001 and BBa_K1137002. Even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. M. Smegmatis sirA has high homology (about 89%) to sirA from M. Tuberculosis. | + | <p> Thus this gene can be used to provide cysteine in E. coli strains that lack a native cysI gene and allow for growth on minimal media. However, to do so it requires co-expression of biobricks BBa_K1137001 and BBa_K1137002. Even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. M. Smegmatis sirA has high homology (about 89%) to sirA from M. Tuberculosis. |
</p> | </p> | ||
</div> | </div> | ||
| Line 80: | Line 80: | ||
<h2>Part:BBa_K1137001 (<i>M. Smegmatis</i> FprA)</h2> | <h2>Part:BBa_K1137001 (<i>M. Smegmatis</i> FprA)</h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>This biobrick encodes a NADPH-ferredoxin reductase FprA. This replenishes FdxA by reducing it with NADPH as an electron donor and is required for the proper function of BBa_K1137000 along with BBa_K1137001 in the following reaction (EC=1.18.1.2):</br></br> | + | <p> This biobrick encodes a NADPH-ferredoxin reductase FprA. This replenishes FdxA by reducing it with NADPH as an electron donor and is required for the proper function of BBa_K1137000 along with BBa_K1137001 in the following reaction (EC=1.18.1.2):</br></br> |
<center><img src="https://static.igem.org/mediawiki/2013/d/dd/PB_FprA_equation.png"></center> | <center><img src="https://static.igem.org/mediawiki/2013/d/dd/PB_FprA_equation.png"></center> | ||
</p> | </p> | ||
</div> | </div> | ||
<div class="rightparagraph"> | <div class="rightparagraph"> | ||
| - | <p>FprA in addition to SirA has low homology to mammalian proteins and contains one tightly bound FAD. Additonally it has been well characterized and it’s kinetics determined experimentally. As mentioned under BBa_K1137000, even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. FprA from M. Smegmatis has a homolog in M. Tuberculosis. | + | <p> FprA in addition to SirA has low homology to mammalian proteins and contains one tightly bound FAD. Additonally it has been well characterized and it’s kinetics determined experimentally. As mentioned under BBa_K1137000, even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. FprA from M. Smegmatis has a homolog in M. Tuberculosis. |
</p> | </p> | ||
</div> | </div> | ||
| Line 91: | Line 91: | ||
<h2>Part:BBa_K1137002 (<i>M. Smegmatis</i> FdxA)</h2> | <h2>Part:BBa_K1137002 (<i>M. Smegmatis</i> FdxA)</h2> | ||
<div class="leftparagraph"> | <div class="leftparagraph"> | ||
| - | <p>This biobrick encodes a 7Fe ferredoxin which is an orthologue of ferredoxin FdxC in M. Tuberculosis. It contains both one 3Fe-4S and one 4Fe-4S cluster. FdxA is the preferred substrate of FprA and is required for the proper functioning of SirA for sulfite reduction during cysteine metabolism. | + | <p> This biobrick encodes a 7Fe ferredoxin which is an orthologue of ferredoxin FdxC in M. Tuberculosis. It contains both one 3Fe-4S and one 4Fe-4S cluster. FdxA is the preferred substrate of FprA and is required for the proper functioning of SirA for sulfite reduction during cysteine metabolism. |
</p> | </p> | ||
</div> | </div> | ||
<div class="rightparagraph"> | <div class="rightparagraph"> | ||
| - | <p>Thus it required for growth on minimal media. We were able to obtain growth from an E. coli strain lacking native cysI in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137000 and BBa_K1137001. | + | <p> Thus it required for growth on minimal media. We were able to obtain growth from an E. coli strain lacking native cysI in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137000 and BBa_K1137001. |
</p> | </p> | ||
</div> | </div> | ||
Revision as of 13:33, 4 October 2013
<body>
Add abstract and hyperlink to BioBricks in the Parts Registry
Part: BBa_K1137008 (TDMH)
TDMH is a trehalose 6,6’ dimycolate (TDM) esterase serine esterase superfamily that can hydrolyze purified TDM from various mycobacterial species. TDM is one of the most potent immunomodulatory and granulomatogenic surface glycolipids and it is highly abundant in at least ten species of pathogenic and non-pathogenic mycobacteria. Additonally TDM is crucial to the structural integrity of the mycobacterial envelope. As such, TDMH triggers rapid and extensive lysis of mycobacterial species due to the release of free mycolic acids from the non-covalently associated mycolyl-containing glycolipids.
We biobricked TDMH as a method for lysing Mycobacteria including M. smegmatis and M. Tuberculosis. We have demonstrated experimentally that TDMH is effective at killing M. smegmatis when secreted by E. coli. We expressed TDMH on a T7 promoter within lacO sites inserted such that it could be induced by IPTG (Invitrogen Duet Vector) at a concentration of 1mM and found that TDMH was effective when the M. smegmatis to E. coli ratio 1:1 or 10:1. Higher ratios of M. smegmatis to E. coli were no longer effective.
Part: BBa_K1137009 (sRNA anti Kan)
This complex part contains everything necessary to express small RNA to inhibit expression of the Kanamycin resistance cassette encoding Aminoglycoside N6'-acetyltransferase. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CGTTTCCCGTTGAATATGGCT binds to the target sequence of ATGAGCCATATTCAACGGGAAACG including the start codon and the first 24 bp of the kanamycin ORF within the mRNA. It is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the kanamycin resistance cassette at this location, or a different kanamycin cassette is targeted the biobrick will not function correctly.
Part: BBa_K1137010 (sRNA anti Cm)
This complex part contains everything necessary to express small RNA to inhibit expression of the Chloramphenicol resistance cassette cat encoding chloramphenicol acetyltransferase. Very similar to BBa_K1137010, the biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence ATATCCAGTGATTTTTTTCTC binds to the target sequence of ATGGAGAAAAAAATCACTGGATAT which includes the start codon and the first 24 bp of the ORF within the chloramphenicol mRNA. As above, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the cat cassette at this location, or a different mechanism provides chloramphenicol resistance the biobrick will not function correctly.
Part: BBa_K1137011 (sRNA anti Lac)
Highly similar to BBa_K1137009 and BBa_K1137010, this part contains everything necessary to express small RNA to inhibit expression of lacZ. The biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence CAGTGAATCCGTAATCATGGT bind to the target sequence of ATGACCATGATTACGGATTCACTG which includes the start codon and the first 24 bp of the ORF within the lacZ mRNA. As in the previously described biobricks, it is vital that the sequences are complementary for proper repression to occur. If there are point mutations within the lacZ gene or biobrick sequence the biobrick will not function correctly. Additionally, there will be some leakage of β-Galactosidase which will cause cleavage of X-Gal, however we observed that edges of colonies tended to be white while the center of colonies tended to be blue.
Part:BBa_K1137000 (M. Smegmatis SirA)
This biobrick encodes a Ferredoxin-dependent sulfite reductase SirA, which reduces sulfite to hydrogen sulfide in the cysteine metabolism pathway. Due to the sensitivity of sulfur contain amino acids to oxidative stress; they must constantly be replenished in mycobacteria while inside the phagosome. Thus sirA is one of the few genes that is upregulated even in latent mycobacterial infections. Additionally, SirA differs from E. coli and Human sulfite reductases in its use of ferredoxin as an electron done instead of NADPH. As a result sirA has been previously identified as a drug target candidate for M. Tuberculosis infections. SirA reduces sulfite in the following reaction (EC=1.8.7.1):
Thus this gene can be used to provide cysteine in E. coli strains that lack a native cysI gene and allow for growth on minimal media. However, to do so it requires co-expression of biobricks BBa_K1137001 and BBa_K1137002. Even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. M. Smegmatis sirA has high homology (about 89%) to sirA from M. Tuberculosis.
Part:BBa_K1137001 (M. Smegmatis FprA)
This biobrick encodes a NADPH-ferredoxin reductase FprA. This replenishes FdxA by reducing it with NADPH as an electron donor and is required for the proper function of BBa_K1137000 along with BBa_K1137001 in the following reaction (EC=1.18.1.2):
FprA in addition to SirA has low homology to mammalian proteins and contains one tightly bound FAD. Additonally it has been well characterized and it’s kinetics determined experimentally. As mentioned under BBa_K1137000, even with minimal induction in a duet vector expression system, we were able to obtain growth in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137001 and BBa_K1137002, however the parent strain which lacked these biobricks was unable to grow. FprA from M. Smegmatis has a homolog in M. Tuberculosis.
Part:BBa_K1137002 (M. Smegmatis FdxA)
This biobrick encodes a 7Fe ferredoxin which is an orthologue of ferredoxin FdxC in M. Tuberculosis. It contains both one 3Fe-4S and one 4Fe-4S cluster. FdxA is the preferred substrate of FprA and is required for the proper functioning of SirA for sulfite reduction during cysteine metabolism.
Thus it required for growth on minimal media. We were able to obtain growth from an E. coli strain lacking native cysI in M9 media supplemented with glucose as a carbon source when co-expressed with BBa_K1137000 and BBa_K1137001.
+33 1 44 41 25 22/25
team2013@igem-paris.org 
