"
Team:WHU-China/templates/standardpage doublepromoter
From 2013.igem.org
(Difference between revisions)
IgnatzZeng (Talk | contribs) |
IgnatzZeng (Talk | contribs) |
||
| Line 6: | Line 6: | ||
<div class="mac" style="height:auto;width:67%;float:right;padding:5px;margin-top:6px;margin-right:7%;"> | <div class="mac" style="height:auto;width:67%;float:right;padding:5px;margin-top:6px;margin-right:7%;"> | ||
| - | <h1 style="float:right;width:100 | + | <h1 style="float:right;width:100%;font-size:20px;"><b>Double promoter</b></h1> |
<div style="width:100%;float:right;height:auto;"> | <div style="width:100%;float:right;height:auto;"> | ||
<img src="https://static.igem.org/mediawiki/igem.org/5/5a/DoublePro_J23116-J23102.png" style="width:400px;height:400px;" align=right /> | <img src="https://static.igem.org/mediawiki/igem.org/5/5a/DoublePro_J23116-J23102.png" style="width:400px;height:400px;" align=right /> | ||
| Line 30: | Line 30: | ||
| - | <h1 style="float:right;width:100 | + | <h1 style="float:right;width:100%;font-size:20px;"><b>gRNA</b></h1> |
</br></br></br> | </br></br></br> | ||
<img src=”” width=300px height=250px style="border:1px solid" align=right /> | <img src=”” width=300px height=250px style="border:1px solid" align=right /> | ||
Revision as of 08:06, 24 September 2013
Double promoter
We choose promoters J23102、J23106 and J23116 to construct double tandem promoters from the current iGEM biobrick kit, taking the PAM region which is necessary for gRNA targeting into consideration. And because the three promoters have comparatively large divergence of transcript strength, which can provide us more regulation sites and a obvious expression difference to detect.
According to the standard of biobrick construction, we get these three promoters from biobrick BBa_J23102, BBa_J23106 and BBa_J23116 by restriction enzyme digestion. Then we combine two of them with different orders respectively and transfer the double tandem promoters with the report gene RFP to the expression vector pSB2K3. Through the analysis of the fluorescence/OD600 ratios, we identify the relevant transcription strength.
Improve strategy
To exclude the problem of the divergence of plasmid copy number in different sample groups, which would make the result not that accurate. We design a double fluorescence system to detect the expression level of each double tandem promoters, eliminating the instability of plasmids.
We construct the report protein mCherry and EYFP on the same plasmid pSB1C3. When at detection, we set the fluorescence of EYFP as the control, and use the fluorescencem/fluorescencee ratios to represent the relative transcription strength
Here we choose J23106-J23116 double tandem promoters as the final platform to conduct the following experiment, because this combination would have the most obviously different transcription strength.
Here show the J23106-J23116 double tandem promoters sequence:
gaacctcttacgtgcccgatcaactcgagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacg(active-4)aggcagaatttcagataaaaaaaatcct(active-2)tagctttcgctaaggatgatttc(active-3)tggaattcg(active-5)cggccg(CA6)cttctagag(106+116)TTTA(CI2)CGGCTAGCTCAGTCCTAGGTATAGTGCTAGCTACTAGAGTTGACAGCTAGCTCAGTCCTA(CI1)GGGACTATGCTAGCTACTAGGAAAGAGGAGAAATACTAGATG
