"
Team:UChicago/Plan
From 2013.igem.org
| Line 26: | Line 26: | ||
<!-- insert your text between these two 'html' tags --> | <!-- insert your text between these two 'html' tags --> | ||
| - | |||
| - | |||
| - | |||
| - | |||
== '''Construct pUB110 BioBrick''' == | == '''Construct pUB110 BioBrick''' == | ||
| Line 87: | Line 83: | ||
Green: suffix | Green: suffix | ||
Purple: kerA signal peptide | Purple: kerA signal peptide | ||
| + | |||
| + | |||
| + | <html> | ||
| + | |||
</div> | </div> | ||
Revision as of 19:58, 27 September 2013
Construct pUB110 BioBrick
-Digest pUB110 w/ NdeI and AflII--> gel purify-->nanodrop for concentration
-Digest pUB110 linker w/ NdeI and AflII
Linker sequence:
attcgtcttaaggaattcgcggccgcttctagagtactagtagcggccgctgcagcatatgtcatac
-Set up overnight ligation of digested, gel purified pUB110 and digested pUB110 linker = generates pUB110 BioBrick
-Transform into B. subtilis to amplify
-Set up O. N. cultures
-Do B. subtilis miniprep
-Digest our pUB110 BioBrick
To test pUB110 Biobrick (kanamycin resistant) construction (send for sequencing)
-Put a promoter/upstream BioBrick (in vector with chloramphenicol resistance) + RFP BioBrick from amp resistant vector => do 3 step assembly
-Do transformation in B. subtilis
-Choose transformants--> if transformants express RFP, we could conclude our pUB110 BioBrick works--> submit pUB110 BioBrick
"Construct kerA BioBrick"
-Do Gibson assembly to put together the two kerA gBlocks from IDT
-Put our kerA biobrick into an empty vector w/ amp resistance (so we can use the 3 step assembly) and transform into DH5-a
-Since promoter/upstream biobrick will be in chloramphenicol resistant vector
-And our puB110 vector will use kanamycin resistance
-So that leaves our kerA biobrick the vector that is amp resistant
Orange: prefix Green: suffix Purple: kerA signal peptide
