Team:Heidelberg/Templates/DelH overview21

From 2013.igem.org

(Difference between revisions)
(Results)
 
Line 1: Line 1:
 +
===Results===
===Results===
{| class="wikitable"
{| class="wikitable"
Line 12: Line 13:
<div style="clear:both"></div>
<div style="clear:both"></div>
<br/>
<br/>
 +
===Vector Maps and Primers===
===Vector Maps and Primers===
As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.
As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.

Latest revision as of 11:43, 4 October 2013

Results

Colonies Alignment File Sequence
I C5 File:Heidelberg Sequencing Result pHM04 DN07 colony 05 old.clustal.txt Amino Acid Substitution
I C7 sequencing insufficient -
I C12 sequencing insufficient -


Vector Maps and Primers

As pointed out before, we ordered new shorter and HPLC purified primers for the assembly of pHM04 as well as for the mutagenesis.

Identifier Order date Note Sequence
HM_20:BB_HPLC_rev 11-09-2013 HPLC version of HM11
Gibson-Primer rev, amplify the Backbone with overlap with the
RBS and the lacI-promotor and it creates and overlap to
the start of DelH
GATTTGGCGCAGGCGGCCACGGTCCATctagtatttctcctctttc
FS_77:BB_HPLC_rev 11-09-2013 Gibson-Primer rev, amplify the Backbone with overlap with the
RBS and the lacI-promotor and it creates and overlap to
the start of DelH
GCGATTTGGCGCAGGCGGCCACGGTCCATCTAGTATTTCTCCTCTTTC
HM21:fw_lacI_BbsI_Xba 2013-09-15 Forward primer for cutting out mutated fragment for mutagenesis TTTTGAAGACAA CTAGGCAATACGCAA
HM22:rev_RBS 2013-09-15 Reverse Primer in RBS for mutagenesis TTTTGAAGACAA CTCTTTCTCTAGTATGTGTGAAATTG
HM23:fw_RBS 2013-09-15 Forward Primer in RBS for mutagenesis TTTTGAAGACAA AGAGGAGAAATACTAGATGGACCGTGGC
HM24:rev_BbsI_MfeI 2013-09-15 Reverse primer for cutting out mutated fragment for mutagenesis TTTTGAAGACAA AATTGGACAGCGCGGCATGCCGGTTG