Team:AITM-Nepal/Part1

(Difference between revisions)

Part 1

Toll like receptor 8 transfection in HEK 293 cell line Plasmid information :

pcDNA3-TLR8-YFP
Gene/insert name:	Toll-Like Receptor 8
Alt name:	TLR8
Insert size:	3177
Species:	H. sapiens (human)
GenBank ID:	NM_016610
Entrez Gene:	TLR8 (CD288, MGC119599, MGC119600)
Fusion protein or tag:	YFP
Terminal:	C terminal on backbone
Vector backbone:	pcDNA3-YFP
Vector type:	Mammalian Expression
Backbone size w/o insert (bp):	6100
Cloning site 5':	BamHI
Site destroyed during cloning:	No
Cloning site 3':	XhoI
Site destroyed during cloning:	No
5' sequencing primer:	T7
3' sequencing primer:	GTCTTGTAGTTGCCGTCGTC
Bacterial resistance(s)	Ampicillin
Growth strain(s)	DH5alpha
Growth temperature (℃):	37
High or low copy:	High Copy
Selectable markers:	Neomycin

The HEK 293 cell line was transfected with the pcDNA3-TLR8-YFP plasmid. For the evocation of Interferon type 1 production the siRNA would act as ligand for the Toll like receptor 8. Although TLR8 is phylogenetically related to TLR7 and is activated by structurally similar ligands, the cellular expression patterns of these two receptors are distinct. TLR8 is constitutively expressed by myeloid DC (mDC), monocytes, and macrophages in humans. It is the cellular expression patterns, rather than the nature of the TLRs themselves, that is likely responsible for the differing cytokine profiles evoked by TLR7 and TLR8 (predominantly pDC-derived IFNα for TLR7 and mDC-derived proinflammatory cytokines for TLR8). Murine TLR8 does not respond to conventional TLR7/8 ligands and, until recently , was considered to be nonfunctional in mice. These interspecies variations are an important consideration when comparing RNA-mediated immune activation in murine and human model systems. The precise nature of the RNA motifs recognized by TLR7/8 remains obscure. We originally described siRNA duplexes with GU-rich sequences as being highly immunostimulatory and identified 5′-UGU-3′ motifs within particular siRNAs that apparently confer this activity. Substitution of the uridine groups in this motif significantly reduced immunostimulatory capacity of the duplex, whereas introduction of the 5′-UGU-3′ motif into an siRNA duplex had the opposite effect. By inserting GU-rich sequences, we have shown that it is possible to select functional siRNA duplexes with inherently high immunostimulatory capacity. Thus for the proper activation of TLR-8 the GU rich sequence was prepared and was used as siRNA fragment of 21ntd.