Team:Stanford-Brown/Team/Safety

Safety

The Rothschild lab (NASA-ARC) hosts students and interns as part of the Education Associates Program (EAP). As interns, we must complete a four hour lab-safety “bootcamp,” which includes biological containment protocols, waste disposal, handling of hazardous materials, personal protection/equipment, and general biosafety. In addition, each intern must pass safety certification post-bootcamp, which familiarizes interns with safe lab work practices under NASA Ames Guidelines.

NASA Ames Bio safety guideines: http://server-mpo.arc.nasa.gov/Services/CDMSDocs/Centers/ARC/Dirs/APR/APR8800.3C6.html

NASA General Safety Guidelines:http://server-mpo.arc.nasa.gov/Services/CDMSDocs/Centers/ARC/Dirs/APR/APR1700.1.html

Stanford APB website: http://www.stanford.edu/dept/EHS/prod/researchlab/bio/

The following questions are paraphrased from the 2013 IGEM safety-compliance documents. Beneath each question, we have divided our answers among the projects, as applicable. Safety forms were approved on 9/18/13 by David Lloyd and Julie McNamara.

1. If your project moved from a small-scale lab study to become widely used as a commercial/industrial product, what new risks might arise? Also, what risks might arise if the knowledge you generate or the methods you develop became widely available?

EuCROPIS: Engineering B. subtilis to change color in the presence of sucrose and during sporulation do not present grave environmental risk. However, it is worth noting that B. subtilis is a tenacious and hardy species, which can be difficult to eradicate in cases of contamination, though B. subtilis is already widely distributed in the environment and has been shown to be non-toxic and non-pathogenic. Were B. subtilis to suddenly develop the mechanisms of pathogenesis, our strains could present some risk, as we have added chloramphenicol resistance.

CRISPR-Cas: Both of the CRISPR-Cas projects feature conjugation via the RP4 plasmid. If either sub-project were to become a commercial product, we would consider the risk of phage infection, as any unwanted genes not targeted and removed by the CRISPR-Cas system could be conjugated throughout a bacterial population. We would also consider the ever-present risk of mutation in our product, as a change in nucleotide sequence could compromise the efficacy of the CRISPR-Cas system. Both events could pose a risk to the safety and health of the general public, as E coli can cause foodborne illness. In the transition between lab project and commercial product, however, we would perform rigorous testing and enact certain safeguards, such as including spacers in the CRISPR-Cas system to target unwanted viral DNA, to eliminate these risks.
   The methods we used in this project were based on prior research and established practice. For example, the method of using RP4 plasmid to mediate conjugation was adopted by Team Heidelberg in 2008, and papers characterizing RP4 as a conjugative plasmid date back to 1993. Thus, disclosing our methods would not result in additional security or environmental risks that are not currently present, as these methods are already available. Additionally, we have mitigated a possible health risk by submitting our Cas9 bricks to the registry. Since the type II CRISPR-Cas system is derived from Streptococcus pyogenes , making the genes available frees future researchers from having to work with Streptococcus to obtain a working CRISPR-Cas system. Finally, any knowledge we generate regarding the CRISPR-Cas system would contribute to the growing body of literature characterizing CRISPR-Cas. Because CRISPR-Cas is a relatively new area of research, we hope our project will help highlight any potential risks of using CRISPR-Cas as a genome editing tool.

De-Extinction: The portion of our project focusing on CasA will help to expand the understanding of the mechanisms driving CASCADE. Use of the knowledge gained here would improve the ability to modify the CRISPR system, which could be used in several ways as described in the CRISPR/Cas section. The main methods we are using include ancestral sequence prediction. This is a technology that is already available freely online. There are no immediate risks involved in this. We also use sequencing and expression techniques to test these ancestral predictions. Dangers that might arise if this practice became commonplace would most likely be unintentional. For example, an ancestral version of a gene might make a certain organism more pathogenic or virulent in some way that is not predicted. It is unlikely, however, that this would happen unless working with genes which already control these attributes.There would also be some risk to the status quo of the ecosystem if working with traits that could be evolutionarily advantageous. If a stronger strain of a microbe was released accidentally, it might out-compete the existing strains and alter the equilibrium of the ecosystem.

2. Does your project include any design features to address safety risks? (For example: kill switches, auxotrophic chassis, etc.)

BioWires: Our DNA does not produce any proteins. Our bricks are meant for extracellular manipulation, and are most ideally used to produce short oligos in cell-free environments. As such, we deemed that no kill switch was necessary.

CRISPR-Cas: Our projects currently do not include a kill switch or auxotrophic chassis, though both are features that could be added to the final product. However, because the product of our vaccination sub-project targets virulent E coli, we have included a feature that positively selects our cells against pathogenic E. coli if both strains are in the same population. Thus, our product will out-compete its virulent counterpart and decrease the health risk posed by pathogenic E. coli.

3. List and describe all new or modified coding regions you will be using in your project. (If you use parts from the 2013 iGEM Distribution without modifying them, you do not need to list those parts.)

EuCROPIS: <b> Our project does not use any new or modified coding regions. We are linking unmodified chromoproteins developed by the Uppsala iGEM team with B. subtilis promoters that we constructed from oligos. <b> Biowires: <b>

We utilized a multitude (50+) of different short, synthetic oligonucleotides synthesized by Elim Biopharmaceuticals. These oligos did not code any information, but were used in the creation of silver-intercalating dsDNA wires. The most commonly used strands are listed below:

Star sequence: TTATATTTACCACCTCCTCCACCTTTTAGATT Star prime: AATCTAAAACCTCCACCACCTCCTAAATATAA NMR/ESI-MS Palindrome: TTATGAACTTGACTCAAGTTCATAA 50bp Hairpin: AAACACTACTCCCTCCTACCCACCACACAACTCATCACTCAACACCTCACCTCACCTCTTCACTCATCACTTCTCTCCTCCCTACCACCCACTACTGTTT KM hairpin: CTCTCTTCTCTTCATTTTTCAACACAACACAC

<b> CRISPR-Cas: <b> <style type="text/css"> table.tableizer-table { border: 1px solid #CCC; font-family: Arial, Helvetica, sans-serif font-size: 12px; } .tableizer-table td { padding: 4px; margin: 3px; border: 1px solid #ccc; } .tableizer-table th { background-color: #104E8B; color: #FFF; font-weight: bold; }

There would also be some risk to the status quo of the ecosystem if working with traits that could be evolutionarily advantageous. If a stronger strain of a microbe was released accidentally, it might out-compete the existing strains and alter the status quo of the ecosystem.