"
Team:Washington/PRIMER DESIGN
From 2013.igem.org
(Difference between revisions)
(Created page with "==''''''== <html> <header> <b><u>Primer Design</u></b> </header> <body> <br> <br> <p> IDT’s <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Ana...") |
(→') |
||
| Line 26: | Line 26: | ||
<a href = "http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html/">PCR Primer Design Guidelines</a><br> | <a href = "http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html/">PCR Primer Design Guidelines</a><br> | ||
| + | <br> | ||
| + | <br> | ||
<b>Primer Design</b> | <b>Primer Design</b> | ||
| - | + | <br> | |
<u>Forward Primer:</u><br> | <u>Forward Primer:</u><br> | ||
| Line 34: | Line 36: | ||
<br> | <br> | ||
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed) | Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed) | ||
| + | <br> | ||
<u>Reverse primer:</u><br> | <u>Reverse primer:</u><br> | ||
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence | Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence | ||
| Line 43: | Line 46: | ||
<b>General notes:</b> | <b>General notes:</b> | ||
| + | <br> | ||
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com” | -When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com” | ||
<br> | <br> | ||
| Line 49: | Line 53: | ||
- The primer should end on an G/C for stability | - The primer should end on an G/C for stability | ||
| - | <br>When possible use the <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Analyzer</a> or<a href = "http://www.thermoscientificbio.com/webtools/multipleprimer/">Multiple primer analyzer</a> (ignore Tms): | + | <br>When possible use the <a href = "http://www.idtdna.com/analyzer/applications/oligoanalyzer/">Oligo Analyzer</a> or <a href = "http://www.thermoscientificbio.com/webtools/multipleprimer/">Multiple primer analyzer</a> (ignore Tms): |
<br> | <br> | ||
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <b><u><-2.0</u></b> add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore. | - Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <b><u><-2.0</u></b> add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore. | ||
Revision as of 04:48, 7 September 2013
'
IDT’s
Oligo Analyzer
Finnezymes
Multiple primer analyzer
Tyler’s primer design video-
Primer Design for PCR
General Guidelines:
PCR Primer Design Guidelines
Primer Design
Forward Primer:
Take the beginning of the 18~35 bases of your targeted sequence according to the melting temperature for the gene primer bind to the plasmid you want to transform into. Tms should be around 58*C to match VF2 and VR primers, unless making “hanging primers” by adding the prefix and suffix for cloning - these Tms can be a bit lower to make the combined oligo shorter.
Add the *prefix “gaattcgcggccgcttctagag” at the beginning (extend if needed)
Reverse primer:
Add the *suffix “tactagtagcggccgctgcag” to the end of the targeted sequence
Then reverse complement the whole thing (end of the 20 bases + suffix). Both primers must be listed 5’->3’ for ordering format purposes.
General notes:
-When finding the reverse complement of the end sequence, instead of writing out the reverse complement either use http://www.bioinformatics.org/sms/rev_comp.html or highlight the sequence in Ape, right click and click “Copy Rev-Com”
- The primer has to be at least 18 base pairs long ( NO LESS )
- The primer should end on an G/C for stability
When possible use the Oligo Analyzer or Multiple primer analyzer (ignore Tms):
- Click on hairpin, and looking at the structures the site pops out with. If there is a delta G value of <-2.0 add more base pairs till all values of any resulting structures are >-2.0. The reason for this is because of free energy, the primer might loop onto itself and not function anymore.
Using Ape:
- The highlighted region that you will use for primers will show “Tm” = mel temps. It should be between 40-50 degrees (THIS HAS MORE PRIORITY THAN THE delta G)
*the prefix and the suffix can be found in the following website:
http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix
(use the prefix for the non-inframe cloning, i.e. the longer one)
*match the melting temperature of forward and reverse primer
*A good way to check whether you design the primer correctly is used “find” (control +F) on a new plasmid file you construct by inserting the segment between the prefix and suffix.
