Team:NTNU-Trondheim/Notebook

From 2013.igem.org

(Difference between revisions)
(Friday 09.08.13)
Line 1,276: Line 1,276:
In addition to the Tat_GFP_RFP construct it was made a Tat_CFP_YFP construct. Still negative results, but the same size of product in each reaction. Will try to get better concentration of BB.   
In addition to the Tat_GFP_RFP construct it was made a Tat_CFP_YFP construct. Still negative results, but the same size of product in each reaction. Will try to get better concentration of BB.   
 +
 +
 +
====Friday 06.09.13====
 +
 +
=====PCR=====
 +
 +
Turned the Pm XylS promoter system into a biobrick using PCR. The following recipe was used:
 +
 +
* 31.5 &mu;l dH<sub>2</sub>O
 +
* 10 &mu;l 10x phusion buffer
 +
* 1 &mu;l dNTPs
 +
* 2.5 &mu;l fwd primer diluted 1:10 compared to stock solution (primer sequence: GAATTCGCGGCCGCTTCTAGTCAAGCCACTTCCTTTTTGC)
 +
* 2.5 &mu;l rev primer diluted 1:10 compared to stock solution (primer sequence: TACTAGTAGCGGCCGCTGCAGTGCATAAAGCCTAAGGGGTAGG)
 +
* 1 &mu;l template DNA
 +
* 1 &mu;l DMSO
 +
* 0.5 &mu;l Phusion DNA polymerase
 +
 +
Two different templates were used, and two samples were made for each template, giving in total four PCR batches. The first template was the Pm XylS plasmid, while the second was a PCR product of the Pm XylS promoter, modified in order to eliminate an XbaI restriction site.
 +
The following PCR program was used:
 +
 +
{|border="1"
 +
!Program step
 +
!Temperature
 +
!Duration
 +
|-
 +
|Heated lid
 +
|103&deg;C
 +
| -
 +
|-
 +
|Initial denaturation
 +
|98&deg;C
 +
|30 s
 +
|-
 +
|Cycle 30x
 +
|
 +
|
 +
|-
 +
|Denaturation
 +
|98&deg;C
 +
|15 s
 +
|-
 +
|Annealing
 +
|64&deg;C
 +
|15 s
 +
|-
 +
|Elongation
 +
|72&deg;C
 +
|53 s
 +
|-
 +
|End of cycle
 +
|
 +
|
 +
|-
 +
|Final elongation
 +
|72&deg;C
 +
|10 min
 +
|-
 +
|Hold
 +
|4&deg;C
 +
|&infin;
 +
|-
 +
|}
 +
 +
Gel picture of the PCR products:
 +
 +
[[file:Pm_XylS_BB.png|400px]]
 +
 +
=====Miniprep=====
 +
 +
<partinfo>BBa_E0240</partinfo> and <partinfo>pSB3K3</partinfo> were isolated using the Wizard <i>Plus</i> SV Minipreps DNA Purification System kit. The following concentrations were measured after the isolation:
 +
 +
{|border="1"
 +
!Part
 +
!Concentration
 +
|-
 +
|<partinfo>BBa_E0240</partinfo>
 +
|79.8 ng/&mu;l
 +
|-
 +
|<partinfo>pSB3K3</partinfo>
 +
|42.8 ng/&mu;l
 +
|-
 +
|}
</div>
</div>

Revision as of 13:22, 6 September 2013

NTNU Trondheim


January
MTWTFSS
  [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_January_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_January_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_January_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_January_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_January_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_January_2013&action=edit 6]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_January_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_January_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_January_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_January_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_January_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_January_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_January_2013&action=edit 13]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_January_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_January_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_January_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_January_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_January_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_January_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_January_2013&action=edit 20]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_January_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_January_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_January_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_January_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_January_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_January_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_January_2013&action=edit 27]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_January_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_January_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_January_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_January_2013&action=edit 31]
February
MTWTFSS
        [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_February_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_February_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_February_2013&action=edit 3]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_February_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_February_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_February_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_February_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_February_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_February_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_February_2013&action=edit 10]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_February_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_February_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_February_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_February_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_February_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_February_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_February_2013&action=edit 17]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_February_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_February_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_February_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_February_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_February_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_February_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_February_2013&action=edit 24]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_February_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_February_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_February_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_February_2013&action=edit 28]
March
MTWTFSS
        [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_March_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_March_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_March_2013&action=edit 3]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_March_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_March_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_March_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_March_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_March_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_March_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_March_2013&action=edit 10]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_March_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_March_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_March_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_March_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_March_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_March_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_March_2013&action=edit 17]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_March_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_March_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_March_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_March_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_March_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_March_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_March_2013&action=edit 24]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_March_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_March_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_March_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_March_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_March_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_March_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_March_2013&action=edit 31]
April
MTWTFSS
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_April_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_April_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_April_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_April_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_April_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_April_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_April_2013&action=edit 7]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_April_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_April_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_April_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_April_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_April_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_April_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_April_2013&action=edit 14]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_April_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_April_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_April_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_April_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_April_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_April_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_April_2013&action=edit 21]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_April_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_April_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_April_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_April_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_April_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_April_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_April_2013&action=edit 28]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_April_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_April_2013&action=edit 30]
May
MTWTFSS
    [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_May_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_May_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_May_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_May_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_May_2013&action=edit 5]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_May_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_May_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_May_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_May_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_May_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_May_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_May_2013&action=edit 12]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_May_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_May_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_May_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_May_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_May_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_May_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_May_2013&action=edit 19]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_May_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_May_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_May_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_May_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_May_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_May_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_May_2013&action=edit 26]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_May_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_May_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_May_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_May_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_May_2013&action=edit 31]
June
MTWTFSS
          [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_June_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_June_2013&action=edit 2]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_June_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_June_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_June_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_June_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_June_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_June_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_June_2013&action=edit 9]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_June_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_June_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_June_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_June_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_June_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_June_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_June_2013&action=edit 16]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_June_2013&action=edit 17] [http://2013.igem.org/Team:NTNU-Trondheim/18_June_2013 18] [http://2013.igem.org/Team:NTNU-Trondheim/19_June_2013 19] [http://2013.igem.org/Team:NTNU-Trondheim/20_June_2013 20] [http://2013.igem.org/Team:NTNU-Trondheim/21_June_2013 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_June_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_June_2013&action=edit 23]
[http://2013.igem.org/Team:NTNU-Trondheim/24_June_2013 24] [http://2013.igem.org/Team:NTNU-Trondheim/25_June_2013 25] [http://2013.igem.org/Team:NTNU-Trondheim/26_June_2013 26] [http://2013.igem.org/Team:NTNU-Trondheim/27_June_2013 27] [http://2013.igem.org/Team:NTNU-Trondheim/28_June_2013 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_June_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_June_2013&action=edit 30]
July
MTWTFSS
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_July_2013&action=edit 1] [http://2013.igem.org/Team:NTNU-Trondheim/2_July_2013 2] [http://2013.igem.org/Team:NTNU-Trondheim/3_July_2013 3] [http://2013.igem.org/Team:NTNU-Trondheim/4_July_2013 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_July_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_July_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_July_2013&action=edit 7]
[http://2013.igem.org/Team:NTNU-Trondheim/8_July_2013 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_July_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_July_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_July_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_July_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_July_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_July_2013&action=edit 14]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_July_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_July_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_July_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_July_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_July_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_July_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_July_2013&action=edit 21]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_July_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_July_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_July_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_July_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_July_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_July_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_July_2013&action=edit 28]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_July_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_July_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_July_2013&action=edit 31]
August
MTWTFSS
      [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_August_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_August_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_August_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_August_2013&action=edit 4]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_August_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_August_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_August_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_August_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_August_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_August_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_August_2013&action=edit 11]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_August_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_August_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_August_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_August_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_August_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_August_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_August_2013&action=edit 18]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_August_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_August_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_August_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_August_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_August_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_August_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_August_2013&action=edit 25]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_August_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_August_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_August_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_August_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_August_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_August_2013&action=edit 31]
September
MTWTFSS
            [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_September_2013&action=edit 1]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_September_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_September_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_September_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_September_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_September_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_September_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_September_2013&action=edit 8]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_September_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_September_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_September_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_September_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_September_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_September_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_September_2013&action=edit 15]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_September_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_September_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_September_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_September_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_September_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_September_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_September_2013&action=edit 22]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_September_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_September_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_September_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_September_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_September_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_September_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_September_2013&action=edit 29]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_September_2013&action=edit 30]
October
MTWTFSS
  [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_October_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_October_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_October_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_October_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_October_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_October_2013&action=edit 6]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_October_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_October_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_October_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_October_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_October_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_October_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_October_2013&action=edit 13]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_October_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_October_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_October_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_October_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_October_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_October_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_October_2013&action=edit 20]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_October_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_October_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_October_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_October_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_October_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_October_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_October_2013&action=edit 27]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_October_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_October_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_October_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_October_2013&action=edit 31]
November
MTWTFSS
        [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_November_2013&action=edit 1] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_November_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_November_2013&action=edit 3]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_November_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_November_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_November_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_November_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_November_2013&action=edit 8] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_November_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_November_2013&action=edit 10]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_November_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_November_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_November_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_November_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_November_2013&action=edit 15] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_November_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_November_2013&action=edit 17]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_November_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_November_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_November_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_November_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_November_2013&action=edit 22] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_November_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_November_2013&action=edit 24]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_November_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_November_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_November_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_November_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_November_2013&action=edit 29] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_November_2013&action=edit 30]
December
MTWTFSS
            [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/1_December_2013&action=edit 1]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/2_December_2013&action=edit 2] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/3_December_2013&action=edit 3] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/4_December_2013&action=edit 4] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/5_December_2013&action=edit 5] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/6_December_2013&action=edit 6] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/7_December_2013&action=edit 7] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/8_December_2013&action=edit 8]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/9_December_2013&action=edit 9] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/10_December_2013&action=edit 10] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/11_December_2013&action=edit 11] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/12_December_2013&action=edit 12] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/13_December_2013&action=edit 13] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/14_December_2013&action=edit 14] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/15_December_2013&action=edit 15]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/16_December_2013&action=edit 16] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/17_December_2013&action=edit 17] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/18_December_2013&action=edit 18] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/19_December_2013&action=edit 19] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/20_December_2013&action=edit 20] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/21_December_2013&action=edit 21] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/22_December_2013&action=edit 22]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/23_December_2013&action=edit 23] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/24_December_2013&action=edit 24] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/25_December_2013&action=edit 25] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/26_December_2013&action=edit 26] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/27_December_2013&action=edit 27] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/28_December_2013&action=edit 28] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/29_December_2013&action=edit 29]
[http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/30_December_2013&action=edit 30] [http://2013.igem.org/wiki/index.php?title=Team:NTNU-Trondheim/31_December_2013&action=edit 31]




Contents

Notebook

Transformed BioBricks

Tuesday 18.06.13

Started transforming BioBricks. Transformed some composite BioBricks consisting of constitutive promotor, RBS, a fluorescent protein and a terminator. Transformed the parts Promoter+RBS+RFP+term (<partinfo>BBa_I13521</partinfo>), Promoter+RBS+GFP+term (<partinfo>BBa_I13522</partinfo>), Promoter+RBS+CFP+term (<partinfo>BBa_I13600</partinfo>) and Pm+RBS+mCherry+term to competent E.coli DH5α cells, to have some colorful cells to show the camera crew from NRK (Norwegian broadcasting), who will visit our lab tomorrow :-)

For our transformation protocol, see the protocol page.


Wednesday 19.06.13

We transformed BioBricks consisting of fluorescent proteins. Transformed the parts YFP (<partinfo>BBa_E0030</partinfo>), CFP (<partinfo>BBa_E0020</partinfo>), RFP (<partinfo>BBa_E1010</partinfo>), GFP (<partinfo>BBa_E0040</partinfo>), BFP (<partinfo>BBa_K592100</partinfo>) and SYFP (<partinfo>BBa_K864100</partinfo>).

We transferred mCherry from agar plate to liquid medium and incubated at 37° C.


Thursday 20.06.13

We transferred the transformed cells from yesterday to liquid medium and incubated at 37°C protocol.

We isolated the DNA from the transformed mCherry cells by using the miniprep protocol and measured the concentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
mCherry1 5,6
mCherry2 7,3

Friday 21.06.13

We isolated the DNA from the transformed cells by using the miniprep protocol and measured the concentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
CFP1 8,59
CFP2 7,04
BFP 7,06
SYFP 5,42
RFP1 5,04
RFP2 7,52
YFP 6,79
GFP 5,27

Monday 24.06.13 - Friday 28.06.13

This week we have established protocols for further work and designed primers for PCR.


Monday 01.07.13

We transformed E.coli strain DH5α with some BioBricks: pBAD promoter (<partinfo>BBa_K206000</partinfo>), RBS (<partinfo>BBa_J61101</partinfo>) and a plasmid backbone (<partinfo>BBa_J01101</partinfo>).


Tuesday 02.07.2013

Small-scale vesicle preparation

This day we started making the small-scale vesicle preparation according to our protocol.

Overnight cell cultures of E.coli ER2566 and E.coli BW27784 transformed with the pUM9 plasmid were preprared. The pUM9 plasmid has ampR induces a stress respons in E.coli when arabinose is present. According to the litterature (link?) stress in E.coli increases vesicle production.

The ER2566 cell were cultured in plain LB, while the BW27784 cells were cultured in LB with ampenicillin (100 µg/mL).

Transfer to liquid medium

We transferred the samples of tranformed DH5α (pBAD promoter (<partinfo>BBa_K206000</partinfo>), RBS (<partinfo>BBa_J61101</partinfo>) and a plasmid backbone (<partinfo>BBa_J01101</partinfo>)) from agar plate to liquid medium and incubated at 37°C overnight.


Wednesday 03.07.2013

Small-scale vesicle preparation

The small-scale vesicle preparation continued with completion of step 2-7 in the vesicle isolation protocol. There where made three cell cultures in step 2; E.coli ER2566 in LB, E.coli BW27784 in LB with ampenicillin (100 µg/mL) (ara-) and E.coli BW27784 in LB with ampenicillin (100 µg/mL) with the addition of arabinose (0.5 %) after 1 hour of incubtion (ara+). The cell cultures in step 2 was incubated for 3 hours.

Optical denisty (OD) at 600 nm was mesured as indicated in the table below. No dilution of the samples was necessary.

Sample OD600
ER2566 0.9805
ara- 0.1263
ara+ 0.0471
DNA isolaton from transformants

We isolated the DNA from the transformed cells (pBAD promoter (<partinfo>BBa_K206000</partinfo>), RBS (<partinfo>BBa_J61101</partinfo>) and a plasmid backbone (<partinfo>BBa_J01101</partinfo>)) by using the miniprep protocol and measured the concentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
RBS 4,91
pTet1 8,99
pTet2 4,39
pBAD1 3,54
pBAD2 9,24

Thursday 04.07.2013

Continuation of the small-scale vesicle preparation according to the vesicle isolation protocol. Step 8-12 was completed with the exception that the pellet was resuspended in 0.5 mL DPBSS insted of 100 µL in step 11 and that the check for sterility in step 12 was not performed. The SDS-PAGE showed no signs of vesicles as viewed in figure 1.

Vesicles trial 1.jpg
figure 1

Monday 08.07.10

An overnight culture was started for vesicle isolation as desribed for tuesday 02.07.10.


Tuesday 09.07.2013

Today we ran PCR on 4 FP's <partinfo>Bba_K864100</partinfo>, <partinfo>Bba_K592100</partinfo>, <partinfo>Bba_E0040</partinfo>, <partinfo>Bba_E1010</partinfo> and 1 backbone <partinfo>Bba_J01101</partinfo>. We used the Phusion DNA Polymerase protocol from New England Biolabs [1] for 50 ul sample(without DMSO). All amplicons were run on a GelGreen 0.8% agarose gel. We only got a band on our RFP <partinfo>Bba_E1010</partinfo>, and it was not the expected size. We will adjust the PCR parameters and run them again tomorrow.

Step 2-11 of the small scale-vesicle preparation protocol and step 1-4 of the density gradient protocol was performed. Samples from the small-scale vesicle preparation were made ready for SDS-PAGE.

The incubation period was revised from the first attempt to isolate vesicles. The duration and other condition is summerised in the table below.

Sample Sample Sample
Time (h:min) ER2566 MW27784 ara- MW27784 ara+
0:00 Add 250 μL Amp (100X) and 2,5 mL of overnight culture to 250 mL of LB. Incubate at 37 C Add 250 μL Amp (100X) and 2,5 mL of overnight culture to 250 mL of LB. Incubate at 37 C
1:00 Add 1 mL of overnight culture to 250 mL of LB. Incubate at 37 C
2:00 Add 1,25 μL arabinose (1000X)
4:00 Measure OD-600 Measure OD-600 Measure OD-600


Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. No dilution of the samples was necessary.

Sample OD600
ER2566 0.1671
ara- 0.6726
ara+ 0.5968

Wednesday 10.07.2013

We ran the PCR again with different parameters. Increased annealing- and elongationtime and a separate program for the backbone due to its larger size. We still only got a band for RFP <partinfo>Bba_E1010</partinfo>. In the prosess of rechecking the primers it was discovered that the primers for RFP are incorrect which explains the discrepancy in productsize. The other primers should be working so tomorrow we will redo the dilutions of the primers, increase the elongation time and lower the annealing temperature a little, add DMSO, add a bit larger templatesample and use 1-step PCR.

SDS-PAGE were run with the samples from the vesicle preparaton from the day before. There were no indication of vesicles in the samples as indicated on the gel (figure 2)

figure 2
figure 2

Step 5 of the purification of vesicles by density gradient was performed. The fraction were freezed down at -80 oC.


Thursday 11.07.2013

Today we ran PCR again. This time we omitted the RFP, since we discovered that one of the primers was incorrect. We diluted the primers one more time and changed the parameters for the PCR. This time we only did one step, with 30 cycles. We also decreased the annealing temperature and increased the elongationtime. The results were more uplifting this time around after running gel electrophoreses (picture coming soon). We got a clear band on the backbone and faint bands on the GFP and SYFP. Since there was a faint band on the backbone of a larger size than the one we wanted, we added 1 µl of Dpn1 to the amplicon and put it in a 37 °C waterbath for an hour. We used the QIAGEN PCR purification kit to isolate the DNA and measured the cioncentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
SYFP 13,16
GFP 55,62
BB 55,50

Friday 12.07.2013

We repeated the PCR on the SYFP and BFP. We changed some of the conditions (increased number of cycles and varying the template volume), but still no result.


Sunday 14.07.2013

Step 1 and 2 of the Small-scale vesicle preparation were performed. 5 mL cultures of the E.coli strains ER2566, DH5α and MW27784 were incubated in 5 mL LB at 37 oC for 8 h. 2,5 mL of these cell cultures were added to 250 mL of LB and incubated at 37 oC for 13 h.


Monday 15.07.2013

Small scale-vesicle preparation protocol

Step 3-11 of small scale-vesicle preparation protocol and step 1-4 of the density gradient protocol was performed. Samples from the small-scale vesicle preparation were made ready for SDS-PAGE.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:16 with LB media.

Sample OD600
ER2566 0.133
DH5α 0.169
MW27784 0.198


A relative concentration of vesicles from the small scale preparation was mesured by adding the hydrophobic fluorecent dye [http://products.invitrogen.com/ivgn/product/T3166 FM4-64] and measuring fluorecence (RFU) (as desribed in step 12 in the small-scale vesicle preparation). Results (table below) indicated presence of vesicles in the ER2566-sample only.

Sample RFU (exitation/emission at 506/750 nm)
Empty 3
Blank 19 814
MW27784 19 598
DH5α 19 254
ER2566 40 987
New rounds of PCR

Two rounds of PCR was run today with varying the conditions.There are still no result. For the BFP, we will wait for new primers, since the result are showing formation of primer dimers. A new transformation of the SYFP-biobrick was started to get a new template for the PCRs.


Tuesday 16.07.13

SDS-PAGE were run with the samples from the vesicle preparaton from the day before. The ER2566-sample had vesicles, where as the other samples did not contain any (figure 3)

Vesicles trial 3m.jpg
figure 3: Ladder applied is Precision Plus ProteinTM Unstained Standards.

Step 5 of the purification of vesicles by density gradient was performed. SDS-PAGE were run on the fractions from ER2566, as this was the only sample with any indication of vesicles. As indicated in figure 4, fraction 4 and 5 had clear bands, whereas the fraction 6 has pale bands. The fractions are numbered according to when whey where removed from the gradient with fraction 1 beeing the first fraction to be removed and so on.

Density gradient 1m.jpg
figure 4: Ladder applied is Precision Plus ProteinTM Unstained Standards

The rest of the fractions were freezed down at -80 oC. Too short incubation time in step 2 of the small-scale vesicle preparation seem to be the reason why vesicles were not isolated during the two previous attemts.

Due to postive results, the Small-Scale vesicle preparation was repeated: Step 1 and 2 of the Small-Scale vesicle preparation was performed. 5 mL cultures of the E.coli strains ER2566, DH5α and MW27784 were incubated in 5 mL LB at 37 oC for 8 h. 2.5 mL of these cell cultures were added to 250 mL of LB and incubated at 37 oC for 14 h.


Wednesday 17.07.13

Small-Scale vesicle preparation

Step 3-11 of the Small-Scale vesicle preparation protocol was performed on the ER2566, DH5α, and MW27784-samples.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
ER2566 0.281
DH5α 0.293
MW27784 0.402


The DH5α had no pallet after the second centrifugation, and this sample where therefore not included further in the experiement. Some of MW27784 sample was lost in step 10 of the small-scale vesicle preparation. A part of the ER2566 and MW27784-samples from the small-scale vesicle preparation were made ready for SDS-PAGE. The rest of the samples were mixed with OptiPrep (60%) to give a final OptiPrep concentration of 45% and frozen at -80oC.

A relative concentration of vesicles from the small scale preparation was mesured by adding the hydrophobic fluorecent dye [http://products.invitrogen.com/ivgn/product/T3166 FM4-64] and measuring RFU (as desribed in step 12 in the small-scale vesicle preparation). This time we also measured RFU with exitation at 515 nm and emission at 640 nm. As the last exitation and emission gave a more significant difference between the blank sample and the vesicle containing sample, this condition will be applied for later RFU-measurements. Results (table below) indicated presence of vesicles in the ER2566-sample and perhaps also in the MW27784-sample.

Sample RFU (exitation/emission at 506/750 nm) RFU (exitation/emission at 515/640 nm)
Empty 1 32
Blank 16 536 1 180
MW27784 16 335 1 691
ER2566 47 191 44 059
DNA isolation

We isolated the DNA from the transformed cells (with SYFP) by using the miniprep protocol and measured the concentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
SYFP1 30,5
SYFP2 20,8

We used the new isolated DNA as template in PCR, trying different parameters.


Thursday 18.07.13

SDS-PAGE were run with the samples from the vesicle preparaton from the day before. The ER2566-sample had a clear content of vesicles whereas the MW27784-sample had a less denser content of vesicles (figure 5). The MW27784 also seems to have a different protein profile.

Vesicles trial 4m.jpg
Figure 5: Ladder applied is Precision Plus ProteinTM Unstained Standards.

Friday 19.07.13

E.coli strain ER2566 was transformed with biobrick [http://parts.igem.org/Part:BBa_K530015 BBa_K530015] according to the transformation protocol. The plates were incubated for 19 hours and then moved to the fridge. The transformed ER2566 bacteria is later to be used for determination of influence of chloramphenicol on the cells and for growth duration for optimal vesicle production.


Monday 22.07.13

Three cell cultures of E.coli strain ER2566 transformed with [http://parts.igem.org/Part:BBa_K530015 BBa_K530015] was inoculated in Chl-LB and one cell culture of MW27784 were inoculated in LB for 7.5 hours at 37°C as described in step 1 of the small-scale vesicle preparation. The transformed ER2566 seems to grow slower in Chl_LB than untransformed ER2566 does in plain LB. Bigger overnight cell cultures were incubated as in step 2 of the small-scale vesicle preparation, the ER2566 cells were incolated in Chl-LB as before. The three ER2566 samples were incubated for 14, 16 and 18 hours, while the MW27784 sample was incubated for 16 hours.


Tuesday 23.07.13

Step 4-12 of the small-scale vesicle preparation were performed. In addition dilutions (10-2, 10-4 and 10-6) of the ER2566 samples were made and plating of 100µL of 1 mL of the dilutions on Chl-LA was performed in step 4. The plates were left in the incubator overnight.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
ER2566 14h 0.247
ER2566 16h 0.347
MW27784 16h 0.533
ER2566 18h 0.328

Samples for SDS-PAGE was prepared in step 12.

RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. Results were as indicated in the table below:

Sample RFU (exitation/emission at 515/640 nm)
Empty 91
Blank 6 745
ER2566 14h 31 571
ER2566 16h 45 089
MW27784 16h 6 899
ER2655 18h 22 328

Wednesday 24.07.13

Small-scale vesicles isolation

Plates with transformed ER2566, plated the day before, were checked for colonies. As the 10-2 and 10-4 dilution had to much growth, only the 10-6-dilutions were counted for colony forming units (CFU)(table below):

Sample CFU (10-6-dilution) CFU/mL (undiluted)
ER2566 14h 265 2.65*109
ER2566 16h 278 2.78*109
ER2566 18h 273 2.73*109


It seems that transformed ER2566 reaches steady state at 14h or quickly after 14h in the 240 mL cellmedia. The CFU results corresponds well with the measured OD600 (table from the day before) except for that the OD600 of ER2566 14h is more different from the other samples compared to the CFU-results.

SDS-PAGE were run on the samples prepared the day before. There were very weak bands on the on all of the ER2566 samples (not as visible in the photograph (figure 6) as in real life) and no indication of vesicles on the MW27784-sample.

Vesicles trial 5m.jpg
Figure 6: Ladder applied is Precision Plus ProteinTM Unstained Standards.

The results of the SDS-PAGE does not correspond well to the results of the RFU-measurements from the day before. The RFU results indicate that the concentration of vesicles is higher.


New Primers

We recieved the new primers for the GFP, RFP and BB(Backbone) that we intend to attach to each other with Gibson Assembly. We got results from all and purified DNA using NEB Purification Kit.

Tranformation

Since we cannot seem to get the primers for SYFP and BFP to work and they are both developed by the same iGEM team we're testing them for futher characterization. Transformation of SYFP, BFP and an appropritate BB with promoter and RBS were done and plated out. The plates are incubated in 37 degrees overnight and put in the frige.

Thursday 25.07.13

Because the SDS-PAGE from yesterday did not give us expected results in terms of vesicles consentration, we started with the density gradient vesicle isolation with the ER2566 14h and 16h-samples to further test them for vesicles. Step 1-4 of this protocol was performed.


Isolation of Tat-sequence

We isolated the tat-signaling sequence beloning to the TorA gene from the "E. Coli" strain ER2566 using our designed primers with PCR.


Friday 26.07.13

Density gradient for vesicle purification

Step 5 and 6 of the density gradient vesicle isolation protocol was performed. The SDS-PAGE of the fractions show no or little indication of vesicles, further confirming the tendencies from the day before.

Gibson assembly

The Tat-PCR product was purified using NEB DNA Purification Kit. We will use our purified PCR products of Tat, GFP, RFP and BB in Gibson assembly.

The Gibson assembly reaction of the plasmid backbone, tat signal-sequence, GFP and RFP to create our first construct was performed according to the Gibson AssemblyTM Cloning Kit Manual. We made two samples, one with a incubation time (with the mastermix) of 60 min and one with 15 min. The control-sample was incubated for 15 min. The samples were then used for transformation of both E.coli strain DH5α and ER2566, giving us 4 samples. The transformation protocol was also collected from the Gibson AssemblyTM Cloning Kit Manual. Transformed bacteria were incubated on plates with the appropriate antibiotics for 18 hours and then put in the fridge.

Insert(I)/Vector(V) Concentration(ng/µl) Size(bp) µl
Tat(I)5X 35.84 150 1.5
GFP(I)2X 52.68 750 1.5
RFP(I)2X 98.31 750 1.0
BB(V) 73.82 2500 1.4

Add 10 µl of Gibson Mastermix and up to 20 µl dH2O.

There were no colonies on the plates where bacteria transformed with the 60 minutes incubation time Gibson assembly plasmids. There were three colonies with ER2566 transformed with the 15 minutes incubation time Gibson assenmbly plasmids and one colony on the plate with DH5α.


Sunday 28.07.13

The colonies with SYFP, BFP and BB was transferred to liquid media.


Monday 29.07.13

Small-scale vesicle preparation

Due to our unexpected vesicle yeild last week (see figure 6), we started a new round of small-scale vesicle preparation. Step 1 and 2 of this protocol was performed with E.coli strains DH5α, untransformed ER2566 and ER2566 transformed with biobrick [http://parts.igem.org/Part:BBa_K530015 BBa_K530015]. The transformed ER2566 was inculated in LB with chloramphenicole. All cultures were incubated for 16 hours.

Miniprep

Isolation of SYFP, BFP and BB from last weeks transformation.

Restriction Digest

The GFP, BFP an BB wad digested using restrictionenzymes. We followed the protocol [http://parts.igem.org/Help:Protocols/Restriction_Digest Restricion Digest]. BB was digested with SpeI and PstI and SYFP/BFP with XbaI and PstI. The following ligation was performed using this [http://parts.igem.org/Help:Protocols/Ligation Ligation Protocol] using bot 1:1 and 1:2 vector insert ratio.


Tuesday 30.07.13

Small-Scale vesicle preparation

Step 4-12 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of the ER2566 samples were made and plating of 100µL of 1 mL of the dilution on Chl-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
Unstransformed ER2566
Transformed ER2566
Unstransformed DH5α

Samples for SDS-PAGE was prepared in step 12.

RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. Results were as indicated in the table below:

Sample RFU (exitation/emission at 515/640 nm)
Empty 93
Blank 22340
Transformed ER2566 27249
Unstransformed ER2566 48478
Unstransformed DH5α 22029

From now on we will consentrate on E.coli strain ER2566.

Analysis of Gibson Assembly construct

Miniprep of Gibson Assembly construct and restriction digest gave wrong product on the gel. The size is not correct, so we must try again.

Check for contamination

To ensure that there is no contamination in our 4 construct component DNA we put 1µl of each DNA sample in 50µl of competent cells(ER2566) and plated them out. Incubated at 37°C overnight.

Second Gibson Assembly

We used the same protocol, but changed the DNA concentration to 200 ng and increased the ratio of tat to 10X instead of 5X.

Insert(I)/Vector(V) Concentration(ng/µl) Size(bp) µl
Tat(I)10X 35.84 150 2.5
GFP(I)2X 52.68 750 3.0
RFP(I)2X 98.31 750 1.5
BB(V) 73.82 2500 3.0

Add 10 µl Gibson Mastermix.

They where then transformed into ER2566 cells on 4 plates. Three plates with 5µl template, and one with standard 2µl template. Incubated at 37°C overnight.

Plate Templatevolume(µl) Colonies
1 2 3
2 5 36
3 5 37
4 5 250

Colonies where picked from all four plates and transferred to liquid media. Left overnight in 37 degrees shaker.


Wednesday 31.07.13

Small-scale vesicle preparation

SDS-PAGE were run on the samples from the day before. There were only a few weak bands on the gel (not visible on a potential picture) indicating vesicles in the unstransformed ER2566-sample only.

A new round of small-scale vesicle preparation was started with two transformed ER2566 samples (same conditions) and one sample of unstransformed ER2566. The transformed ER2566 had a plasmid that wes a product from the first Gibson Assenbly. Step 1 and 2 of the protocol was completed with the transformed ER2566 incubating in LB with chloramphenicol (25µL/mL) and untransformed ER2566 incubating in plain LB.

Restriction Digest of Gibson Assembly

We followed the procedure [http://parts.igem.org/Help:Protocols/Restriction_Digest Restriction Digest] in the registry.

Template Concentration(ng/µl) µl dH2O
1 17.9 14 2
2 137 2 14
3 26.7 9.5 6.5
4 20.6 12 4

Incubated at 50 &degree;C for 15 min. Run on gel, positive result for sample 1. Will do confirmation PCR tomorrow.


Thursday 01.08.13

Small-scale vesicle preparation

Step 4-7 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of the ER2566 samples were made and plating of 100µL of 1 mL of the dilution on Chl-LA was performed in step 4. The plates were left in the incubator overnight. The plate had growth, indicating that the bacteria still had their plasmid.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
Transformed ER2566 (1) 0.34
Transformed ER2566 (2) 0.32
Unstransformed ER2566 0.37

Due to complications in step 7, this vesicle isolation attempt was terminated.

Confirmation PCR of Gibson Construct

To confirm that our result from yesterday was in fact our construct with tat-sequense, GFP and RFP we performed several PCR reactions with different targets. We used 5 templates, 2 samples from the 2µl plats and 3 from the 5µl plates. All run with 4 different primersets. Tm was calculated using Tm Caculator. Only the actual primer, not the flankingsequence was included in the calculations. The Phusion PCR Protocol with 20µl sample was used.

Target F_Primer R_Primer Tm
GFP_RFP F_tat_GFP R_RFP 58°C
Tat_GFP_RFP F_pl.b_tat R_RFP 64/72°C
Tat_GFP F_pl.b_tat R_GFP 58°C
Tat F_pl.b_tat R_tat 72°C


All were run on GelGreen 0.8% Agarose. Bands indicate no GFP, tat or tat_GFP_RFP construct present, and tat_RFP-construct(which should not be possible) present. |


Friday 02.08.13

Transformation

Biobrick [http://parts.igem.org/Part:BBa_J04450 BBa_J04450] (in plasmid with kanamycin resistance) was transformed into E.coli strain ER2566 according to our transformation protocole.


Saturday 03.08.13

Step 1 and 2 of the were performed small-scale vesicle preparation with E.coli strains ER2566. Untransformed ER2566 was incubated for 14 hours, transformed ER2566 (with biobrick [http://parts.igem.org/Part:BBa_J04450 BBa_J04450]) for 14 and 16 hours in step 2. The untransformed sample was incubated in plain LB whereas the transformed samples were incubated in LB with kanamycin (50µL/mL)


Sunday 04.08.13

Step 4-12 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of the transformed ER2566 samples (both 14 and 16 hour incubation time) were made and plating of 100µL of 1 mL of the dilution on Kan-LA was performed in step 4. The plates were left in the incubator overnight. The plates had growth, indicating that the bacteria still had their plasmid. Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
Unstransformed ER2566 14h 0.324
Transformed ER2566 14h 0.449
Unstransformed ER2566 16h 0.493

Samples for SDS-PAGE was prepared in step 12.

RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. Results were as indicated in the table below:

Sample RFU (exitation/emission at 515/640 nm)
Empty 100
Blank 4 656
Untransformed ER2566 14h 24 549
Transformed ER2566 14h 45 732
Transformed ER2566 16h 30 655
Another round of Small-scale vesicle preparation

Step 1 and 2 of the small-scale vesicle preparation were performed with untransformed ER2566 that was incubated for 14 hours in plain LB in step 2, transformed ER2566 ( with biobrick [http://parts.igem.org/Part:BBa_K530015 BBa_K530015]) that were incubated in LB with chloramphenicole (25 µL/mL) for 16 hours and the same transformed ER2566 in plain LB for 14 hours (incubated WITH chloramphenicole (25 µL/mL) in step 1).


Monday 04.08.13

Small-scale vesicle preparation

Step 4-6 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of the transformed ER2566 samples (both 14 and 16 hour incubation time) were made and plating of 100µL of 1 mL of the dilution on Kan-LA was performed in step 4. The plates were left in the incubator overnight. The plates had growth, indicating that the bacteria still had their plasmid. This result also means that transformed ER2566 with Chl-resistance can hold on to their plasmid even without a selective marker in the media for at least 14 hours of incubation.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
Unstransformed ER2566 14h 0.379
Transformed ER2566 14h -Chl 0.369
Unstransformed ER2566 16h +Chl 0.373

The experiment was terminated after step 6 because we will not be needing the results.

SDS-PAGE of vesicle samples

SDS-PAGE was run on the samples from the day before. As figure 7 shows the unstransformed sample and the transformed ER2566 14h had a clear indication of vesicles. According to the SDS-PAGE the untransformed sample had a greater content of protein compared to ransformed ER2566 14h, whereas the transformed samples had more vesicles than the unstransformed sample judging from the RFU measurements (table, sunday 04.08.13). It seems that transformation with antibiotics in the media increases vesicle production, but decreases production of vesicle assosiated proteins.

Vesicle trial6.jpg
Figure 7: Ladder applied is Precision Plus ProteinTM Unstained Standards.
Yet another round of small-scale vesicle preparation

Step 1 and 2 of the small-scale vesicle preparation were performed with ER2566 transformed with construct from the second Gibson assembly attempt. Two colonies (see picture 8) were selected and incubated for 14 and 16 hours in step 2. All of the cultures were incubated in LB media with ampenicillin (100 µL/mL).

Colonies.jpg


figure 8
Different PCR with Gibson construct

The results from the last confirmation PCR gave strange results, so it was decided to run it again. Changes where; the whole primer including the flanking sequence to calculate the annealing temperature, included the RFP only, and we used 2-step PCR. The results were the same. Confirmed RFP and tat_RFP, but no tat_GFP_RFP construct. It is likely that the GFP is not present in our product. A new transformation was performed with the GFP to use in next Gibson Assembly.

The tat_RFP construct was purified and frozen at -20°C.



Tuesday 06.08.13

Small-scale vesicle preparation

Step 4-12 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of all the samples were made and plating of 100µL of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plates had growth, indicating that the bacteria still had their plasmid.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media.

Sample OD600
14-1 0.432
14-2 0.391
16-1 0.425
16-2 0.420

The cell cultures and cell pallets were not red or pink when they were taken out of the incubator and centrifuge. The pallet did, however, start to get a red color after a while. This indicate that the cells reqiure a more aerobic enviroment for production of RFP.

Samples for SDS-PAGE was prepared in step 12.

RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. As the vesicles were expected to contain RFP, RFU was also measured without FM64-4 at exitation/emission at 605/670 (the known exitation/emission for RFP) Results were as indicated in the table below:

Sample RFU (exitation/emission at

515/640 nm) with FM64-4

RFU (exitation/emission at

605/670 nm) without FM64-4

Empty 36 3258
Blank 2148 2641
14-1 3571 4104
14-2 46 480 6181
16-1 3475 3629
16-2 17 430 4565


NB! Later it was discovered that the RFP that we have in the vesicles (from biobrick [http://parts.igem.org/wiki/index.php/Part:BBa_E1010 Part:BBa_E1010) has an exitation/emission peak at 584/607nm.

Colony PCR of GFP

We transferred around 15 colonies to 20µl dH2O and incubated in the PCR-machine at 95°C for 15 min. Sentrifuged for 2 min 14.000rpm. 1µl was used as template for PCR. Gel electroforeses confirm a band around 750bp which is the expected size of the GFP. DNA purification was performed using a putification kit and the concentration was measured using Nanodrop.

Gibson Assembly 3

A new gibson with the newly transformed GFP was performed. Insert and vector concentrations of 200ng, 10µl DNA 10µl Gibson Mastermix. 50°C, 15 min. A sample of 2µl was removed after 5 min. Product was incubated in -20°C immidiately to stop the reaction. 2µl transformed in ER2566 and plated. Control with all DNA was plated on Amp and Chl plates.


Plate Colonies Concentration(ng/µl)
1 57 108.1
2 130 109.3
3 52 29.3
4 12 19.6
5 38 99.3
6 31 25.4
7 85 23.3
8 42 24
Control Amp 95
Control Chl 34


The Concentration was measured after miniprep using nanodrop. The colonies on both controlplates indicate contamination at some stage.

A new transformation was started with RFP, BB and Ptet GFP <partinfo>BBa_I13522</partinfo>, to check if the different GFP will work. Tat was isolated from ER2566 cells using colony PCR and product used as template in PCR with tat-primers. They were plated and incubated at 37°C overnight.


Wednesday 07.08.13

SDS-PAGE of vesicle samples

SDS-PAGE was run on the samples from the day before. As showed in figure 9 all of the samples had vesicles, but sample 14-2 had a higher density.

Vesicle trial7.jpg
Figure 9: Ladder applied is Precision Plus ProteinTM Unstained Standards.
Another round of small-scale vesicle preparation

Step 1 and 2 of the small-scale vesicle preparation were performed with ER2566 transformed with construct from the second Gibson assembly attempt. Two colonies (see picture 8) were selected and incubated for 14 and 16 hours in step 2. The cultures were incubated aerobically in LB media with ampenicillin (100 µL/mL) in step 1 and areobically in plain LB in step 2. The samples are again labeled as 'hours incubation in step 2 - colony number'

Confirmation PCR of Gibson Construct with Taq Polymerase

We got several bands on the gel from gibson, it is unsure if they are the right size so to confirm what product was made in the gibson assembly we ran a confirmation PCR using Taq Polymerase Taq Pol Protocol.

Different combinations of primers to detect different combinations.

Sample Target F_Primer R_Primer Tm
A RFP F_l_RFP R_RFP 66
B GFP+RFP F_Tat_GFP R_RFP 66
C Tat+GFP+RFP F_pl.b_Tat R_RFP 63
D GFP F_tat_GFP R_GFP 68
E Tat F_pl.b_Tat R_Tat 63
F Tat+GFP F_pl.b_Tat R_GFP 63


Band was visible for RFP around 750bp, so that is confirmed. Strong band for the Tat_GFP_RFP construct, but the size is only around 850bp. For it to contain tat and the 2 FPs it should be around 1600bp. It is probable that tat has attached to the RFP instead of the GFP even though the primers are not designed so that this is possible. More tests will be run.


Thursday 08.08.13

Small-scale vesicle preparation

Step 4-12 of the small-scale vesicle preparation were performed. In addition a 10-6 dilution of all the samples were made and plating of 100µL of 1 mL of the dilution on Amp-LA was performed in step 4. The plates were left in the incubator overnight. The plates with bacteria from colony 1 had growth (approximately 250-300 colonies) indicating that the bacteria still had their plasmid. The controll plate with bacteria from colony 2 had 14 colonies (14-2) and 2 colonies (16-2).

The cellmedia with bacteria from colony 1 (14-1 and 16-1) has a pink color, while the other samples did not.

Optical denisty (OD) at 600 nm was mesured in step 4 as indicated in the table below. The samples were diluted 1:10 with LB media. The true OD of 14-1 and 16-1 might be disturbed by the production of RFP, giving these samples a higher OD.

Sample OD600
14-1 0.566
14-2 0.400
16-1 0.555
16-2 0.504

Sample 16-1 was disregarded for RFU-measurements in step 12 due to an experimental mistake.

Samples for SDS-PAGE was prepared in step 12.

RFU was measured as decribed in step 12 of the small-scale vesicle preparation protcol. As the vesicles were expected to contain RFP if the tat sequence is present, RFU was also measured without FM4-64 at exitation/emission at 605/670 (the known exitation/emission for RFP). Results were as indicated in the table below:

Sample RFU (exitation/emission at

515/640 nm) with FM4-64

RFU (exitation/emission at

584/607 nm) without FM4-64

Empty 37 18 147
Blank 1736 45 927
14-1 9030 40 818
14-2 20 745 31 325
16-1
16-2 46 126 37 304

As the highest 584/607-measurement is the blank sample, we conclude that there are no RFP present in the vesicles.

PCR

Primers for CFP (<partinfo>BBa_E0020</partinfo>) and YFP (<partinfo>BBa_E0030</partinfo>) arrived today, so PCR was run with these primers. TO avoid any contamination, we added 1 µl of Dpn1 to the amplicon and put it in a 37 °C waterbath for an hour. We used the QIAGEN PCR purification kit to isolate the DNA and measured the concentration by [http://www.nanodrop.com/library/nd-1000-v3.7-users-manual-8.5x11.pdf NanoDrop ND-1000 Spectrophotometer].

Sample Concentration (ng/µl)
YFP 64
CFP 92,8


Restriction cutting of construct

2 different samples of the gibson assembly product was used in restriction analysis with 3 enzymes. Two of the enzymes cut on either side of the construct and the third cuts the GFP at 323 bp, rughly in the middle of the gene. 4 different combinations were performed. We used the restriction digest [http://parts.igem.org/Help:Protocols/Restriction_Digest protocol] from iGEM webpage.

# Enzyme1 Enzyme2
1 EcoRI SpeI
2 EcoRI PmlI
3 PmlI SpeI
4 BsaAI SpeI



<center>Friday 09.08.13

SDS-PAGE of vesicle samples

SDS-PAGE was run on the samples from the day before. As showed in figure 10 the 16-2 sample seems to have the highest protein content followed by 16-1. It seems that the 16 hour incubation is to prefer when considering the SDS-PAGE (figure 9) and the RFU-measurements (table, thursday 08.08.3013)

Vesicles trial 8m.jpg
Figure 10: Ladder applied is Precision Plus ProteinTM Unstained Standards.
PCR

New PCR on GFP, RFP, BB and tat. Very weak band on BB. Ran new Expand high fidelity DNA polymerase kit with BB-PCRproduct as template. Still low concentration.

Gibson Assembly 4

In addition to the Tat_GFP_RFP construct it was made a Tat_CFP_YFP construct. Still negative results, but the same size of product in each reaction. Will try to get better concentration of BB.


Friday 06.09.13

PCR

Turned the Pm XylS promoter system into a biobrick using PCR. The following recipe was used:

Two different templates were used, and two samples were made for each template, giving in total four PCR batches. The first template was the Pm XylS plasmid, while the second was a PCR product of the Pm XylS promoter, modified in order to eliminate an XbaI restriction site. The following PCR program was used:

Program step Temperature Duration
Heated lid 103°C -
Initial denaturation 98°C 30 s
Cycle 30x
Denaturation 98°C 15 s
Annealing 64°C 15 s
Elongation 72°C 53 s
End of cycle
Final elongation 72°C 10 min
Hold 4°C

Gel picture of the PCR products:

Pm XylS BB.png

Miniprep

<partinfo>BBa_E0240</partinfo> and <partinfo>pSB3K3</partinfo> were isolated using the Wizard Plus SV Minipreps DNA Purification System kit. The following concentrations were measured after the isolation:

Part Concentration
<partinfo>BBa_E0240</partinfo> 79.8 ng/μl
<partinfo>pSB3K3</partinfo> 42.8 ng/μl


Retrieved from "http://2013.igem.org/Team:NTNU-Trondheim/Notebook"