"
Team:UChicago/Plan
From 2013.igem.org
(Created page with "{{:Team:UChicago/Templates/Standard_header|}} <html> <div id="" class="subNav"> <ul> <li class=""> <a href="/Team:UChicago/Project">Return to P...") |
|||
| Line 30: | Line 30: | ||
<html> | <html> | ||
| + | |||
| + | pUB110 BioBrick | ||
| + | |||
| + | -Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration | ||
| + | -Digest pUB110 linker w/ NdeI and AflII | ||
| + | linker: | ||
| + | attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac | ||
| + | gtatgacatatgctgcagcggccgctactagtactctagaagcggccgcgaattccttaagacgaat | ||
| + | |||
| + | -Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick | ||
| + | -Transform into B. subtilis to amplify | ||
| + | -Set up O. N. cultures | ||
| + | -Do B. subtilis miniprep | ||
| + | -Digest our pUB110 BioBrick | ||
| + | To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing) | ||
| + | -Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly | ||
| + | -Do transformation in B. subtilis | ||
| + | -Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick | ||
| + | |||
| + | kerA BioBrick | ||
| + | |||
| + | -Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a | ||
| + | -Since promoter/upstream biobrick will be in chloramphenicol resistant vector | ||
| + | -And our puB110 vector will use kanamycin resistance | ||
| + | -So that leaves our kerA biobrick the vector that is amp resistant | ||
| + | |||
| + | Orange: prefix | ||
| + | Green: suffix | ||
| + | Purple: kerA Sac signal peptide | ||
| + | |||
</div> | </div> | ||
Revision as of 19:52, 27 September 2013
pUB110 BioBrick
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration
-Digest pUB110 linker w/ NdeI and AflII
linker:
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac
gtatgacatatgctgcagcggccgctactagtactctagaagcggccgcgaattccttaagacgaat
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick
-Transform into B. subtilis to amplify
-Set up O. N. cultures
-Do B. subtilis miniprep
-Digest our pUB110 BioBrick
To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing)
-Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly
-Do transformation in B. subtilis
-Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick
kerA BioBrick
-Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a
-Since promoter/upstream biobrick will be in chloramphenicol resistant vector
-And our puB110 vector will use kanamycin resistance
-So that leaves our kerA biobrick the vector that is amp resistant
Orange: prefix
Green: suffix
Purple: kerA Sac signal peptide
