(Difference between revisions)

• Home
• Project
  • Iron metabolism
  • Related diseases
  • Iron chelators
  • Achievements
  • References
• Team
  • iGEM Profile
  • Attributions
  • Collaborations
  • Acknowledgement
  • Press
  • Photo gallery
• Model
  • Flush treatment
  • Enterobactin production
  • Genome scale
  • Population scale
  • Logistic functions
  • Chemical reasoning
  • Plate Reader
• Biology
  • Parts
  • Sensor
  • Inverter
  • Chelator
  • Results
• Human Practice
  • Consultation
  • Survey
  • Seminar
  • Philosophy
  • Safety
  • Economy
  • Art
• Capsule
• Notebook
  • Protocols
  • Primers
• Sponsors

Week 7: 29th July - 4th August

Construction of plasmid N°1

We make an electrophoresis with 5 µL of plamsid to check the plasmid purification made on the last friday.

Mettre l'image légendée ici

There is not the 3 bandes that we sould see, so to check another time, we make a digestion with Pst I and EcoR I:

• NEB Buffer 10X 5 µL
• BSA 10X 5 µL
• DNA 2 µg
• PstI 2 µL
• EcoRI 2 µL
• Water 50 µL

After another electrophoresis, we obtain no band.

Construction of plasmid N°2

Our plasmid N°2 is building with a synthetic promote sequence which is composed of:

• Andersen's promotor
• Fur Binding Site (15 different)
• RBS
• sfGFP
• Terminator

Golden Gate

In order to associate these sequences we performed a golden gate, using for each sample :

• 80 ng of Andersen's promotor
• 80 ng of Fur Binding Site
• 80 ng of RBS
• 80 ng of sfGFP
• 80 ng of Terminator
• 1.5 µL of T4 buffer (10X)
• 15 Unit of T4 ligase
• 2.5 Unit of Bsa I

The Golden Gate products are chemically transformed into E. coli Top 10 strains. After the transformation process, bacteria are plated into LB medium with carbenicillin and icubated overnigth at 37°C.

30/07/13
Golden Gates plates are composed at 98% of red colonies. The problem was probably on the equimolarity ratio between our different part which were not totally respected. We isolated white colonies (4 maximum by each sample) on LB medium with carbenicillin and we incubated them overnight at 37°c.

31/07/13
We made pre culture (V = 10 mL), using bacterial colonies isolated from our plates of Golden Gate transformation.

• Fur BS 1: clones 1,2 and 4
• Fur BS 2: clones 1,2 and 3
• Fur BS 3: clones 1,2 and 3
• Fur BS 4: clones 1 and 2
• Fur BS 5: clone 1
• Fur BS 6: clone 1
• Fur BS 7: clone 1
• Fur BS 8: clones 1,2,3 and 4
• Fur BS 9: none
• Fur BS 10: clone 1
• Fur BS 11: clones 2,3 and 4
• Fur BS 12: clones 1
• Fur BS 13: clones 2
• Fur BS 14: clones 1,2,3 and 4
• Fur BS 15: clones 1,2 and 3

Fur Binding Site	Sequence	Clone	Concentration
Fur BS 1	ATTATTGATAACTATTTG	Clone n°1	80.8 ng/µL
		Clone n°2	83.8 ng/µL
		Clone n°4	90.3 ng/µL
Fur BS 2	GATAACTATTTGCATTTGCA	Clone n°1	68.6 ng/µL
		Clone n°2	77.4 ng/µL
		Clone n°3	68.0 ng/µL
Fur BS 3	CAAATGCAAATAGTTATCCA	Clone n°1	79.4 ng/µL
		Clone n°2	110.5 ng/µL
		Clone n°3	457.4 ng/µL
Fur BS 4	CAAATAGTTATCAATAATCA	Clone n°1	73.2 ng/µL
		Clone n°2	66.2 ng/µL
Fur BS 5	GTAAATTAATATTATTTACA	Clone n°1	57.2 ng/µL
Fur BS 6	AATAATGCTTCTCATTTTCA	Clone n°1	63.8 ng/µL
Fur BS 7	ATAAATGATAATCATTATCA	Clone n°1	70.6 ng/µL
Fur BS 8	GAAAATAATTCTTATTTCCA	Clone n°1	75.6 ng/µL
		Clone n°2	87.2 ng/µL
		Clone n°3	48.8 ng/µL
		Clone n°4	57.8 ng/µL
Fur BS 9	AGCACTTATTATTATTTTCA	Clone n°1	58.6 ng/µL
Fur BS 10	GATAATTGTTATCGTTTGCA	No Clone	-
Fur BS 11	GATAATGCTTATCAAAATCA	Clone n°2	75.6 ng/µL
		Clone n°3	398.0 ng/µL
		Clone n°4	57.4 ng/µL
Fur BS 12	CAAAATTATTATCACTTTCA	Clone n°1	50.0 ng/µL
Fur BS 13	AATAATGATTACCATTCCCA	Clone n°2	70.7 ng/µL
Fur BS 14	GAAATTGTTTTTGATTTTCA	Clone n°1	42.7 ng/µL
		Clone n°2	32.8 ng/µL
		Clone n°3	37.8 ng/µL
		Clone n°4	45.7 ng/µL
Fur BS 15	GTTAATTGTAATGATTTTCA	Clone n°1	37.0 ng/µL
		Clone n°2	53.2 ng/µL
		Clone n°3	196.0 ng/µL

Construction of plasmid N°3

29/07/13
We received the primers ordered on friday the 26th of July and started to dilute them into TrisCL at 10 mM. Secondly, we diluted the previous stock solution at a rate of 1/20th to obtain a final concentration of 5 µM for our intermediate solution.

Then, for our plasmid three construction, we need to first extract the 6 enterobactin gene (EntA, EntB, EntC, EntD, EntE and EntF). The ordered primers from friday will theoretically extract them in the appropriate Golden Gate format with their own RBS upstream (designed from Salis RBS). This will allow us to construct our two N°3 plasmids, one containing EntA, EntD and EntF, and the other one EntB, EntC and EntE. The genes are spread like this to obtain two equivalent plasmids xxx

We proceeded to a genomic extraction of the 6 genes of interest and migrated to PCR products on a 1% gel. We successfully extracted 5 out of the 6.

30/07/13
We annealled the oligonucleotides of the PL-LacO part in the golden gate format. Also, we extracted the sfGFP with the RBS upstream which will allow us to construct the control positive plasmid 3 for future TECAN experiments.

31/07/13
We started by purifying our 6 succesful PCR extraction from the 29/07 and 30/07. So we managed to extract EntA, EntB, EntC, EntD and EntF from E. coli's genomic DNA and sfGFP in the golden gate format with a RBS (plasmid 3 construction) from plasmidic DNA.

Additionnaly, we optimized our PCR to extract our missing gene, EntE. We obtained a smear +/- a double band. As a consequence, we adjusted the annealing temperature with a range from 54°C to 66°C. This will allow us to try extracting the missing gene (EntE) in the appropriate conditions.

01/08/13
The did a gradient PCR and migrated on a gel our samples. On the gel, we notice that both the smear and the double band disappear when the annealing temperature increases. So to conclude, we run tonight a PCR with Q5 polymerase with increasing temperature starting from 56 degrees. The absolute annealing temperature will be determined for the Q5 (not extrapolable from a OneTaq PCR)