Team:Biwako Nagahama/Material & Method
From 2013.igem.org
(→CrdS) |
(→CrdS) |
||
Line 155: | Line 155: | ||
<p>CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI. </p> | <p>CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI. </p> | ||
[[File:Biwako-Nagahama_E.P_tutumi1.png|left|]] | [[File:Biwako-Nagahama_E.P_tutumi1.png|left|]] | ||
- | < | + | <html> |
+ | <div style> | ||
<table border="1"> | <table border="1"> | ||
<tr><td>1</td><td>500bp DNA ladder</td><td>10μL</td></tr> | <tr><td>1</td><td>500bp DNA ladder</td><td>10μL</td></tr> | ||
Line 166: | Line 167: | ||
<tr><td>8</td><td>-</td><td>-</td></tr> | <tr><td>8</td><td>-</td><td>-</td></tr> | ||
</table> | </table> | ||
- | </div></ | + | </div> |
+ | </html> | ||
[[File:Biwako-Nagahama_E.P_tutumi2.png|left|]] | [[File:Biwako-Nagahama_E.P_tutumi2.png|left|]] |
Revision as of 19:08, 27 September 2013
Contents |
Material & Method
CelC
Agro Notebook
5/31 Cloning of CelC and Restriction Enzyme
By Koki Tsutsumi
CelC gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CelC gene has restriction enzyme sites,EcoRI and BamHI.
Inverse PCR
※Restriction Enzyme sol.(line No.5 CelC_EcoRI)which has 1M NaCl dissolved in it, so, the band in lane no.5 appeared as upper-side.
CelC_Fw: TGACGAAAGCACTGATCTGC
CelC_Rv: GAAAAGATCGAAACGGTGG
TA cloning of CelC
16℃ 30min incubate
Ligation of CelC/pMD20 and Transformation in JM109.
Cells were stored on ice for 30min.
After 42℃ 30sec heat shock, cells were stored on ice for 2min.
Then cells were pre-cultured at 37℃ for 1hr, plated to Ampicillin plate.
6/1 Liquid clluture
CelC/pMD20 22 samples at 37°C, for overnight.
6/2 MiniPrep of CelC
Linear CelC/pMD20 DNA :2736bp. This CelC/pMD20 sample is cccDNA. So,white 6,white 7,white 8,white 9,white 14 probably picked up CelC/pMD20.
6/3 Restriction Enzyme of CelC/pMD20
CelC gene had produced clone from Agrobacterium tumefaciens C58, I confirmed whether it’s true or not. CelC/pMD20 gene has 2 restriction enzyme sites,BamHI
I confirmed the direction of CelC gene.
6/ Sequence of CelC/pMD20
7/18 PointMutation of CelC
CelC gene had Restriction Enzyme Site,EcoRI. We directed the EcoRI site.
Front
Fw1 Primer:
TATATATTCTAGATGAAGAGCGGGATTTCG
Rv2 Primer:
CATTATATCCGAACTCCGGCTG
Rear
Fw2 Primer:
AGCCGGAGTTCGGATATAATGC
Rv1 Primer:
CAGCACGAACTAGTATTATTATCATCGGC
7/19 Gel Purification of CelC gene’s Front Fragment and Rear Fragment
Front Fragment DNA and Rear Fragment DNA that 765bp and 347bp band performed Gel Purification by illustra GFX PCR Purification Kit.
7/21 CelC gene’s Front Fragment and Rear Fragment Overlap PCR
No.6,7,8,9,14 each fragment Overlap PCR completed.
I selected No.8.
7/22 Gel Purification of CelC gene No.8
No.8 DNA that about 1ooo bp band performed Gel Purification by illustra GFX PCR Purification Kit.
8/1 Adapter PCR of CelC gene No.8 (BioBrick Part)
Fw Primer:
GTTTCTTCGAATTCGCGGCCGCTTCTAGATG
Rv Primer:
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATC
8/11 BioBrick of CelC Restrict Enzyme ,EcoRI.
I confirmed BioBrick of CelC non-Restriction Enzyme ,EcoRI.
9/5 Brick Part of CelC and pSB1C3 Restrict Enzyme,EcoRI and PstI.
9/5 Ligation of CelC/pSB1C3 and Transformation in JM109.
9/7 Colony PCR of CelC/pSB1C3
CelC/pSB1C3 DNA(VR-VF2) :1370bp. So,No.5 and No.12 probably picked up CelC/pSB1C3
9/8 Miniprep of CelC/pSB1C3
Linear CelC/pSB1C3 DNA :3126bp. This CelC/pSB1C3 sample is cccDNA. So,No.5 and No.12 probably picked up CelC/pSB1C3.
9/15. Sequence of CelC Brick Part sequence.
Result of NCBI BLAST
CrdS
Cloning of CrdS and Restriction Enzyme
By Koki Tsutsumi
CrdS gene had produced clone from Agrobacterium tumefaciens C58, but I confirmed whether it’s true or not. CrdS gene has restriction enzyme sites,EcoRI and PstI.
1 | 500bp DNA ladder | 10μL |
2 | λ-HindⅢ | 12μL |
3 | CrdS | 12μL |
4 | - | - |
5 | - | - |
6 | - | - |
7 | - | - |
8 | - | - |